ID: 960778933

View in Genome Browser
Species Human (GRCh38)
Location 3:121295579-121295601
Sequence GAAAATTCACACATACTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960778933 Original CRISPR GAAAATTCACACATACTGCT AGG (reversed) Intronic
900510747 1:3059643-3059665 AAAAATCCACACATGATGCTGGG + Intergenic
900757660 1:4448112-4448134 GGAAATTCAGAAACACTGCTTGG - Intergenic
901233385 1:7653586-7653608 GAAGATGCTCACATACTGCCTGG + Intronic
903389599 1:22954534-22954556 GAAAATTCACAAATTCTCCTAGG + Intronic
903902109 1:26654813-26654835 GAGAATTCTCACACATTGCTGGG - Intergenic
912148498 1:106825030-106825052 GAAAATTCACAAATACTGAAAGG - Intergenic
912299760 1:108502911-108502933 GAAAACACACACAGACTTCTGGG + Intergenic
913134770 1:115877725-115877747 GGAAATTCACACATTATGCATGG + Intergenic
916670720 1:167017343-167017365 GAAGGTTCACCCATATTGCTAGG - Intronic
917708343 1:177657630-177657652 GAAAAATTACACAAACTGATGGG + Intergenic
917833310 1:178916648-178916670 GAAGATTCACACACACTATTTGG - Exonic
918802653 1:188991819-188991841 GAAAATTTACTTATACTGCAAGG + Intergenic
921089130 1:211826202-211826224 GTAAATTCATACATGCTTCTTGG - Intronic
922626475 1:227050339-227050361 GGGAACTCACACACACTGCTGGG + Intronic
924583872 1:245345056-245345078 GAAAATTTACCCTTGCTGCTGGG - Intronic
1063651838 10:7945835-7945857 GAAAATTCACAGTAAGTGCTAGG - Intronic
1064163133 10:12962930-12962952 GAAAACACACACATAAAGCTTGG - Intronic
1066638636 10:37533298-37533320 GAAAATTTATACAGACAGCTGGG + Intergenic
1070388422 10:75947759-75947781 GAAAACACACACATACTTCACGG + Intronic
1070395574 10:76008978-76009000 CCAAAATCACACATACTGCAGGG + Intronic
1070924231 10:80207568-80207590 GGAAATTCACACAGATTTCTTGG - Intergenic
1073285920 10:102388186-102388208 GAAAATTCACATATTTTTCTTGG - Intergenic
1073488047 10:103834125-103834147 GAAAATCCACACACTCTGCAAGG + Intronic
1073881248 10:107982839-107982861 TTAAATTCACACATTCTCCTTGG - Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1074589646 10:114800615-114800637 GAAAATCCACATATAAGGCTGGG + Intergenic
1074725927 10:116309793-116309815 GAAAAATCAGTAATACTGCTAGG + Intergenic
1074856742 10:117479550-117479572 GAGAATGCACACACAATGCTTGG - Intergenic
1074895717 10:117776097-117776119 CAAAAATCACACATAGTGTTGGG - Intergenic
1076001036 10:126913253-126913275 GGATATTCACACATCCTGCTTGG + Intronic
1076294076 10:129370537-129370559 GGAAATTCTCACATAGTGCTGGG + Intergenic
1076544967 10:131239020-131239042 GAAAATGCACACGTGCTACTTGG - Intronic
1081061211 11:38480150-38480172 GACAATTCAAACTGACTGCTTGG + Intergenic
1081511222 11:43775338-43775360 GAAAAGTAATACATACTCCTAGG + Intronic
1083487212 11:62990892-62990914 GACAACTCAGACATACTGCAGGG - Intronic
1084040004 11:66537144-66537166 GAAAGTCCATAGATACTGCTGGG - Intronic
1087295679 11:96370628-96370650 ATAAATTCACATATAATGCTTGG + Intronic
1088393520 11:109342128-109342150 GAAAATTGATACATGGTGCTGGG + Intergenic
1088863646 11:113825531-113825553 GAACATTCACATATAATCCTTGG - Intronic
1089854069 11:121525541-121525563 TAAAATTCTCACATACTGTTTGG - Intronic
1090343342 11:126045673-126045695 AAAAAGTCACACATTCGGCTGGG + Intronic
1094179630 12:27578297-27578319 AAAAATTCACACACACTGAGAGG - Intronic
1095847801 12:46764927-46764949 TAAAATTCATATATACTGCAGGG - Exonic
1097380527 12:58890288-58890310 TAAGATTCACACATATTGCTGGG + Intronic
1097743368 12:63271496-63271518 GAAAATTCTCACAGACTGTGTGG + Intergenic
1098186211 12:67899588-67899610 GCAAATGCACAAATACTTCTCGG + Intergenic
1099778134 12:87160802-87160824 GAAAATTTAAATATATTGCTTGG - Intergenic
1099949334 12:89283105-89283127 GAAAACTCCTCCATACTGCTGGG - Intergenic
1100158845 12:91833990-91834012 CAAAATTCACACAGGCTTCTGGG - Intergenic
1106381814 13:29246487-29246509 CAAAATTCCCACTAACTGCTTGG - Intronic
1107843825 13:44489920-44489942 GAACATTCACAGACACAGCTAGG + Intronic
1110466930 13:75813085-75813107 GATAATTCACGTAGACTGCTTGG + Intronic
1110697219 13:78504872-78504894 AAAAATACACATATACGGCTGGG - Intergenic
1112154016 13:96797772-96797794 GAGAATCCCCACACACTGCTTGG - Intronic
1118654506 14:67932668-67932690 CAACATTAGCACATACTGCTTGG - Intronic
1118874157 14:69768390-69768412 TAAAATTCAGACATAAGGCTGGG - Intronic
1120358615 14:83465635-83465657 GACAAGGCACACATACTACTCGG + Intergenic
1120836709 14:89044941-89044963 GCAAAGTCACAGATACTGCAAGG - Intergenic
1124009024 15:25820700-25820722 GAAAATTCAAAAATGCTGCTTGG + Intronic
1124387274 15:29220436-29220458 GAAAAATCACAAATACTGATCGG - Intronic
1125142474 15:36424971-36424993 AAAAATTCATTCATTCTGCTTGG - Intergenic
1126423034 15:48495298-48495320 AAAAATTCAAACATACACCTTGG + Intronic
1127023364 15:54775840-54775862 GACAATTCACCCATATTTCTGGG - Intergenic
1127346189 15:58102047-58102069 GGAAGTTCACATAAACTGCTTGG + Intronic
1128271139 15:66311077-66311099 AAGAATGTACACATACTGCTGGG + Intronic
1128791158 15:70434899-70434921 GAAAATCCAAACCTCCTGCTAGG + Intergenic
1130099980 15:80886028-80886050 GGAAATGAACACATACTGGTGGG + Intronic
1134624941 16:15716860-15716882 GAAAAGTCATATGTACTGCTGGG + Intronic
1135015690 16:18923241-18923263 GATACTTCACACATACTGACAGG - Intronic
1135321308 16:21499045-21499067 GATACTTCACACATACTGACAGG - Intergenic
1135374141 16:21930547-21930569 GATACTTCACACATACTGACAGG - Intergenic
1135402574 16:22176328-22176350 GAACATTCACATCTACTGCCTGG - Intronic
1135437645 16:22440174-22440196 GATACTTCACACATACTGACAGG + Intergenic
1137279052 16:46959588-46959610 GAAGTTTCTCACATACTACTTGG - Intronic
1138296956 16:55894969-55894991 GAAAGTTCTCACATATTCCTGGG + Intronic
1139109362 16:63870182-63870204 GAAAATTCAGTCATATTGTTAGG + Intergenic
1141712144 16:85705897-85705919 GAAAATGAACACACACTGCCGGG + Intronic
1142987487 17:3705133-3705155 GAAAGTTCACACATGCTGTGGGG - Intergenic
1143329916 17:6126222-6126244 ACAAATACATACATACTGCTGGG - Intergenic
1144291674 17:13832676-13832698 GAAAATCTACCCATACTCCTTGG - Intergenic
1145077124 17:19865758-19865780 TCAAAATCACAAATACTGCTTGG - Exonic
1148658642 17:49309153-49309175 TCATATTCACACACACTGCTTGG - Intronic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1151031912 17:70750813-70750835 GAAATGTCTCATATACTGCTGGG + Intergenic
1155065399 18:22265003-22265025 GAAAATCCACACGTGGTGCTGGG - Intergenic
1156678734 18:39564105-39564127 TAAAACTCAACCATACTGCTGGG + Intergenic
1157990735 18:52492715-52492737 GAAAAATCACACACACTGCGGGG - Intronic
1159386144 18:67727525-67727547 GAAAATACACACACACAGCCGGG + Intergenic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1163757905 19:19117642-19117664 AAAAATACACACACACTGCCGGG + Intergenic
1163772873 19:19201396-19201418 CACAATTCACACATTTTGCTTGG + Exonic
1166612175 19:44208478-44208500 GAACTTTCACAAATACTTCTAGG + Intronic
926232107 2:11012164-11012186 AAAACTTCCCACATGCTGCTGGG + Intergenic
927583741 2:24280025-24280047 GAAAATTCACACATCTGGCCAGG - Intronic
928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG + Intronic
929331559 2:40688066-40688088 ATATATTCAGACATACTGCTTGG - Intergenic
930345523 2:50175950-50175972 AGAAATTCACAAATACTGTTAGG + Intronic
930648776 2:53942905-53942927 GAAAATTCACACAGAATCATTGG - Intronic
931053124 2:58436688-58436710 AACAATCAACACATACTGCTTGG + Intergenic
933439130 2:82287893-82287915 GAAAATACAGACAGAATGCTCGG + Intergenic
934530963 2:95088539-95088561 CTAATTTCACACATACTGCAGGG - Intronic
936450643 2:112631311-112631333 GAAAAGACAAACATACCGCTAGG - Intergenic
938761875 2:134433556-134433578 AAAAATTCACACTCACTTCTGGG + Intronic
938882020 2:135600239-135600261 AAAAATTCATACAAACTGTTGGG - Intronic
941259274 2:163275645-163275667 GAAAATTAATACATCCTGTTTGG - Intergenic
941778114 2:169414642-169414664 GAAATTTTACAAATCCTGCTCGG + Intergenic
943519646 2:188932181-188932203 GAAAAATCACACTTACTAATAGG + Intergenic
943870088 2:192983952-192983974 GAAACATCACACACACTGTTGGG + Intergenic
943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG + Intergenic
944157332 2:196621143-196621165 GAACATTTAGACACACTGCTGGG - Intergenic
944223768 2:197328657-197328679 GAGAATTCATACCTACTGCATGG + Intergenic
945016417 2:205522970-205522992 TAAAATTCCCATATACTGTTTGG + Intronic
947184396 2:227442045-227442067 CAAAATTCACAGATACAGGTCGG - Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
1170064703 20:12298876-12298898 CAACATTCACATAAACTGCTTGG - Intergenic
1170970122 20:21107791-21107813 CAACACACACACATACTGCTAGG + Intergenic
1172044230 20:32068628-32068650 GAAAAATCACACTTTCAGCTGGG + Intronic
1172336915 20:34124226-34124248 GAAAATTCATAGATATGGCTGGG - Intergenic
1172508060 20:35478948-35478970 GAAGATGCACACATAATACTGGG - Intronic
1174555465 20:51392326-51392348 GGAACTCCACACATACTTCTGGG - Intronic
1174951635 20:55048393-55048415 GAAAATGCACACTTTCTGCCAGG + Intergenic
1179047858 21:37862226-37862248 TAAAATTCACACACAATGTTTGG - Intronic
949655682 3:6216127-6216149 GAAACTTCAAACATGCTGATTGG + Intergenic
954076320 3:48184054-48184076 TAAAATACACACATTCGGCTGGG + Intronic
954898539 3:53998381-53998403 GAATTTTCACACAGACTGCATGG + Intergenic
960778933 3:121295579-121295601 GAAAATTCACACATACTGCTAGG - Intronic
965937802 3:174136441-174136463 GAAAATTGACACTTACTGGGTGG + Intronic
968019626 3:195373632-195373654 GACAATTCACATATACTGCCAGG + Intronic
968114254 3:196077454-196077476 CAAAAGTGACACATACTGCTGGG + Intronic
969787292 4:9468938-9468960 TAAAATGCAGACATAATGCTGGG + Intergenic
971341441 4:25773090-25773112 TAAGATTCACACATCTTGCTGGG - Intronic
972012127 4:34197193-34197215 GAAAATTCAGAAAGACTGTTTGG + Intergenic
973001097 4:44951717-44951739 GAAATTTCACAGATAGTTCTAGG + Intergenic
974263023 4:59549155-59549177 GAAGATTAACACAAACTGCATGG + Intergenic
974358261 4:60840567-60840589 TCAAATTCACACATATTGCCTGG + Intergenic
974858016 4:67483839-67483861 TAAAATTCAACCATACTGTTTGG - Intronic
975053349 4:69894428-69894450 GTATATTGACACATGCTGCTCGG + Intergenic
975862122 4:78688798-78688820 GAAAATTCAAACATCCTTCTTGG + Intergenic
977246225 4:94634811-94634833 AAAAATTCACACGTACTACCGGG + Intronic
977859468 4:101938966-101938988 GATAAATCACAGCTACTGCTTGG - Intronic
978312587 4:107401474-107401496 GAAAATACACACAGAAGGCTGGG + Intergenic
978888095 4:113790097-113790119 AAAAATTCACACTGATTGCTAGG - Intergenic
979384192 4:120044529-120044551 AACAATTCACACAAAATGCTTGG + Intergenic
982895011 4:160909265-160909287 GAAACTTCAAATATACTGTTTGG - Intergenic
982974539 4:162037450-162037472 GAAGAATCACACATACAGCTTGG + Intronic
984501303 4:180562870-180562892 GGAAATTTACACATTCTACTGGG - Intergenic
986473605 5:8100729-8100751 CAAAATTCACACATACTTAAAGG + Intergenic
986590860 5:9368237-9368259 TAAAGTTCTCACATAATGCTTGG + Intronic
988121145 5:26964602-26964624 GATAATGCACTCATAGTGCTAGG - Intronic
992851292 5:80812282-80812304 GAAACTTCACACAAACAACTGGG - Intronic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
996884330 5:128338167-128338189 AAATATTCACACATACAGCGTGG + Intronic
998543916 5:143009522-143009544 GACAATGCACACAGAATGCTTGG + Intronic
1000208538 5:159087221-159087243 ATAAATTCACAGATACTGATGGG + Intronic
1001910337 5:175511945-175511967 GGAAATATACAAATACTGCTAGG + Intronic
1002832524 6:835846-835868 GAATATTCTCACATACTCTTGGG + Intergenic
1005773772 6:29106122-29106144 GAAAATTCACATATACAACATGG - Intergenic
1008930625 6:56935205-56935227 GATGATTCAGACATACAGCTAGG + Intronic
1010858387 6:80872487-80872509 GAAAATTCACAGCTCTTGCTGGG + Intergenic
1011451297 6:87495308-87495330 TAACATTTACACATCCTGCTAGG - Intronic
1011491253 6:87895848-87895870 GAAAATTCAAAAATATTCCTCGG + Intergenic
1013228710 6:108141652-108141674 GAAGTTTAACACATACTGATAGG + Intronic
1013646542 6:112147560-112147582 GAAATTTCACAAGTACTGCCTGG + Intronic
1015702345 6:136050338-136050360 GAAAATTCACAGAGAGGGCTTGG - Intronic
1017193521 6:151677910-151677932 GAAAACTCACACATTCTCTTAGG + Intronic
1020375063 7:7476179-7476201 GCATATACACACATACTGCCCGG - Intronic
1020864749 7:13544828-13544850 GAATTTTCATACATACTGTTAGG + Intergenic
1021029246 7:15709462-15709484 TAAAATGCACACACACTGCCTGG + Intergenic
1021472300 7:21018365-21018387 AAACACACACACATACTGCTGGG + Intergenic
1022253622 7:28633198-28633220 GACAATTCAAACAGACTGGTTGG + Intronic
1025784153 7:64628844-64628866 GAAAATTGTGACATATTGCTGGG + Intergenic
1028695669 7:93708400-93708422 GAAAATACACACATACGCCATGG + Intronic
1029139176 7:98397877-98397899 TAAAATACACACATCCTCCTGGG + Intronic
1030667192 7:112292338-112292360 GAAAATTGACACCAACTGTTTGG - Intronic
1031259607 7:119501721-119501743 TAAAATCCACACATACAGCCAGG + Intergenic
1031695737 7:124850805-124850827 GAAAATTAACACACATTTCTTGG - Intronic
1031951776 7:127900130-127900152 GAAAATTCACAGATACTTTAGGG + Intronic
1032200127 7:129815224-129815246 AAAAAGTAACACATAGTGCTGGG - Intergenic
1033089707 7:138373979-138374001 TAAAAGTCACACATACTGGCTGG - Intergenic
1035607094 8:936967-936989 GAAAGTTCACACATAAGCCTAGG - Intergenic
1038204256 8:25450009-25450031 AAAAAACCACACATACTGCTTGG + Intronic
1039251956 8:35675852-35675874 GAAAATTCTCACATATTGTCTGG + Intronic
1039476919 8:37843676-37843698 GAAAACCCACACACACTCCTTGG + Exonic
1040931993 8:52745268-52745290 GATAATTCTCAAATAATGCTAGG - Intronic
1041697926 8:60757070-60757092 GAAATTTCCCACATTCTGCTGGG + Intronic
1042433786 8:68740579-68740601 AAAAATTAACAGATACTGGTGGG + Intronic
1042441788 8:68836525-68836547 AAAAAATCACACACACTGATGGG + Intergenic
1042495682 8:69452562-69452584 AAAAACTCACTCATACTCCTTGG - Intergenic
1042697339 8:71569591-71569613 TAAAACTCATACATTCTGCTGGG + Intronic
1043991766 8:86764368-86764390 GAAAATTCACATATAGAGTTAGG - Intergenic
1049055737 8:140235668-140235690 GAGAGTTCATACATAGTGCTGGG + Intronic
1049618310 8:143586155-143586177 GAAAAATCAGACATGCTGCTTGG + Intronic
1051726738 9:20095528-20095550 GAAAATTCCCCCTGACTGCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052940687 9:34129872-34129894 AAAAAATCAAACACACTGCTGGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057751898 9:97799309-97799331 GAAAAATCTCACAAACTCCTCGG - Intergenic
1058246099 9:102627011-102627033 GAAACAACACACATACTCCTAGG - Intergenic
1058916256 9:109568689-109568711 GAAAACACACACATGCTGCCTGG - Intergenic
1059538568 9:115108162-115108184 AAAAATCCAAACATACTGCTTGG - Intronic
1059645858 9:116266596-116266618 TAAAATCCACACTTACTGATTGG - Intronic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1186256190 X:7723123-7723145 GAAAGTTTAAACATGCTGCTTGG - Intergenic
1187025001 X:15425738-15425760 TTAAATTGACAAATACTGCTGGG - Intronic
1187328451 X:18313775-18313797 GAAAATTCATACATACTGGTTGG - Intronic
1187516182 X:19973491-19973513 GAAAAGACACACATAAGGCTGGG - Intergenic
1187916245 X:24154902-24154924 GAATATTCTCACATACAGGTGGG + Intronic
1188776046 X:34220061-34220083 GAAAATCGAGACATACTACTTGG + Intergenic
1190300700 X:49055330-49055352 GAAGATTCATACATACCCCTGGG - Intronic
1190336089 X:49262751-49262773 TAAAAATCACACATAGGGCTTGG + Intronic
1195087323 X:101424618-101424640 GAAAATTCTCCCATACATCTGGG + Intronic
1195351000 X:103997004-103997026 TAAAATTCTCAAATACTTCTTGG - Intergenic
1197162969 X:123344708-123344730 GGAAATTCACCCAGACTCCTGGG - Intronic
1197855970 X:130914462-130914484 GTAAAATCACAAATACTCCTGGG + Intergenic
1198470865 X:136945604-136945626 GAAAATTTACAAATTGTGCTTGG + Intergenic
1198651974 X:138873078-138873100 GAGCATTCACAAATATTGCTGGG - Intronic
1200855644 Y:7935198-7935220 GAATATTATGACATACTGCTGGG - Intergenic
1202071902 Y:21000624-21000646 GAAAATTGTGACATATTGCTGGG - Intergenic
1202263702 Y:22996041-22996063 GAATATTATAACATACTGCTGGG + Intronic
1202416692 Y:24629782-24629804 GAATATTATAACATACTGCTGGG + Intronic
1202454095 Y:25040304-25040326 GAATATTATAACATACTGCTGGG - Intronic