ID: 960763298

View in Genome Browser
Species Human (GRCh38)
Location 3:121097093-121097115
Sequence GCAGCCAGGAAGTTTGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5574
Summary {0: 5, 1: 138, 2: 953, 3: 2182, 4: 2296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960763298_960763301 5 Left 960763298 3:121097093-121097115 CCCAGTTCAAACTTCCTGGCTGC 0: 5
1: 138
2: 953
3: 2182
4: 2296
Right 960763301 3:121097121-121097143 TTACTCTGTGAGCTTAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 181
960763298_960763303 29 Left 960763298 3:121097093-121097115 CCCAGTTCAAACTTCCTGGCTGC 0: 5
1: 138
2: 953
3: 2182
4: 2296
Right 960763303 3:121097145-121097167 TACTCAAGCTGCACCAGTGGTGG 0: 1
1: 0
2: 1
3: 86
4: 1270
960763298_960763302 26 Left 960763298 3:121097093-121097115 CCCAGTTCAAACTTCCTGGCTGC 0: 5
1: 138
2: 953
3: 2182
4: 2296
Right 960763302 3:121097142-121097164 GGCTACTCAAGCTGCACCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960763298 Original CRISPR GCAGCCAGGAAGTTTGAACT GGG (reversed) Intronic
Too many off-targets to display for this crispr