ID: 960784647

View in Genome Browser
Species Human (GRCh38)
Location 3:121358596-121358618
Sequence CCCACCAGGCCCCACCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 2, 1: 3, 2: 9, 3: 75, 4: 819}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960784639_960784647 10 Left 960784639 3:121358563-121358585 CCATTAGAAACCACCACCATGAT 0: 5
1: 129
2: 269
3: 624
4: 964
Right 960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG 0: 2
1: 3
2: 9
3: 75
4: 819
960784641_960784647 -3 Left 960784641 3:121358576-121358598 CCACCATGATTCAGTCACCTCCC 0: 138
1: 1814
2: 8001
3: 11252
4: 11538
Right 960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG 0: 2
1: 3
2: 9
3: 75
4: 819
960784638_960784647 15 Left 960784638 3:121358558-121358580 CCAAACCATTAGAAACCACCACC 0: 2
1: 7
2: 35
3: 219
4: 630
Right 960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG 0: 2
1: 3
2: 9
3: 75
4: 819
960784642_960784647 -6 Left 960784642 3:121358579-121358601 CCATGATTCAGTCACCTCCCACC 0: 116
1: 1598
2: 6824
3: 10842
4: 10999
Right 960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG 0: 2
1: 3
2: 9
3: 75
4: 819
960784640_960784647 0 Left 960784640 3:121358573-121358595 CCACCACCATGATTCAGTCACCT 0: 13
1: 100
2: 1135
3: 4724
4: 7336
Right 960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG 0: 2
1: 3
2: 9
3: 75
4: 819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960784647 Original CRISPR CCCACCAGGCCCCACCTCCT GGG Intronic
900265087 1:1753302-1753324 CCCACCCCCACCCACCTCCTGGG - Intronic
900352326 1:2241095-2241117 CCCGCAGGGCCCCACCTTCTGGG - Intronic
900427417 1:2586941-2586963 TCCACCCGGCCTCACCTCCCCGG - Exonic
900428860 1:2592640-2592662 CCTGCCAGGCCCCACCTTATAGG + Exonic
900476178 1:2877430-2877452 CACACCAGCCCCCAGCTTCTCGG - Intergenic
900501989 1:3010637-3010659 CCCTGCAGCCTCCACCTCCTGGG - Intergenic
900612980 1:3552234-3552256 CCCACCAGGGCCAGCCTCCCAGG + Intronic
900624235 1:3600853-3600875 CTCACCTGGCCCCCGCTCCTGGG - Intronic
900641346 1:3689438-3689460 CTCTCCAGGCCCCAGCCCCTTGG + Intronic
900645964 1:3708870-3708892 CCCACGAGGCCCCGCCTCCCCGG + Intronic
900832768 1:4977118-4977140 CACTCCAGGCCCCACCCCTTGGG - Intergenic
900963085 1:5938098-5938120 GACACCAGGCTCCACCTCCAAGG - Intronic
901109566 1:6784718-6784740 CCCGCCAGGCCCCGCCCCCTCGG - Intergenic
901167496 1:7230627-7230649 CCCTCCACCCTCCACCTCCTTGG - Intronic
901461552 1:9394898-9394920 CCCATCATGCCCCGGCTCCTCGG - Intergenic
901463317 1:9404585-9404607 CTCACCTGGCCCCACCTCTGCGG - Intergenic
901487107 1:9571711-9571733 CCCTGCAACCCCCACCTCCTGGG + Intronic
901932329 1:12603510-12603532 CCCACGTGGCCCTACCTTCTTGG + Intronic
902042325 1:13502001-13502023 CACTGCAAGCCCCACCTCCTGGG + Intronic
902275289 1:15335147-15335169 CCCAGCAGGCCTCACCTTGTGGG - Intronic
902520202 1:17011594-17011616 CCAACCAGGTCCCGCTTCCTGGG + Intronic
902640243 1:17762385-17762407 CAGACCAGGCCCCACCCCCTGGG + Intronic
902891867 1:19450066-19450088 CACTGCAGCCCCCACCTCCTGGG - Intronic
903478839 1:23638534-23638556 CCCATCAGTCCCCTCCTTCTGGG - Intronic
903785435 1:25858089-25858111 CCCTGCAAGCCCCACCTCCGGGG - Intronic
904438418 1:30514336-30514358 TCCATCAGGTCCCACCCCCTGGG + Intergenic
904649445 1:31993691-31993713 CTCAGCAGCCTCCACCTCCTGGG + Intergenic
904696742 1:32335609-32335631 CCCGCCGGGCCCCAGCTCCGCGG + Intronic
904717690 1:32481430-32481452 CCCACCGAGCCCCAGCACCTAGG + Intronic
904865876 1:33578500-33578522 CCCTGCAGCCTCCACCTCCTGGG - Intronic
905161758 1:36042158-36042180 CACTGCAGCCCCCACCTCCTGGG + Intronic
905323224 1:37132268-37132290 CCCACCAGAACCCACCTGGTGGG - Intergenic
905693951 1:39961422-39961444 CACAGCAAGCTCCACCTCCTGGG + Intronic
905816493 1:40954879-40954901 CCCACCCCGCCCCACCCCCGTGG - Intergenic
906124812 1:43421282-43421304 CCCTCCAGGCTCCACCACCCCGG + Exonic
906161249 1:43650511-43650533 CCCTCCCGGCCCCGCCGCCTTGG - Intronic
906480242 1:46194764-46194786 CCCACCCCACCCCATCTCCTAGG + Intronic
906770329 1:48477476-48477498 CACTGCAGACCCCACCTCCTGGG - Intergenic
907312243 1:53545288-53545310 CCCATCAGGCCCCCTGTCCTTGG - Intronic
908007417 1:59741240-59741262 CCCACCAGGGCCCTCCTCACTGG - Intronic
908539900 1:65112330-65112352 CCTGCCAGGCCCCACCTCAGGGG + Intergenic
908586803 1:65578502-65578524 CCCACCACTCCTCACCCCCTGGG - Intronic
908791628 1:67788411-67788433 CCCTGCAGCCCCTACCTCCTGGG + Intronic
909231354 1:73094111-73094133 ACCACCACTCCCCATCTCCTGGG - Intergenic
909600741 1:77458725-77458747 CCCACCAGGTCCCACCATATGGG + Intronic
909756282 1:79230062-79230084 TCCACCTGGCTCCACCTCCAGGG + Intergenic
910696687 1:90026037-90026059 CACTGCAGGCTCCACCTCCTGGG + Intronic
910849721 1:91638290-91638312 CACAACAGCCTCCACCTCCTGGG + Intergenic
910947291 1:92608073-92608095 CACTGCAGGCTCCACCTCCTGGG - Intronic
911061222 1:93749511-93749533 CACTGCAAGCCCCACCTCCTGGG - Intronic
912395159 1:109336731-109336753 CCCTGCAGCCCCCACCTCCCGGG - Intronic
912419580 1:109533844-109533866 CACTGCAAGCCCCACCTCCTGGG - Intergenic
912627713 1:111220038-111220060 AGCACCAGGCCTCTCCTCCTAGG - Intronic
912680104 1:111723531-111723553 CCCACCCTGCCCCACTTCCCTGG - Exonic
912881776 1:113423345-113423367 CACTGCAAGCCCCACCTCCTGGG + Intronic
912895133 1:113578315-113578337 GGCAACAGGCCCCACCTCTTAGG + Intronic
912929236 1:113941833-113941855 CACTGCAAGCCCCACCTCCTGGG + Intronic
913380215 1:118202392-118202414 CCCACCAGGTCTCACCTTTTGGG + Intergenic
914172147 1:145234577-145234599 CCCAGCAAGCTCCTCCTCCTTGG - Intergenic
914995939 1:152543459-152543481 CCCACCATGCCCCACATCCTGGG + Intronic
915162667 1:153931050-153931072 TCCCCCAGGCCCCATCTCCTTGG - Exonic
915326514 1:155083649-155083671 CCCCCCTGACCCCACTTCCTTGG - Intronic
915579894 1:156807262-156807284 CCCACCAGCCCCCACCCGCCTGG - Exonic
916074365 1:161191778-161191800 CCTTCCAAGCCCCACTTCCTTGG + Intronic
916161103 1:161915698-161915720 CACTCCAGCCTCCACCTCCTGGG + Intronic
916196494 1:162228544-162228566 TTCACCAGGCCCCTCCTCCTTGG - Intronic
916352681 1:163869542-163869564 CCCTGCAAGCTCCACCTCCTGGG - Intergenic
916722507 1:167495019-167495041 GCCACCAGCCCTCCCCTCCTTGG - Intronic
917528865 1:175815047-175815069 CCCAGGAGGCCCCACCTTCCTGG - Intergenic
918019454 1:180671598-180671620 CACTGCAGCCCCCACCTCCTGGG + Intronic
918082421 1:181217838-181217860 CCCACCAAACACCACCACCTTGG - Intergenic
918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG + Intronic
918427465 1:184425339-184425361 CCCTGCAGCCTCCACCTCCTGGG + Intronic
919644043 1:200074659-200074681 CACTGCAGGCTCCACCTCCTGGG - Intronic
919646045 1:200095626-200095648 CACTCCAAGCTCCACCTCCTGGG + Intronic
919692841 1:200542989-200543011 CCCTGCAAGCTCCACCTCCTGGG + Intergenic
919902669 1:202055790-202055812 CCCTGCAGTCTCCACCTCCTGGG + Intergenic
920409658 1:205749608-205749630 CCCAAGAGGCCCCACCTCCTCGG - Intronic
920499638 1:206478034-206478056 CCCACCCTGCCCCACCATCTTGG + Intronic
920775007 1:208927433-208927455 CACTGCAAGCCCCACCTCCTGGG - Intergenic
921031481 1:211338698-211338720 CACTGCAGCCCCCACCTCCTGGG + Intronic
921868633 1:220112937-220112959 CACAGCAGCCTCCACCTCCTGGG + Intronic
922501345 1:226098974-226098996 CCCACCAGGCCCCACCTCATAGG - Intergenic
922722225 1:227904958-227904980 GCACCCAGGCCCCTCCTCCTAGG + Intergenic
923031102 1:230249579-230249601 CCCACCAAGCCCCTTTTCCTGGG - Intronic
923785051 1:237058628-237058650 GCCACCACGCCCCGCCTCCAAGG - Intronic
924762237 1:246998890-246998912 CACTACAAGCCCCACCTCCTGGG - Intronic
924771702 1:247085603-247085625 CCCCTCAGGCAGCACCTCCTGGG + Intergenic
1062883153 10:995024-995046 CCTAGCCTGCCCCACCTCCTGGG - Intronic
1063250147 10:4264894-4264916 CTCACCAGGCTCCACTCCCTGGG - Intergenic
1063381822 10:5590546-5590568 CCCACCGCGCCCCCCCTCCCTGG + Intergenic
1063586019 10:7352932-7352954 CACTGCAAGCCCCACCTCCTGGG - Intronic
1064145632 10:12824057-12824079 GCCACCATGCGCCACCTCCAAGG - Intronic
1065557359 10:26930320-26930342 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1066471440 10:35701798-35701820 CCCACCAGGTGCCATGTCCTGGG + Intergenic
1066573534 10:36800488-36800510 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1067436848 10:46284647-46284669 GCCACCAGGCCCCGCCTTCCTGG + Intergenic
1067441262 10:46310286-46310308 CCCGGCAGGCTCCTCCTCCTGGG - Intronic
1067552454 10:47245299-47245321 CCCACCAGCCCCAGCCTCTTAGG + Intergenic
1067577912 10:47419551-47419573 CCCAGCAGGCTCCTCCTCCCAGG - Intergenic
1067713877 10:48672002-48672024 CCCACCAGCCCCAGCCTCCCAGG + Intergenic
1067737560 10:48870055-48870077 GCCAACAGGCACCACCCCCTAGG - Intronic
1069014533 10:63414060-63414082 CACTGCAAGCCCCACCTCCTGGG + Intronic
1069912396 10:71767530-71767552 CCCGCCAGGCCCCATCCCCCAGG + Intronic
1071772026 10:88739777-88739799 CACTGCAGGCTCCACCTCCTGGG - Intronic
1072424265 10:95316164-95316186 GCCACCATGCCCAGCCTCCTCGG - Intronic
1072676089 10:97467263-97467285 GCCACCATGCCCCGCCTCCTGGG + Intronic
1072676144 10:97467737-97467759 CCCTGCAGCCCCGACCTCCTAGG + Intronic
1073205897 10:101769167-101769189 CCCGCCAGGCCCATCCTCCGAGG + Intergenic
1073785651 10:106886184-106886206 CACAGCAGCCTCCACCTCCTGGG - Intronic
1074379841 10:112970397-112970419 GCCACCAGGACCCTCCTCCAGGG + Intronic
1075188998 10:120288887-120288909 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1075258463 10:120943729-120943751 CCTCCCAAGCCCCACCTCCAGGG + Intergenic
1075740012 10:124689589-124689611 ACCATCAGGCCCCACATCCAAGG + Intronic
1075903810 10:126063843-126063865 TCCTCCATGCCCCACCTTCTGGG - Intronic
1076202031 10:128566631-128566653 CCCACTGGGCCCAACCTCCCAGG - Intergenic
1076573589 10:131449208-131449230 CCCACAGGGCCCCACTTCTTGGG + Intergenic
1076605780 10:131689140-131689162 CCCACCTGCCCCCACCTCCCAGG + Intergenic
1076624450 10:131812915-131812937 GTCCCCAGCCCCCACCTCCTCGG + Intergenic
1076649899 10:131980854-131980876 GCCACCAGGTCCCTCCTCCGAGG + Intronic
1076910469 10:133385657-133385679 CACTGCAAGCCCCACCTCCTGGG + Intronic
1076981972 11:209361-209383 TCCACCAGGCCCTTCTTCCTGGG - Intronic
1077247156 11:1545206-1545228 CCATGCGGGCCCCACCTCCTGGG + Intergenic
1077263762 11:1638519-1638541 CTCTCCAGGGCCCAGCTCCTCGG + Intergenic
1077439518 11:2561526-2561548 ACCAGCAGTGCCCACCTCCTAGG - Intronic
1077487671 11:2846539-2846561 GCCCCCAGGTCCAACCTCCTAGG + Intronic
1077907611 11:6546274-6546296 CCCACCCAGCCCCAGCTCCTTGG + Exonic
1078085621 11:8231660-8231682 CCCACCCCTCCCCACCTCCCCGG + Intronic
1078463193 11:11530896-11530918 CCCACTTGACCCTACCTCCTTGG - Intronic
1079056023 11:17207580-17207602 CCCACCAGGCCCCTCTTCTCGGG - Intronic
1079064326 11:17276554-17276576 CCCACCAGGCTCCACAGCTTCGG + Intronic
1079117743 11:17651353-17651375 CCCACCAGACCCATCTTCCTGGG - Intergenic
1079237023 11:18698583-18698605 CCCCCCAGGCCCCGCCCCCTTGG - Intronic
1080831780 11:35900671-35900693 CACTGCAGCCCCCACCTCCTGGG - Intergenic
1081007109 11:37758175-37758197 CACAGCAAGCTCCACCTCCTGGG - Intergenic
1081446851 11:43139023-43139045 CGCTCCAGGCCCCAGCACCTTGG + Intergenic
1082001077 11:47394095-47394117 CACACCAGCATCCACCTCCTCGG + Intergenic
1082078433 11:47993366-47993388 CCCTGCAGCCTCCACCTCCTGGG + Intronic
1083163252 11:60868420-60868442 CACACCAGGCCACGCCTACTAGG - Intronic
1083308269 11:61771978-61772000 TCCTCCAGGCCCCCCCACCTTGG + Intronic
1083611461 11:64006407-64006429 CTCACCAGGCCCCACCCTCTCGG + Intronic
1083624032 11:64062853-64062875 CCACCCCGGCCCCGCCTCCTAGG + Intronic
1083676535 11:64328815-64328837 ACCACCAGCCTCTACCTCCTGGG + Intergenic
1084190077 11:67494751-67494773 CCCCCCAGCACCCCCCTCCTCGG - Intronic
1084503690 11:69552510-69552532 CCCACGATGCCCCAAATCCTAGG - Intergenic
1084557366 11:69883083-69883105 CCCACCAGCCCCTGCCTCCGTGG + Intergenic
1084942683 11:72621494-72621516 CACAGCAGGTCCCACCTGCTCGG + Intronic
1084965418 11:72741880-72741902 CCCACCAAGTCCCTCCTCCTTGG - Intronic
1085395118 11:76203343-76203365 GCCTCCTGGCCCCACCTCCGTGG + Intronic
1085402498 11:76243195-76243217 CCCACCAGGCCCACTTTCCTGGG - Intergenic
1085757099 11:79210960-79210982 CACAAAAAGCCCCACCTCCTTGG + Intronic
1085976490 11:81661389-81661411 CCCACCAGGCCCCTCAACATTGG + Intergenic
1086158969 11:83699632-83699654 CACTGCAGGCTCCACCTCCTGGG - Intronic
1086333305 11:85775556-85775578 CACTCCAGCCTCCACCTCCTGGG + Intronic
1086466407 11:87058693-87058715 CACTGCAAGCCCCACCTCCTGGG + Intronic
1088292835 11:108260108-108260130 CACTGCAGCCCCCACCTCCTAGG + Intronic
1088952269 11:114583867-114583889 CCCATAAGTCCCCATCTCCTGGG - Intronic
1089159055 11:116423908-116423930 CCCGTGAGGACCCACCTCCTGGG - Intergenic
1089452598 11:118608288-118608310 TCCCCAAGGCCCCACGTCCTCGG + Intronic
1089747515 11:120627604-120627626 CCCAGCAGGGCCTGCCTCCTGGG - Intronic
1089970598 11:122689968-122689990 CCCACCAAACCCCGCCTTCTTGG + Intronic
1090248727 11:125236372-125236394 CACCCCCCGCCCCACCTCCTAGG - Intronic
1090402311 11:126456654-126456676 CACACCAGGCCCCAAGTCCACGG - Intronic
1091254707 11:134173264-134173286 CCCACCATCCCCCGCCTCCCTGG - Intronic
1091677390 12:2501131-2501153 CACAGCAAGCTCCACCTCCTGGG - Intronic
1091781724 12:3218225-3218247 CCCACCAACCCCAACTTCCTCGG + Intronic
1092185181 12:6473543-6473565 CACTGCAAGCCCCACCTCCTGGG + Intergenic
1092492269 12:8956268-8956290 CCCACCAGCCCACGGCTCCTGGG - Intronic
1092822446 12:12365243-12365265 CACTCCAGCCTCCACCTCCTGGG + Intronic
1094648435 12:32350399-32350421 CACTGCAGCCCCCACCTCCTGGG - Intronic
1096324763 12:50649778-50649800 CACAGCAGCCTCCACCTCCTAGG - Intronic
1096561262 12:52437639-52437661 GCCACCTGGCCCCATGTCCTGGG - Intergenic
1096617882 12:52844541-52844563 CCCCCCAGGTCCCACCACCTTGG + Exonic
1096792070 12:54051695-54051717 ACCACCAAGCACCAGCTCCTTGG + Intronic
1097062846 12:56298964-56298986 CCCTGCAGCCTCCACCTCCTGGG - Intronic
1097112125 12:56668030-56668052 CACTCCAGCCTCCACCTCCTGGG - Intronic
1098110838 12:67120012-67120034 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1098134858 12:67391488-67391510 CCCACCACGCCCCTTCCCCTTGG + Intergenic
1099294769 12:80816333-80816355 CCCCACAGCCCCGACCTCCTGGG - Intronic
1099751516 12:86779835-86779857 CACAGCAAGCTCCACCTCCTGGG - Intronic
1099989663 12:89708928-89708950 CCCCGCAGGACCCGCCTCCTCGG + Intronic
1100987802 12:100220909-100220931 CACACCAACCTCCACCTCCTGGG - Intronic
1102022716 12:109695240-109695262 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1102337640 12:112095359-112095381 CACTGCAAGCCCCACCTCCTGGG - Intronic
1102559980 12:113754934-113754956 CTTCCCAGGCCCCATCTCCTGGG - Intergenic
1102574513 12:113847690-113847712 CTCACCCGGACCTACCTCCTGGG - Intronic
1102769344 12:115460537-115460559 CACTGCAAGCCCCACCTCCTGGG + Intergenic
1103233373 12:119351041-119351063 CCCACCAGTCCCCAGCTGCAGGG + Intronic
1103435385 12:120921350-120921372 CACTGCAAGCCCCACCTCCTGGG - Intergenic
1104837026 12:131798226-131798248 CACAGCAGCCTCCACCTCCTGGG - Intronic
1105279437 13:18954582-18954604 CCCACCACGCTCCACCTGCAGGG - Intergenic
1105426787 13:20301566-20301588 ACCACCAGGCCCCACGCCCTGGG + Intergenic
1105725654 13:23160130-23160152 CCCACCACTCCACACCTCCCGGG - Intergenic
1105745771 13:23375652-23375674 CCCGCCAGGCCCCGCCCCCAGGG + Intronic
1105745804 13:23375757-23375779 CCCACCAGGCTCCGCCTGCCAGG + Intronic
1105896922 13:24724464-24724486 CACAGCAGCCTCCACCTCCTGGG + Intergenic
1106335371 13:28778422-28778444 CCCCCGAGGCCCCAGCTCCCTGG - Intergenic
1106651977 13:31700978-31701000 CCCACCACTACTCACCTCCTAGG + Intergenic
1107108591 13:36672990-36673012 CCCACCAGGGCCCGGCTCCTAGG - Intergenic
1107472349 13:40702613-40702635 CCCTGCAGCCTCCACCTCCTGGG - Intergenic
1108442265 13:50466846-50466868 CCCACCTGGCCCCTCATCCTTGG - Intronic
1109711710 13:66169404-66169426 CCCTGCAGCCCCAACCTCCTGGG + Intergenic
1110806546 13:79761077-79761099 CCCTGCAAGCTCCACCTCCTGGG + Intergenic
1110856486 13:80302765-80302787 CACAGCAAGCTCCACCTCCTGGG + Intergenic
1112326477 13:98445541-98445563 CACCCCAGGCCCCACTTCCTGGG + Intronic
1113487424 13:110664439-110664461 CACTCTAGGCCCAACCTCCTGGG - Intronic
1113766949 13:112887787-112887809 ACCACCAGGTCCCAACTTCTGGG + Intergenic
1113841185 13:113362770-113362792 CCCACCAGGTCCCTACTGCTCGG + Intronic
1113961436 13:114128465-114128487 CCTCCCTGGCCCCAGCTCCTGGG - Intronic
1113982863 13:114290544-114290566 CCCCACAGGCCCCACCTCAGAGG - Intronic
1114403295 14:22430113-22430135 ACCATCAGGCTCCACCTCTTTGG + Intergenic
1114484684 14:23055717-23055739 CTCACCAGGCCCCACATGTTTGG + Exonic
1114577679 14:23728721-23728743 CCCTCCAGATCCCACCTCATGGG - Intergenic
1114950853 14:27751801-27751823 CACTGCAGCCCCCACCTCCTGGG + Intergenic
1115657317 14:35455996-35456018 CCCTGCAGCCTCCACCTCCTGGG + Intergenic
1115986211 14:39105460-39105482 CACTGCAGGCTCCACCTCCTGGG - Intronic
1116075095 14:40100960-40100982 CACAGCAGTCTCCACCTCCTGGG + Intergenic
1117419075 14:55525671-55525693 CCCTGCAGCCTCCACCTCCTGGG + Intergenic
1117451432 14:55853829-55853851 CACTGCAGGCTCCACCTCCTAGG + Intergenic
1117456802 14:55905942-55905964 CCCCCAAGGCCCCTCCTCCAAGG + Intergenic
1117694496 14:58345804-58345826 CCCTCCAGCCTCCACTTCCTGGG + Intronic
1117827907 14:59722871-59722893 CACTGCAGGCCCGACCTCCTGGG + Intronic
1118084720 14:62401128-62401150 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1118509990 14:66461370-66461392 CACTGCAGCCCCCACCTCCTAGG - Intergenic
1118641740 14:67798885-67798907 GCCACCAGGCCCCGCCCCCGGGG + Intronic
1119065808 14:71525256-71525278 CACTGCAAGCCCCACCTCCTGGG + Intronic
1119388273 14:74272603-74272625 CCCTGCAGCCTCCACCTCCTAGG - Intergenic
1119705823 14:76781989-76782011 GCCAGCAGCCCCCACCTCCAGGG - Exonic
1119834757 14:77738502-77738524 CACTGCAGCCCCCACCTCCTGGG - Intronic
1121015348 14:90545665-90545687 CCCACCAGTCCCTTCCTGCTGGG + Intronic
1121110903 14:91312310-91312332 CACTGCAGGCTCCACCTCCTGGG - Intronic
1121487153 14:94326026-94326048 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1122262070 14:100529392-100529414 CACCCCAGGCCCCACGTACTGGG + Intronic
1122364820 14:101188356-101188378 CCCGCCACGCCCCACTACCTTGG + Intergenic
1122546991 14:102528612-102528634 CCCACGTGGCCTCCCCTCCTAGG - Intergenic
1122885483 14:104708580-104708602 CCTCCCCGTCCCCACCTCCTTGG - Exonic
1122958624 14:105084264-105084286 CCCTACAAGCCCCACGTCCTGGG + Intergenic
1122983282 14:105201112-105201134 CCCTCCAGGCCTCACCCCTTCGG - Intergenic
1124347598 15:28932841-28932863 TCCATAAGGCCCCATCTCCTTGG - Intronic
1125585213 15:40814790-40814812 GCCACCAGTCCCCACCATCTTGG + Exonic
1125596336 15:40889024-40889046 CACAGCAACCCCCACCTCCTGGG - Intergenic
1126232124 15:46339336-46339358 CACTGCAAGCCCCACCTCCTGGG + Intergenic
1127063657 15:55214358-55214380 CACAGCAAGCTCCACCTCCTGGG - Intronic
1127797112 15:62448065-62448087 TCCAACAGGCCCCAACGCCTTGG + Intronic
1128865609 15:71113111-71113133 CACTGCAGGCTCCACCTCCTGGG - Intronic
1129698638 15:77754897-77754919 ACCACCAGGCCCCATCTTATAGG - Intronic
1129765938 15:78167368-78167390 CCCAACAAGCTCCACCGCCTCGG + Intronic
1130087026 15:80786310-80786332 CCCTGCAGCCCCAACCTCCTAGG + Intronic
1130398187 15:83523373-83523395 CCCACCCCGCACCACTTCCTAGG - Intronic
1131077976 15:89510215-89510237 CCGACCATGCCCTACCTCCATGG - Intergenic
1131341811 15:91609424-91609446 CCCAGCAGGCCACACCTCTGTGG - Intergenic
1131830520 15:96352077-96352099 CCCTCCACGCCCCACCCCCCCGG - Intergenic
1132126774 15:99234444-99234466 CCCTGCAAGCTCCACCTCCTGGG + Intronic
1132493737 16:249651-249673 CCCACCAGTCCTCACCTACCTGG - Exonic
1132584054 16:698460-698482 CCCACCAGGCCCACCCCTCTGGG + Intronic
1132594950 16:744622-744644 CACTGCAAGCCCCACCTCCTGGG + Intronic
1132687529 16:1168552-1168574 CCCACCTGTCACCACCTCCAGGG - Intronic
1132797042 16:1729715-1729737 CCAACCAGCTCCCTCCTCCTGGG - Intronic
1132940666 16:2506427-2506449 CACTGCAAGCCCCACCTCCTGGG + Intronic
1132959085 16:2612319-2612341 CCCCACAGGCCCTGCCTCCTGGG - Intergenic
1132972145 16:2694294-2694316 CCCCACAGGCCCTGCCTCCTGGG - Intronic
1133110452 16:3544978-3545000 GCCACCACGCCCAACCTCCTTGG + Intronic
1133276116 16:4639370-4639392 CCCACCCCGCCCCACCTTCCCGG - Intronic
1133969923 16:10560227-10560249 TCCTCCAGGTCCCACATCCTGGG + Intronic
1134206383 16:12241746-12241768 GCCACCAGGCCCAGCCTCCCTGG + Intronic
1134255735 16:12609951-12609973 CACTCCAGCCCCTACCTCCTGGG + Intergenic
1134539450 16:15053236-15053258 GGCCCCAGGCCCCACATCCTGGG - Intronic
1134820664 16:17244253-17244275 CCCCCAAGGCCCCACCCCCAGGG - Intronic
1134836803 16:17368157-17368179 CTCTCCACTCCCCACCTCCTGGG - Intronic
1134868521 16:17630566-17630588 CCCAACAGGGGACACCTCCTTGG + Intergenic
1135521643 16:23182691-23182713 CCGGCCAGGCCCCGCCCCCTAGG - Intergenic
1135522353 16:23187182-23187204 CCCTGCAGCCCCGACCTCCTGGG + Intronic
1136094448 16:27944999-27945021 CACTCCAGCCTCCACCTCCTGGG - Intronic
1136101850 16:28002543-28002565 CACTCCAGCCCCCACCTCCTGGG - Intronic
1136455737 16:30378760-30378782 CGCCCCAGGCCCTGCCTCCTGGG - Intronic
1136469324 16:30468534-30468556 CCCTGCAAGCTCCACCTCCTGGG + Intergenic
1136498915 16:30659970-30659992 CCCATTAGGCCCCACCTGCAAGG - Exonic
1136563278 16:31054048-31054070 CACTGCAAGCCCCACCTCCTGGG + Intergenic
1136663693 16:31789522-31789544 CACTGCAGCCCCCACCTCCTGGG - Intronic
1136999052 16:35213075-35213097 AGCTCCAGGCCCCACCTCTTTGG + Intergenic
1137598239 16:49738845-49738867 ACCACCAGGCGCCACATTCTAGG + Intronic
1137725647 16:50654921-50654943 CCCTCCAGGCCCATTCTCCTGGG - Intergenic
1138019457 16:53464867-53464889 CACAGCAAGCTCCACCTCCTGGG + Intronic
1138117485 16:54372131-54372153 CTCATCAGACGCCACCTCCTCGG - Intergenic
1138599497 16:58046337-58046359 CCCACCAGCCCCCTCTCCCTGGG - Exonic
1138675663 16:58649400-58649422 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1139438437 16:66950152-66950174 CACTGCAGCCCCCACCTCCTGGG - Intergenic
1139438483 16:66950495-66950517 CCCACCAGCTCCCACCTGCCTGG - Intergenic
1139605211 16:68013323-68013345 CCCTGCAAGCTCCACCTCCTGGG - Intronic
1139712847 16:68789771-68789793 GCCACCGGGCCCAGCCTCCTGGG - Intronic
1139850595 16:69949848-69949870 CACACCTGGTCCCAGCTCCTTGG + Intergenic
1139876599 16:70151008-70151030 CACTGCAAGCCCCACCTCCTGGG + Intronic
1139879579 16:70172760-70172782 CACACCTGGTCCCAGCTCCTTGG + Intergenic
1140201159 16:72895746-72895768 CCCTTCAGCCTCCACCTCCTGGG - Intronic
1140865228 16:79054748-79054770 CACAGCAGCCTCCACCTCCTGGG - Intronic
1141089638 16:81121391-81121413 CACTGCAGCCCCCACCTCCTGGG - Intergenic
1141101762 16:81202695-81202717 CCCACCAGTTCACATCTCCTGGG - Intergenic
1141660851 16:85440755-85440777 CCAGCAAGGCCCCACCTCCACGG - Intergenic
1141770213 16:86085330-86085352 CCCCCCAGGCCCCACCCCACTGG + Intergenic
1141939708 16:87266793-87266815 CACTGCAAGCCCCACCTCCTGGG - Intronic
1141984004 16:87567957-87567979 CACTGCAGGCCCCGCCTCCTGGG + Intergenic
1141992083 16:87616307-87616329 CACTACAGGCTCCACCTCCTGGG + Intronic
1142059881 16:88022501-88022523 CCCACTAGGTACCACCACCTGGG - Intronic
1142117532 16:88367686-88367708 TGCACCAGGCCCCGCATCCTTGG + Intergenic
1142285235 16:89168910-89168932 CCCTCCACGCCCCACACCCTGGG + Intergenic
1142302607 16:89267333-89267355 CACAGCAGCCTCCACCTCCTGGG + Intergenic
1142473338 17:175660-175682 CACACCAGATCCCAGCTCCTGGG - Intronic
1142595973 17:1030248-1030270 CCCACCAGGCACCTCCTCAAAGG + Intronic
1142717668 17:1755777-1755799 CCCACGCTGCCCCAGCTCCTGGG - Intergenic
1142977884 17:3656237-3656259 CCCACCAGTCCTCACCCCCTGGG + Intronic
1143018262 17:3903394-3903416 CCCACCACGCCCCAAAGCCTGGG + Intronic
1143102900 17:4513993-4514015 CCCACCAGCCCCTCCCTCCAGGG + Intronic
1143160547 17:4867312-4867334 GCCACCATGCCCTACCTCTTAGG + Intronic
1143160868 17:4869981-4870003 CACTGCAGGCCCCACCTCCAGGG + Intronic
1143264432 17:5625530-5625552 CACTGCAAGCCCCACCTCCTGGG + Intergenic
1143297738 17:5883788-5883810 CACGCCCGGCCCCTCCTCCTTGG + Intronic
1143400568 17:6639921-6639943 CCCGGCAAGCCCCACCACCTCGG + Intronic
1143484017 17:7243105-7243127 CCCAGCCGGCCCCGCCTCCCCGG - Intronic
1143731475 17:8885162-8885184 CTCCCCAGGGCCCACCTGCTGGG + Intronic
1143731588 17:8885456-8885478 CTCCCATGGCCCCACCTCCTGGG + Intronic
1143731656 17:8885620-8885642 CCCCCATGGCCCCACCTCCTGGG + Intronic
1143731694 17:8885702-8885724 CTCCCATGGCCCCACCTCCTGGG + Intronic
1143731709 17:8885735-8885757 CTCCCATGGCCCCACCTCCTGGG + Intronic
1143731739 17:8885801-8885823 CTCCCATGGCCCCACCTCCTGGG + Intronic
1143949392 17:10620654-10620676 CTCACCAGACCCCACCTTCCAGG - Intergenic
1144266524 17:13574640-13574662 CACTGCAGGCTCCACCTCCTGGG - Intronic
1144313524 17:14036831-14036853 CCCATCAGGCCCCACCTCCAAGG + Intergenic
1144481154 17:15630071-15630093 CCTACCAGGCCCCACGTCCCTGG + Intronic
1144487161 17:15676508-15676530 CGCTGCAAGCCCCACCTCCTGGG + Intronic
1144528351 17:16011254-16011276 CACAGCAAGCTCCACCTCCTGGG + Intronic
1144690140 17:17256101-17256123 CACAACAAGCTCCACCTCCTGGG - Intronic
1144800001 17:17919629-17919651 TCCCCCATGCCCCACTTCCTGGG - Intronic
1144830322 17:18127470-18127492 CCCACCTGGCCTCACCTTCCTGG + Intronic
1144852340 17:18250431-18250453 CGCCCTTGGCCCCACCTCCTTGG + Intronic
1144917156 17:18733660-18733682 CCTACCAGGCCCCACGTCCCTGG - Intronic
1145007286 17:19344837-19344859 CCCACCAGCCCCCAACCCCAAGG + Intronic
1145733308 17:27210150-27210172 CGCAGCAGCCTCCACCTCCTGGG + Intergenic
1145856406 17:28162559-28162581 CCCTGCAGCCTCCACCTCCTGGG - Intronic
1145909343 17:28533515-28533537 CCCACCAGGGCACGCCCCCTGGG + Intronic
1145942984 17:28753166-28753188 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1146054212 17:29573196-29573218 CCCACCCGGACCCTCGTCCTAGG + Intergenic
1146451104 17:32974695-32974717 GCCACCATGCCCCACCTCAGAGG - Intronic
1146526229 17:33569239-33569261 CCTTGCAGGCCCCACCTCCAGGG - Intronic
1146628631 17:34454275-34454297 CCCGCCAGGCCACATTTCCTGGG - Intergenic
1146848075 17:36197271-36197293 CACCACAGCCCCCACCTCCTGGG - Intronic
1147670527 17:42174404-42174426 CCCACCAGGCACCATCAGCTGGG - Intronic
1148108012 17:45129761-45129783 CCCTCCAGTCCCCCGCTCCTGGG - Intronic
1148152359 17:45404357-45404379 CCCACCAAGTCCCTCCTCCCAGG + Intronic
1148248059 17:46048489-46048511 CACTGCAGCCCCCACCTCCTGGG - Intronic
1148540692 17:48478116-48478138 CACTGCAGCCCCCACCTCCTGGG + Intergenic
1148646078 17:49220226-49220248 CCCACCTCTCCCCAGCTCCTTGG + Exonic
1148686630 17:49504707-49504729 CCCTCCAGGCCCTTCTTCCTGGG + Intronic
1148907379 17:50919921-50919943 CCCAGCAGGCCCCACTGCCTTGG - Intergenic
1149349771 17:55774867-55774889 CTCCCCCCGCCCCACCTCCTGGG - Intronic
1149745434 17:59093072-59093094 CCCTGCAGCCTCCACCTCCTGGG - Intronic
1149911979 17:60575057-60575079 CCCTCCAGTCTCCACCTCCAAGG - Intronic
1149931055 17:60756103-60756125 CCCACCACGCCCCCCATCCATGG - Intronic
1150751262 17:67864878-67864900 CACTCTAGGCTCCACCTCCTGGG + Intronic
1150854504 17:68738274-68738296 TTCGCCAGGCCCCTCCTCCTTGG - Intergenic
1151597648 17:75088054-75088076 CCCCCCGGGCCCCACTGCCTCGG + Intronic
1151946149 17:77321024-77321046 CCTCCCAGGCCCAGCCTCCTTGG + Intronic
1152267865 17:79306738-79306760 CCCACCTGAGCCAACCTCCTAGG + Intronic
1152572102 17:81125389-81125411 CCCATCAATTCCCACCTCCTGGG - Intronic
1152618781 17:81350500-81350522 CCAACCAGGCCCCACCCCGCAGG + Intergenic
1152737833 17:82005921-82005943 CACACCAGGGCCCACCGCATGGG - Intronic
1153252309 18:3135022-3135044 CACTGCAGCCCCCACCTCCTGGG + Intronic
1154031649 18:10758519-10758541 CACTGCAAGCCCCACCTCCTGGG + Intronic
1154349075 18:13568049-13568071 CCCCCCACCCCCCACCTCCTCGG - Intronic
1155333688 18:24743961-24743983 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1156316721 18:35976223-35976245 CACTGCAAGCCCCACCTCCTGGG + Intronic
1156521246 18:37724038-37724060 CCCACCTGGCAGCAACTCCTGGG + Intergenic
1156636943 18:39042825-39042847 CCCTGCAAGCTCCACCTCCTGGG - Intergenic
1156961662 18:43039422-43039444 CACTGCAGGCCCCGCCTCCTGGG + Intronic
1157334661 18:46729150-46729172 CCCACCAGGCCGTCCCACCTTGG + Intronic
1157356675 18:46941484-46941506 CCCACCCCTCCCCACCTCCAAGG - Intronic
1157502431 18:48200959-48200981 CACCCCAGGCACCACCCCCTTGG + Intronic
1157529795 18:48410460-48410482 CCCGCCGGGCCCCGCCCCCTCGG + Intronic
1158485333 18:57861235-57861257 CCCCCCAGGCTCCACCCCCTGGG + Intergenic
1159046638 18:63375169-63375191 CCCTGCAGCCTCCACCTCCTGGG - Intergenic
1159067300 18:63584984-63585006 CACTCCAAACCCCACCTCCTGGG + Intergenic
1159095249 18:63894508-63894530 CCCACCCCATCCCACCTCCTTGG - Intronic
1159347284 18:67222593-67222615 CCCTGCAGCCTCCACCTCCTGGG - Intergenic
1160236159 18:77088040-77088062 CCCTCCAGGCCACACCTACGGGG + Intronic
1160527849 18:79547862-79547884 CCCACGAGCCCCCACCACTTTGG + Intergenic
1160568682 18:79801966-79801988 CCCACCCTGACCCACCACCTGGG - Intergenic
1160688166 19:446942-446964 GCCACCGGGACCCACCTCATAGG + Intronic
1160702618 19:515323-515345 CACAGCAGCCTCCACCTCCTGGG - Intronic
1160958987 19:1709115-1709137 CCTACCAGTCTCCACCCCCTGGG + Intergenic
1161112949 19:2479774-2479796 CCCTGCAGCCTCCACCTCCTGGG + Intergenic
1161193500 19:2972861-2972883 CCCTGCAGTCCCAACCTCCTGGG - Intergenic
1161306918 19:3573556-3573578 CCCATCAGACCCTGCCTCCTCGG + Intronic
1161321561 19:3643933-3643955 CCCAGCAGCCCCCACTCCCTGGG + Intronic
1161327789 19:3671743-3671765 CTCACCTGCCCCCACCCCCTGGG - Intronic
1161497673 19:4596468-4596490 CCCCCCAGGCCCCTCCTCCCTGG - Intergenic
1161521313 19:4725187-4725209 CCCTGCAGCCTCCACCTCCTGGG + Intergenic
1161722857 19:5913352-5913374 CCCACCCAGGCCCACCTCCAAGG - Intronic
1161801330 19:6418124-6418146 CCCACACCCCCCCACCTCCTCGG + Intronic
1161880624 19:6949244-6949266 CCCTGCAGCCTCCACCTCCTGGG + Intergenic
1161950016 19:7462683-7462705 ATCACCAGGACCCACCTCCCAGG - Intronic
1162111997 19:8404465-8404487 TCCGCCAGGCGCCAGCTCCTAGG + Intronic
1162138871 19:8573233-8573255 CACTGCAAGCCCCACCTCCTAGG - Intronic
1162336829 19:10066774-10066796 CCCTGCAAGCTCCACCTCCTGGG - Intergenic
1162373296 19:10291385-10291407 CCTCCCAGGCCCCGCCCCCTGGG + Intronic
1162551031 19:11358340-11358362 GCCACCACGCCCGGCCTCCTAGG + Intronic
1162614488 19:11786391-11786413 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1162644915 19:12041712-12041734 CACTGCAGGCTCCACCTCCTGGG - Intronic
1162675448 19:12294921-12294943 CCCTCCAGGTCCCGCCTCCTGGG + Intergenic
1162792020 19:13068027-13068049 CACTGCAAGCCCCACCTCCTGGG - Intronic
1162802533 19:13118965-13118987 CCCGCCGTGCCCCACTTCCTGGG - Intronic
1162959089 19:14115838-14115860 CCCAGCTGGCCTCACCTGCTGGG + Intronic
1163377145 19:16940196-16940218 GCCACCACGCCCGGCCTCCTGGG + Intronic
1163466216 19:17469929-17469951 TCAGCCAGGCCCCACCCCCTAGG - Intronic
1163468608 19:17484045-17484067 ACCACCAGGCCCCACCCTCTGGG - Intronic
1163665150 19:18599745-18599767 CCCACCAGGAGCCACCGCCGAGG - Exonic
1163927965 19:20363257-20363279 CCCACCTGGCCACTCCCCCTTGG - Intergenic
1164932662 19:32187232-32187254 CCCTCCTGGCCTTACCTCCTTGG - Intergenic
1165051324 19:33143257-33143279 CACTGCAGGCACCACCTCCTGGG - Intronic
1165146315 19:33733122-33733144 CCCACCAGGACCCATCTCATTGG + Intronic
1165547124 19:36548925-36548947 CCCTGCAGCCTCCACCTCCTGGG - Intronic
1165766739 19:38356376-38356398 CCCACCAGCCCCTCCGTCCTTGG - Intronic
1165838554 19:38773514-38773536 CCCAGCAGGCCCCACCACCACGG - Intergenic
1165841005 19:38789183-38789205 CCCAGCAGGCCCCACCACCACGG + Intergenic
1166076973 19:40419430-40419452 CCCAGGAGGCCACACCACCTTGG - Intergenic
1166332793 19:42088427-42088449 CCCATCAAGTCCCACCACCTGGG - Intronic
1166746399 19:45143913-45143935 CACTCCAGCCCCCGCCTCCTGGG + Intronic
1166746432 19:45144087-45144109 CACTGCAAGCCCCACCTCCTGGG + Intronic
1166993993 19:46710667-46710689 CCCTCCCAGCTCCACCTCCTAGG + Intronic
1167108903 19:47447483-47447505 CCCACCAGGCCCCGCCCACGTGG + Intronic
1167269324 19:48498786-48498808 CCCCCCCGCCGCCACCTCCTCGG - Exonic
1167327329 19:48834582-48834604 GCCCCCAGGCCCTACTTCCTCGG - Intronic
1167327355 19:48834656-48834678 GCCCCCAGGCCCTACTTCCTCGG - Intronic
1167327433 19:48834877-48834899 GCCCCCAGGCCCTACTTCCTCGG - Intronic
1167327485 19:48835024-48835046 GCCCCCAGGCCCTACTTCCTCGG - Intronic
1167327536 19:48835171-48835193 GCCCCCAGGCCCTACTTCCTCGG - Intronic
1167407062 19:49317728-49317750 CACTGCAAGCCCCACCTCCTGGG - Intronic
1167596684 19:50432015-50432037 CTCCCCAGGCCCCGCCCCCTCGG + Intergenic
1167612387 19:50513786-50513808 CCCACCACGCCCACCCTCCACGG + Exonic
1167672059 19:50859130-50859152 CCCTCTAGGCCCCTCCTCCCAGG - Intronic
1167674807 19:50877543-50877565 CCCTCCCGGCCCCTCCTCCCAGG - Intronic
1167855602 19:52236292-52236314 CCACCCAGGCTTCACCTCCTGGG - Intergenic
1168108818 19:54180720-54180742 CCCAGCAGCCCCCACCTCCAAGG - Intronic
1168121464 19:54254534-54254556 CACACTTGGCCCCATCTCCTGGG - Intronic
1168242892 19:55096103-55096125 CCCACCAGGCCGGCGCTCCTTGG + Exonic
1168403046 19:56097096-56097118 CCCACCAGCCCCCAGCTCCACGG + Intronic
1168410210 19:56135153-56135175 CACAGCAAGCTCCACCTCCTGGG - Intronic
1168623072 19:57894288-57894310 CCCTGCAACCCCCACCTCCTGGG - Intronic
1168635164 19:57990462-57990484 CCCTGCAGCCTCCACCTCCTGGG - Intronic
925057939 2:869700-869722 CCCACCAGGTCCCACCTCCAGGG - Intergenic
925427483 2:3762702-3762724 CCCACCAGGCCCCACCTCCAAGG + Intronic
925689361 2:6505530-6505552 CCCTCCATGCTCCAGCTCCTGGG - Intergenic
925856333 2:8133115-8133137 CCCACTCTGCCCCACATCCTGGG - Intergenic
926056192 2:9775507-9775529 CCGACCAGGACCCACCTCTGAGG - Intergenic
926098092 2:10095602-10095624 CCCACCTCGCCCCAGCTCATCGG - Intergenic
926141595 2:10371416-10371438 CCCACCCCACCCCACCCCCTGGG - Intronic
926217665 2:10915317-10915339 CCCAGCAGGCCCCTTCTTCTGGG + Intergenic
926702244 2:15811329-15811351 CCCACCAGGCTCCTCCTCCGAGG - Intergenic
926800297 2:16654069-16654091 CCCACCAGCTCCCACCTCACAGG - Intronic
926825452 2:16901531-16901553 CCCACCATGCCCCCCATCCTGGG + Intergenic
927148809 2:20184173-20184195 AGCACCAGGGCCCACCTCCGAGG - Intergenic
927199278 2:20568392-20568414 CCCGCCCGGCTCCAGCTCCTAGG - Intronic
927200474 2:20575246-20575268 CCCACCAGGCTCCTCACCCTTGG - Intronic
927466219 2:23338785-23338807 TCCACCAGGCCCCCTTTCCTTGG - Intergenic
928978107 2:37110144-37110166 CACAGCAGCCCCCACCTCCCAGG + Intronic
929904814 2:46036512-46036534 CACTGCAGTCCCCACCTCCTGGG - Intronic
930051479 2:47219363-47219385 TCCACCTGGCCCCAGCCCCTTGG - Intergenic
930189311 2:48441177-48441199 ACCGCCCGGCCCCATCTCCTGGG - Intronic
931463897 2:62470555-62470577 ACAACCAGCCCTCACCTCCTTGG + Intergenic
932143241 2:69297623-69297645 CCCCACAGGCAGCACCTCCTGGG + Intergenic
932202945 2:69848630-69848652 CACTGCAGGCTCCACCTCCTAGG - Intronic
932471438 2:71962029-71962051 CCCTCCAGGCCCCAGCTCACAGG + Intergenic
933684699 2:85133679-85133701 CCCACCATGCCCCAGCTCGGCGG + Exonic
934653362 2:96104603-96104625 CCCACCAAGGCCCACCCACTCGG + Intergenic
935165118 2:100563243-100563265 CCCACCAGGACCCACGGCCTGGG + Intronic
935443516 2:103131661-103131683 CCCTCCAGCCTCCACCTCCTAGG - Intergenic
935970057 2:108522603-108522625 CCCTCCAAGCTCCACCTCCCGGG + Intergenic
936103383 2:109603308-109603330 CACTGCAAGCCCCACCTCCTGGG + Intronic
936295069 2:111261718-111261740 CCCACTAGGGCCCACCTCCAGGG - Intergenic
936558392 2:113515547-113515569 CGCTCCAGGCCCCAGCCCCTTGG - Intergenic
936600323 2:113889406-113889428 CCCCCCAACCCCCACCTCCCAGG - Intergenic
938114903 2:128596309-128596331 CCCGGCAGGCTCCACCTCCTTGG + Intergenic
938247783 2:129792367-129792389 CCCAGCAGGCCACACATCCAGGG + Intergenic
938542838 2:132299858-132299880 CACTGCAGGCTCCACCTCCTTGG + Intergenic
938818527 2:134929723-134929745 CGCTCCAGCCTCCACCTCCTGGG + Intronic
938829381 2:135035319-135035341 CACTGCAGGCCCTACCTCCTGGG - Intronic
939140677 2:138350832-138350854 CCCTGCAGCCTCCACCTCCTGGG - Intergenic
939743129 2:145935200-145935222 AACACCAGGCCCCAGATCCTGGG + Intergenic
940336848 2:152538353-152538375 CACTGCAAGCCCCACCTCCTGGG + Intronic
940829228 2:158449521-158449543 CACTGCAGCCCCCACCTCCTGGG + Intronic
941136741 2:161726831-161726853 CACTGCAGCCCCCACCTCCTAGG - Intronic
941431738 2:165422224-165422246 CCCACCAGGCCCCTCCCACCAGG + Intergenic
941607307 2:167615367-167615389 TCCACCAGGCCCCAACCCCTTGG - Intergenic
942826765 2:180187066-180187088 CCCTGCAGCCCCCACCTCCCAGG - Intergenic
944408735 2:199415670-199415692 CTCACCAGGCACAACCTCATTGG - Intronic
945058269 2:205886674-205886696 CACAGCAGCCCCTACCTCCTGGG - Intergenic
945296219 2:208174026-208174048 CCCAGCAGCCTCCACCTCCCAGG + Intronic
945463522 2:210139983-210140005 TCCACCGGGCTACACCTCCTTGG + Intronic
946027063 2:216678301-216678323 CCCTTCAGCCCCCACCCCCTGGG - Intronic
946122473 2:217528489-217528511 CCCTGCAAGCTCCACCTCCTGGG + Intronic
946223838 2:218251527-218251549 CCAGCCAGGCTCAACCTCCTGGG + Intronic
946561040 2:220914160-220914182 CGCAGCAGCCTCCACCTCCTGGG + Intergenic
947367852 2:229415084-229415106 CACACCAACCTCCACCTCCTGGG - Intronic
947601868 2:231456375-231456397 TCCACTGGGCCCCACCTGCTTGG - Intronic
947789567 2:232856614-232856636 CACAGCAAGCTCCACCTCCTGGG - Intronic
947845574 2:233241178-233241200 CCCTCAAGGTCCCATCTCCTTGG - Intronic
948055066 2:235004963-235004985 CATACCAAGCCCTACCTCCTGGG - Intronic
948226859 2:236318120-236318142 CCCACCCCGCCCGCCCTCCTTGG + Intergenic
948884292 2:240875197-240875219 CCTGCCAGGCCTCACATCCTGGG - Exonic
948929953 2:241125813-241125835 CCCACCAGCCCCCACCTCAGTGG - Intronic
948944825 2:241214207-241214229 CCCTGCAGCCTCCACCTCCTGGG - Intronic
948989315 2:241544275-241544297 CACTGCAGCCCCCACCTCCTAGG + Intergenic
949028408 2:241776889-241776911 CCCCCGAGGTCCCACCGCCTCGG - Exonic
949039968 2:241843737-241843759 CCCACCAGCCCCCAGGGCCTTGG + Intergenic
949073113 2:242038792-242038814 CCCACCGGGACCCACCACCGAGG - Intergenic
1168958039 20:1848509-1848531 CTCACCTGGCCCCACCTGCCAGG + Intergenic
1169073246 20:2746513-2746535 CCCAGCAGGCAGCCCCTCCTTGG - Intronic
1169096088 20:2900032-2900054 CACTGCAGCCCCCACCTCCTGGG - Intronic
1169158109 20:3351406-3351428 CACTCCAGCCTCCACCTCCTAGG - Intronic
1169567785 20:6874338-6874360 TCGCCCAGGCTCCACCTCCTGGG - Intergenic
1170555376 20:17510722-17510744 CTGGGCAGGCCCCACCTCCTGGG + Intronic
1170695570 20:18655160-18655182 CCCACCAGACCTCATTTCCTAGG - Intronic
1170865510 20:20151752-20151774 CACTGCAGGCTCCACCTCCTGGG - Intronic
1171000329 20:21408653-21408675 CTCAGCAGCCTCCACCTCCTGGG + Intergenic
1171052123 20:21869800-21869822 CCCTACAGCCTCCACCTCCTGGG + Intergenic
1171210123 20:23310438-23310460 CCCACCAGCCCCCACGACATGGG + Intergenic
1171466960 20:25336608-25336630 CGCCACAGACCCCACCTCCTCGG + Intronic
1171871712 20:30532691-30532713 CACTGCAGGCTCCACCTCCTTGG + Intergenic
1172063744 20:32205382-32205404 CCCTCCAGGCACCATCTCCTGGG + Intronic
1172759409 20:37311561-37311583 CACGGCAGCCCCCACCTCCTGGG + Intronic
1172967135 20:38844968-38844990 CCCACCCCACCCCACCCCCTGGG + Intronic
1173006149 20:39141234-39141256 GCCACCAGGCGCTACCTCCATGG + Intergenic
1173110671 20:40185172-40185194 CCCACCAGACCCCTCCTCTGGGG + Intergenic
1173618825 20:44420740-44420762 CACAGCAGCCTCCACCTCCTGGG - Intronic
1173748151 20:45453747-45453769 CCCTCCAGCCCCCATCTTCTCGG - Intergenic
1173904065 20:46613171-46613193 ACCCCCAGGCCCCACCCCCAGGG - Intronic
1174583882 20:51592690-51592712 TCCTCCATGCCCCACCCCCTCGG + Intergenic
1175394044 20:58646458-58646480 CCCAACAGGCCCCACCTAAATGG - Intergenic
1175667458 20:60872488-60872510 CACACCAGGCTCAAACTCCTTGG - Intergenic
1175769956 20:61617297-61617319 CACACCAGGCCCCAGGTGCTGGG - Intronic
1175790644 20:61738063-61738085 CCCTCTGGGGCCCACCTCCTTGG + Intronic
1175831475 20:61967315-61967337 CCCAGCAAGCTCCAGCTCCTTGG + Intronic
1175998571 20:62821997-62822019 CCCACCAGCCCCCACTCCCACGG - Intronic
1176039701 20:63058902-63058924 CCTACAGGGCCCCACCACCTGGG - Intergenic
1176044240 20:63084116-63084138 CCCACCAGGCACCGCCCCGTGGG - Intergenic
1176120566 20:63452814-63452836 CCCACCGGGACCCTCCTCGTGGG + Intronic
1176183335 20:63764042-63764064 CACACCAGCCTCGACCTCCTGGG + Intronic
1176510625 21:7745196-7745218 GCCGCCAGGCCCCACCTGCGGGG + Intronic
1176704920 21:10108144-10108166 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1177146350 21:17411302-17411324 CCCTGCAGCCTCCACCTCCTGGG + Intergenic
1177169741 21:17641805-17641827 CCCAACAGGCCCCACCTGGGAGG + Intergenic
1177546677 21:22567896-22567918 CACTGCAAGCCCCACCTCCTGGG + Intergenic
1177774412 21:25551891-25551913 CCCACCAGGCCCTACCTCCAAGG + Intergenic
1178027659 21:28486537-28486559 CACACCAGCCTCCACCTCCCGGG - Intergenic
1178644738 21:34375725-34375747 GCCGCCAGGCCCCACCTGCGGGG + Exonic
1178850036 21:36205462-36205484 CCCTGCAGCCTCCACCTCCTGGG + Intronic
1178992699 21:37367865-37367887 CCCCCCAGGCCCCGGCTCCCGGG - Intronic
1179416660 21:41203780-41203802 CTCACCAGGCTCCTCCTCCTTGG - Intronic
1179966829 21:44812130-44812152 CCCTGCAGCCTCCACCTCCTGGG + Intronic
1180002203 21:45000290-45000312 CCCACCCATCCCCACCTCCGTGG + Intergenic
1180665379 22:17506727-17506749 CCCCGCAGCCTCCACCTCCTGGG + Intronic
1180734993 22:18009790-18009812 CGCAGCAGCCTCCACCTCCTGGG - Intronic
1180842208 22:18964708-18964730 CCCACCATGGCCGGCCTCCTGGG + Intergenic
1180877486 22:19181467-19181489 CCCCCCAGACCCCAGCTCATGGG - Intronic
1180922789 22:19530446-19530468 GCCACCATGCCCAGCCTCCTGGG + Intergenic
1181059291 22:20274173-20274195 CCCACCATGGCCGGCCTCCTGGG - Intronic
1181277222 22:21694674-21694696 GCCGCCACGCCCCACCTCCCTGG - Intronic
1181310774 22:21943677-21943699 CCCTCCAGGCCCTCCCACCTTGG + Intronic
1181528809 22:23504429-23504451 CCCCCCAGGCCCTCCCTCCCTGG + Intergenic
1182361460 22:29748885-29748907 CACTGCAGCCCCCACCTCCTGGG + Intronic
1182739062 22:32553748-32553770 TTCACCAGGCCCCACCTCACTGG - Intronic
1183362378 22:37389446-37389468 CCCACCTGTCCCCATCCCCTGGG + Intronic
1183702853 22:39459537-39459559 CACAGCAGCCCCAACCTCCTGGG + Intronic
1184052495 22:42018237-42018259 CTCACCAACCTCCACCTCCTGGG - Intronic
1184586220 22:45449965-45449987 CACAGCAGTCTCCACCTCCTGGG + Intergenic
1184645087 22:45891165-45891187 CCCCGCCGGCCCCACCTCCGCGG + Intergenic
1184695201 22:46135123-46135145 CACACCAGTGACCACCTCCTAGG - Intergenic
1184704136 22:46198734-46198756 CACTGCAGGCTCCACCTCCTGGG + Intronic
1185237116 22:49720529-49720551 CCCAGCAGCCCCCACCTCCTGGG + Intergenic
1185326270 22:50227309-50227331 CCCAGCAGGCCCTCCCTCCCAGG + Intronic
1185340208 22:50287655-50287677 CCCACCACGCACCTCCCCCTGGG + Exonic
1185343194 22:50300534-50300556 CCCGCCCCGCCCCAGCTCCTAGG - Intronic
1185381140 22:50507961-50507983 GCCCCCAAGCCCCGCCTCCTCGG + Intergenic
1185408633 22:50671686-50671708 CCCACCAGACCCCACCGGCCAGG - Intergenic
949550032 3:5104978-5105000 CCCACCACTCCCTACCTCTTTGG + Intergenic
949900448 3:8810458-8810480 CACAGCAGTCTCCACCTCCTGGG - Intronic
949996824 3:9624214-9624236 CACTACAGCCCCCACCTCCTGGG + Intergenic
950097133 3:10336982-10337004 CCAGCCTGCCCCCACCTCCTGGG - Intronic
950662279 3:14473953-14473975 TCCACCAGGCCCCACTTCCTGGG - Intronic
951492835 3:23291932-23291954 CACTGCAGGCTCCACCTCCTGGG + Intronic
952512856 3:34074547-34074569 CCCACCAGGCACCAAATCCTTGG - Intergenic
953130219 3:40130761-40130783 CCCACCAGGTCTTACCACCTGGG + Intronic
953310826 3:41877400-41877422 CCCAGCAGCCTCCGCCTCCTGGG + Intronic
953322780 3:41987061-41987083 CCCTGCAGCCTCCACCTCCTGGG - Intergenic
953563224 3:44011214-44011236 GCCACCATGCCCCACCCCCCAGG + Intergenic
953698573 3:45179011-45179033 CTCAGCAGCCTCCACCTCCTTGG + Intergenic
953812940 3:46130021-46130043 CCCACCACTCCTCACCCCCTTGG - Intergenic
954183795 3:48901476-48901498 CCCTACAAGCTCCACCTCCTGGG - Intergenic
954371279 3:50170767-50170789 CCCACCATGCGCGACCTCCTGGG + Intronic
954615372 3:51966658-51966680 CCCACCCGGCCCCAGCACCCAGG - Intronic
954707107 3:52487028-52487050 CCCACCAGGGCCCTCATCCTGGG + Intronic
955778089 3:62455123-62455145 CCCCCCACCCCCCACCCCCTGGG + Intronic
956554620 3:70505006-70505028 ACCAGTAGGCCCCACCTCATGGG + Intergenic
956842256 3:73151687-73151709 CACTGCAGGCTCCACCTCCTGGG + Intergenic
957228968 3:77486830-77486852 CCCACCATCCCCCACCACCATGG + Intronic
958839938 3:99191603-99191625 CTTTCCAGGCCCCAGCTCCTGGG + Intergenic
959044838 3:101462463-101462485 CACCCCAGCCTCCACCTCCTGGG - Intronic
959539539 3:107523681-107523703 CTCCCCAGGCCCCACCTCCCCGG - Intronic
960010500 3:112829684-112829706 CCCACATGGACCCATCTCCTTGG - Intronic
960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG + Intronic
960897918 3:122525586-122525608 CACTGCAGGCTCCACCTCCTGGG + Intergenic
960994546 3:123332287-123332309 CCCTCCATGCCCCCCATCCTTGG - Intronic
961299797 3:125915622-125915644 CCTAACCGGCCCCACCTCCCGGG + Intergenic
961485406 3:127212428-127212450 CCCACCAGGACACACATCCAGGG + Intergenic
961766973 3:129219053-129219075 CTCAGCAGCCTCCACCTCCTGGG + Intergenic
961801955 3:129457809-129457831 CACTGCAAGCCCCACCTCCTGGG + Intronic
962069896 3:132022416-132022438 CCCATGAGGGGCCACCTCCTGGG - Intronic
962212108 3:133487610-133487632 CCCTACAGTCCCCACTTCCTGGG - Intergenic
962303686 3:134266991-134267013 TACACCAACCCCCACCTCCTGGG + Intergenic
963110349 3:141683137-141683159 CCCTCCAGGCTCCAGCTCCTGGG + Intergenic
963302245 3:143611807-143611829 CACTCCAGTCCCGACCTCCTGGG + Intronic
963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG + Intergenic
963752360 3:149195788-149195810 CACTGCAAGCCCCACCTCCTGGG - Intronic
963801908 3:149684637-149684659 CACTGCAGGCCCAACCTCCTGGG + Intronic
964383865 3:156126504-156126526 CCCAAGAGGCTCCCCCTCCTTGG - Intronic
964407749 3:156367249-156367271 CACTGCAGGCTCCACCTCCTGGG + Intronic
965843138 3:172930632-172930654 CCCTGCAAGCTCCACCTCCTGGG + Intronic
967188659 3:186966741-186966763 ACCACTGGGCCTCACCTCCTGGG - Intronic
967419688 3:189259542-189259564 GCAACCAACCCCCACCTCCTGGG + Intronic
968001206 3:195208096-195208118 CCCACCAGGGCACGACTCCTAGG + Intronic
968111205 3:196048228-196048250 CCCCGCAACCCCCACCTCCTGGG - Intronic
968573481 4:1354334-1354356 CTCACCAGCCCCCACCCCCCCGG - Intronic
968706500 4:2080699-2080721 TCCCCCAGACCCCTCCTCCTCGG - Intronic
968976995 4:3827326-3827348 CTCACGTGTCCCCACCTCCTGGG + Intergenic
969375466 4:6760712-6760734 CCCATCCTGCTCCACCTCCTGGG + Intergenic
969556635 4:7916026-7916048 ATCACCAGTCCCCACCTGCTGGG + Intronic
969665063 4:8552730-8552752 TCCACCAGGCCTCACCTCTAGGG + Intergenic
969691915 4:8708599-8708621 CCCACCACGCCCTGCATCCTGGG + Intergenic
969877854 4:10149194-10149216 CTGACCAGGCCCCACCACCAAGG - Intergenic
970039442 4:11779598-11779620 CACTGCAGGCTCCACCTCCTGGG + Intergenic
970359377 4:15293087-15293109 CCCACTATGCCTCACCTCCAGGG + Intergenic
971221869 4:24716272-24716294 CCCACCACGCCCAGCATCCTTGG + Intergenic
971612171 4:28739939-28739961 CACAGCAAGCTCCACCTCCTGGG + Intergenic
971981316 4:33754512-33754534 CACAGCAGCCTCCACCTCCTGGG - Intergenic
972610813 4:40653845-40653867 CCCACTATGCCCCACCTTCAAGG - Intergenic
973892340 4:55379864-55379886 CACACCAGCCTCGACCTCCTGGG + Intergenic
973907691 4:55547140-55547162 CCGACCAGGCCCCGCCTCCCCGG - Intergenic
975745786 4:77472905-77472927 CCCACTGGGCCCCCCCACCTTGG + Intergenic
975768314 4:77692964-77692986 CTCACCACGCCCCACTTCTTTGG + Intergenic
976175684 4:82349335-82349357 CCCTGCAACCCCCACCTCCTGGG - Intergenic
976195258 4:82525978-82526000 CACAGCAGCCTCCACCTCCTGGG + Intronic
976262625 4:83160123-83160145 CACTGCAAGCCCCACCTCCTGGG - Intergenic
976447035 4:85141798-85141820 CCCCCCACCCCCCACCCCCTCGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977995244 4:103492962-103492984 CCCATCAGGCCTAACCTCCCTGG - Intergenic
978248101 4:106599569-106599591 CACTGCAAGCCCCACCTCCTGGG + Intergenic
979672195 4:123371687-123371709 CACACCAGGCCCCACGGCATAGG + Intergenic
980134332 4:128845580-128845602 CCACCCAGGCCCTACCTCCCAGG - Intronic
980377136 4:131964575-131964597 CACTGCAGGCTCCACCTCCTGGG - Intergenic
980614078 4:135195202-135195224 CCCACCAGGCCCCACCTCCTGGG - Intergenic
981748451 4:148072218-148072240 CCCACCACCCCCCACCCCCAGGG - Exonic
983252415 4:165359734-165359756 CACACCACACCCCAGCTCCTTGG - Intergenic
984127588 4:175831596-175831618 CCCACCCTTCTCCACCTCCTAGG + Intronic
984558591 4:181241821-181241843 CCCACCAGTCTCCACCTATTTGG - Intergenic
984762188 4:183372122-183372144 CCCTGCAGGCTCCAACTCCTGGG - Intergenic
985002478 4:185499816-185499838 CCCAACAGGCTCCCCCTGCTAGG - Intergenic
985119682 4:186627559-186627581 CCCAGCAGGCCCCAGCTCTGGGG + Intronic
985228987 4:187794767-187794789 TCCACCAGCCTCCACCTCCCAGG + Intergenic
985541195 5:488521-488543 CTCCCCAGGGCCCTCCTCCTCGG - Intronic
985714581 5:1448216-1448238 CCCACGGGTCCCCCCCTCCTTGG + Intergenic
985784149 5:1885510-1885532 GCCAGCAGGCCCCAGCGCCTGGG + Intronic
986196964 5:5546217-5546239 CCCACCAGCCCTCTCCTCCCTGG + Intergenic
987045312 5:14102241-14102263 TCCACCAGGCCACACTTCATAGG + Intergenic
987228001 5:15863645-15863667 CCCACTAGGCCCCACCTCCCAGG - Intronic
987244756 5:16037535-16037557 ACCAGCAGGATCCACCTCCTGGG + Intergenic
987353548 5:17042550-17042572 CCCAGCACTCTCCACCTCCTGGG + Intergenic
987387460 5:17343456-17343478 CCCTGCAGCCCCAACCTCCTGGG - Intergenic
987955946 5:24740107-24740129 CCCACCAGTCTCCACCTTCAGGG - Intergenic
988531433 5:32030809-32030831 CCTGCCAGGCCCCACCCCCTTGG + Intronic
988791929 5:34616434-34616456 CACAGCAAGCTCCACCTCCTGGG + Intergenic
989520572 5:42396179-42396201 CCCCCCAGGCCCCACAGGCTCGG + Intergenic
990180080 5:53151129-53151151 CCCACCAGGTCCCTCCTCTGTGG - Intergenic
990431878 5:55743503-55743525 CCCTTCAAGCTCCACCTCCTGGG + Intronic
991401326 5:66254854-66254876 CCCTCCAGACTCCATCTCCTAGG + Intergenic
993504611 5:88694143-88694165 CCCACCAGCCCCCACCCGCTGGG + Intergenic
995196902 5:109380727-109380749 CCCTGCAGCCTCCACCTCCTGGG - Intronic
995309187 5:110691994-110692016 CACTGCAAGCCCCACCTCCTGGG + Intronic
996722267 5:126641500-126641522 CCCACCAGGTCCCACCTCCTAGG - Intergenic
997143726 5:131410103-131410125 CACTGCAGGCTCCACCTCCTAGG - Intergenic
997359729 5:133287310-133287332 CACTGCAAGCCCCACCTCCTGGG - Intronic
997371766 5:133366033-133366055 TCCACAAGGCCCCACCTGCCTGG + Intronic
997965595 5:138353230-138353252 GCCAGCAGGCCCCGCCTCCTGGG + Intronic
997976865 5:138445991-138446013 CCGAGCAGTCCCCACCTCCTTGG - Exonic
998463870 5:142327623-142327645 TCCACCATCCCCCACCTCCCCGG - Intergenic
999825978 5:155274167-155274189 CCCAGCAGGCCTTTCCTCCTGGG + Intergenic
999899720 5:156073485-156073507 CCCTGCAGCCTCCACCTCCTGGG - Intronic
1000018728 5:157300927-157300949 CCATCCAGGCCCCTCCTCCAGGG + Intronic
1000336758 5:160247006-160247028 CACAGCAGCCTCCACCTCCTGGG - Intergenic
1001049302 5:168401562-168401584 CCCACAAGTCCCCACCGCCTGGG + Intronic
1001054762 5:168440014-168440036 CCCACCTGGTTCCACCTTCTGGG - Intronic
1001159716 5:169301912-169301934 CCTACCTGGCCTCACCTCCCTGG + Intergenic
1001978589 5:176021471-176021493 CCTCCCAGGCACCACCTCCCTGG - Intronic
1001992808 5:176132535-176132557 CCCACCAGCACCCGACTCCTAGG - Intergenic
1002001058 5:176196489-176196511 CCCCCCCGCCCCCACCTCCCAGG + Intergenic
1002069684 5:176671940-176671962 CCCACCTGGCCCCACCTGCTAGG + Intergenic
1002238828 5:177822291-177822313 CCTCCCAGGCACCACCTCCCTGG + Intergenic
1002253277 5:177942483-177942505 CCCCCCCGCCCCCACCTCCCAGG - Intergenic
1002373520 5:178772770-178772792 CCCTCCAAGACCCTCCTCCTGGG - Intergenic
1002421901 5:179153323-179153345 CCCACCACTCCCCACCCCCTAGG - Intronic
1003749597 6:9040963-9040985 CCCACCACCCCCCACCGCCGTGG + Intergenic
1004386510 6:15177690-15177712 CACTTCAGGCTCCACCTCCTGGG - Intergenic
1004427527 6:15516520-15516542 CCCACCAGCCCCGGCCCCCTTGG - Intronic
1004643769 6:17540004-17540026 CACCGCAGCCCCCACCTCCTGGG - Intronic
1005311484 6:24563494-24563516 TCCACCAGGCCACTCTTCCTAGG + Exonic
1006086776 6:31601348-31601370 CCCTGCAAGCTCCACCTCCTGGG + Intergenic
1006119370 6:31795020-31795042 CCCACCGGGCCCCTGCTCCAGGG + Exonic
1006167146 6:32071659-32071681 CCCTGCAGCCTCCACCTCCTGGG + Intronic
1006252556 6:32800549-32800571 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1006396429 6:33790329-33790351 TCCCCCAGGCCCCTCCTCCCTGG + Intergenic
1006516991 6:34550698-34550720 CCCAACAGACCCCAGCTCCTGGG - Intronic
1006548350 6:34799015-34799037 CACAGCAACCCCCACCTCCTGGG + Intronic
1006860277 6:37167734-37167756 ACCACCATGCCCAGCCTCCTTGG - Intergenic
1006971338 6:38048544-38048566 CACTGCAAGCCCCACCTCCTGGG - Intronic
1007096144 6:39214466-39214488 CTCAGCTGGGCCCACCTCCTGGG - Intronic
1007585071 6:42984489-42984511 ACAACCAGGCGCCGCCTCCTCGG - Exonic
1007695435 6:43729713-43729735 CCCACAGTGCCCCACCTCCGAGG + Intergenic
1008075224 6:47138893-47138915 CACAGCAGCCTCCACCTCCTAGG + Intergenic
1008675087 6:53810542-53810564 CACTGCAAGCCCCACCTCCTGGG - Intronic
1009491612 6:64299460-64299482 CACACGAGGCACCACCTGCTGGG - Intronic
1010054751 6:71552006-71552028 CACCCCAGGCCACACCCCCTTGG - Intergenic
1010245373 6:73657344-73657366 CCCTGTAGGCTCCACCTCCTGGG + Intergenic
1012948527 6:105493091-105493113 CCCACCACACCCACCCTCCTTGG + Intergenic
1013215949 6:108027498-108027520 CCCTCCAAGCCAGACCTCCTGGG - Intergenic
1014095439 6:117454520-117454542 CACTGCAGCCCCCACCTCCTGGG - Intronic
1014607469 6:123495127-123495149 CCCTGCAGCCCCAACCTCCTGGG + Intronic
1014661396 6:124177666-124177688 CCCAAATGGCCCCAGCTCCTTGG - Intronic
1014924402 6:127253874-127253896 CACAGCAGCCTCCACCTCCTGGG - Intergenic
1015152617 6:130056001-130056023 CACAGCAGCCTCCACCTCCTGGG + Intronic
1015612478 6:135039241-135039263 CACAGCAGCCTCCACCTCCTGGG - Intronic
1018447685 6:163873330-163873352 CCCTGCAACCCCCACCTCCTGGG + Intergenic
1019019100 6:168902715-168902737 CCTACCAGTCCCCATCTCCGAGG + Intergenic
1019370120 7:658357-658379 CACAGCAGCCCCCACCTCATGGG - Intronic
1019707136 7:2502204-2502226 CCCCCCACACCCCACCTCCAGGG - Intergenic
1020351203 7:7220595-7220617 GCAACCAAGCTCCACCTCCTGGG + Intronic
1020742435 7:12039022-12039044 CCCACCAGGTCCCTCCTACATGG + Intergenic
1021076272 7:16307997-16308019 CCCACCAGGTCTCACCTCCATGG - Intronic
1021746641 7:23747443-23747465 CACTGCAAGCCCCACCTCCTGGG + Intronic
1021816177 7:24449603-24449625 GCCACCTGGCTCCACCTCCCAGG + Intergenic
1021888009 7:25158810-25158832 CCCAGCAACCTCCACCTCCTGGG - Intronic
1022510165 7:30929912-30929934 CCCACCTGGCCTCACTCCCTGGG - Intergenic
1022511409 7:30937067-30937089 CCCACCTGGCCCCACTCCCCAGG - Intergenic
1022762204 7:33366618-33366640 CCCTGCAGCCTCCACCTCCTGGG + Intronic
1023351756 7:39327201-39327223 CCCTGCAAGCTCCACCTCCTGGG - Intronic
1025019741 7:55471776-55471798 CCCAGCAAGCTCCTCCTCCTTGG + Exonic
1025123966 7:56330114-56330136 CCCTCCAAGCTCCGCCTCCTGGG + Intergenic
1025204666 7:56985339-56985361 CCCAGAAGGCCCCGTCTCCTGGG - Intergenic
1025667271 7:63591596-63591618 CCCAGAAGGCCCCGTCTCCTGGG + Intergenic
1026504880 7:70973960-70973982 CACACCAGCCTCCACCTTCTAGG - Intergenic
1026630867 7:72037224-72037246 CACTGCAAGCCCCACCTCCTGGG + Intronic
1026815521 7:73508625-73508647 CTCACTAGCCTCCACCTCCTGGG + Intronic
1026841922 7:73674208-73674230 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1026874144 7:73870044-73870066 CTCTCCAGGCCCCAGCTCTTGGG + Intergenic
1027192917 7:76008121-76008143 CACTGCAGGCTCCACCTCCTGGG - Intronic
1027284279 7:76632476-76632498 CCCTGCAAGCTCCACCTCCTGGG - Intergenic
1028156765 7:87438671-87438693 CCCTGCAGCCTCCACCTCCTGGG - Intronic
1029118051 7:98248092-98248114 CACCCCTGGCCCCACCTCCAGGG + Intronic
1029398163 7:100323360-100323382 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1029448982 7:100630363-100630385 CACAGCAGCCTCCACCTCCTGGG + Intronic
1029904342 7:104075042-104075064 CACAGCAGCCACCACCTCCTGGG - Intergenic
1030351095 7:108488494-108488516 CACTCCAACCCCCACCTCCTGGG - Intronic
1030484583 7:110149460-110149482 CACACCAGCCCCCCCCGCCTTGG - Intergenic
1030763602 7:113381669-113381691 CCCTGCAACCCCCACCTCCTGGG + Intergenic
1031730461 7:125293600-125293622 CACAGCAAGCTCCACCTCCTGGG - Intergenic
1032270487 7:130400169-130400191 GCCAGCAGGCCCTTCCTCCTGGG - Exonic
1032316361 7:130842253-130842275 CCCACCACACCCCCCATCCTGGG - Intergenic
1032472630 7:132189587-132189609 CCCAACATGCCCCAAGTCCTGGG + Intronic
1032516170 7:132507877-132507899 TCCACCAGGCTCCACCACCAAGG - Exonic
1032785794 7:135198228-135198250 CCCACCACGCCCCCCCGCCCAGG - Intronic
1032849987 7:135785977-135785999 CCCATGAGGCCCCTACTCCTAGG - Intergenic
1032856451 7:135837582-135837604 CCTAGCAGACCCCACCTCTTGGG - Intergenic
1033326195 7:140380618-140380640 CTCACTAGGCTTCACCTCCTGGG + Intronic
1033719382 7:144041477-144041499 CCCATCAGGCCACACCTCAAAGG - Intergenic
1034063360 7:148113443-148113465 CCCACCAGGCCCCACAACATTGG + Intronic
1034159648 7:148983365-148983387 CCCGCCCGGCCCCACCCCCGCGG + Intergenic
1034348861 7:150403836-150403858 CCCACCAGGCCCCACCCGTCTGG - Intronic
1034475268 7:151277887-151277909 CCCACCTGGCCCCAAATGCTTGG - Intronic
1034951055 7:155297540-155297562 CCTCCCAGGCCCCAGCTCCGCGG + Intergenic
1035270195 7:157715237-157715259 CCCACCACGACCCTCCTCTTGGG - Intronic
1035887295 8:3305753-3305775 CACTGCAGGCTCCACCTCCTGGG + Intronic
1036476867 8:9101491-9101513 CCCACCAGGCCCCTCCCCATGGG + Intronic
1036563034 8:9913669-9913691 AGCTCCAGGCCCTACCTCCTCGG + Intergenic
1036635917 8:10549381-10549403 CCCTACAGGCCACCCCTCCTAGG - Intronic
1036788210 8:11701845-11701867 CCCACCACCCCCCACCACCCCGG - Intronic
1036804959 8:11824809-11824831 CCCTGCAAGCTCCACCTCCTGGG + Intronic
1036981991 8:13479988-13480010 CACTGCAGCCCCCACCTCCTGGG - Intronic
1037185521 8:16057828-16057850 CACAGCAACCCCCACCTCCTGGG - Intergenic
1037273643 8:17156269-17156291 CCCAGCAGCCCCCGCCTCCCCGG + Exonic
1037356538 8:18026086-18026108 CACCGCAAGCCCCACCTCCTGGG - Intronic
1037594769 8:20345735-20345757 CCCAGCAACCTCCACCTCCTAGG - Intergenic
1037657327 8:20896346-20896368 ACAACCAGGCATCACCTCCTTGG - Intergenic
1037759207 8:21730739-21730761 CCCTCAAGGTCCCACCTCCCAGG + Intronic
1038049527 8:23795797-23795819 GCCACCATGCCCAACCTTCTTGG - Intergenic
1038447339 8:27613008-27613030 CCCTCCAGGCACACCCTCCTGGG + Intronic
1038807773 8:30811569-30811591 GCAACCAGCCTCCACCTCCTGGG + Intronic
1039434019 8:37547293-37547315 CACACCAGCCCCCTCCTCCTTGG + Intergenic
1039498386 8:37998364-37998386 CCCTGCAGCCTCCACCTCCTGGG - Intergenic
1040060288 8:43097828-43097850 CCCCACAGGCCCCTCCTCCAGGG - Intronic
1040103031 8:43521875-43521897 TCCACCAGACCCCACCTCTGGGG - Intergenic
1040441124 8:47443493-47443515 CCCTGCAACCCCCACCTCCTGGG - Intronic
1041213407 8:55575717-55575739 CCCTGCAAGCTCCACCTCCTGGG - Intergenic
1042224198 8:66502920-66502942 CACTACAGCCCCCACCTCCTGGG + Intronic
1042484602 8:69336647-69336669 CCCACCGGGACCCACCTCCCAGG - Intergenic
1042835260 8:73073726-73073748 CACTGCAGCCCCCACCTCCTGGG - Intronic
1043142259 8:76604710-76604732 CCCTGCATCCCCCACCTCCTGGG + Intergenic
1044717144 8:95110991-95111013 CCCACAAGGCTTCACCTCCAAGG - Intronic
1045978946 8:108161578-108161600 CACACCTGGTCCCACCTACTTGG - Intergenic
1046102208 8:109628406-109628428 CACTGCAGCCCCCACCTCCTGGG + Intronic
1046849017 8:118952079-118952101 CCCCTCACGCCCCACCTCCCTGG - Exonic
1047460049 8:125054741-125054763 CCCTGCAGGCTCCACCTCCCGGG - Intronic
1048389666 8:133950062-133950084 CACTCCAGCCTCCACCTCCTGGG - Intergenic
1048432694 8:134384940-134384962 CACAGCAAGCTCCACCTCCTGGG - Intergenic
1048843181 8:138582627-138582649 CCCACTATGCCCCACCCACTCGG + Intergenic
1049177925 8:141205760-141205782 CCCACCAGGACCCCCGCCCTCGG - Intergenic
1049235424 8:141510149-141510171 CCCGCCAGGCCGCAGCTGCTAGG - Intergenic
1049309621 8:141926697-141926719 CCCACCAGCCTCCAGCCCCTGGG - Intergenic
1049325541 8:142019631-142019653 CCCACCAGGCTCCACCCTCATGG - Intergenic
1049419833 8:142511594-142511616 CCCCCCAGGCCTCAGCACCTCGG + Intronic
1049591332 8:143464356-143464378 CCAGCCAGGCCCTACCTCCCCGG + Intronic
1049614219 8:143569182-143569204 CCTCCCAGGCCCCGCCTCCCAGG - Intronic
1049688832 8:143949985-143950007 CCCATGTGGCCCCTCCTCCTCGG - Intronic
1049718761 8:144105990-144106012 CCCACCATGGCTCACCTGCTGGG - Exonic
1049743042 8:144250121-144250143 CCCTCATGGCCCCACCCCCTTGG + Intronic
1049757267 8:144316255-144316277 CCCACCAGGCCCCAGGCCCCTGG + Exonic
1049894473 9:100720-100742 CGCTCCAGGCCCCAGCCCCTTGG + Intergenic
1050351834 9:4747435-4747457 CCCTGCAGCCTCCACCTCCTGGG - Intergenic
1051094747 9:13453736-13453758 CTCACCAGGCAGCCCCTCCTTGG - Intergenic
1051468210 9:17404811-17404833 CACTGCAGGCTCCACCTCCTGGG + Intronic
1052832025 9:33223453-33223475 GCCACCACGCCCCACTTCTTTGG + Intronic
1053015569 9:34660154-34660176 CCTATCAGGCTCCTCCTCCTAGG + Intronic
1053279289 9:36807042-36807064 GCCACCAGGTCCCAGCTCTTGGG - Intergenic
1053642184 9:40095224-40095246 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1053763954 9:41370233-41370255 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1054542566 9:66281423-66281445 CACTGCAGGCTCCACCTCCTGGG + Intergenic
1054692696 9:68330688-68330710 CGCTCCAGGCCCCAGCCCCTTGG - Intronic
1055026589 9:71728905-71728927 CACAGCAGCCTCCACCTCCTGGG + Intronic
1056186840 9:84143427-84143449 CCCACCAGGGCCCACTTCCCTGG + Intergenic
1057074548 9:92130653-92130675 CACTACAGGCTCCACCTCCTGGG + Intergenic
1057261212 9:93585873-93585895 CCCACCAGGCCCCACGTTCCTGG - Intronic
1058249384 9:102672415-102672437 CACTGCAGCCCCCACCTCCTGGG + Intergenic
1058707628 9:107650293-107650315 ACCACCAGGCCAGACCTCCCAGG - Intergenic
1058956111 9:109950215-109950237 CCCTGCAGCCTCCACCTCCTGGG - Intronic
1059118852 9:111623299-111623321 CCCACCAGGTCCCTCCCACTGGG + Intergenic
1059146380 9:111903487-111903509 CACTGCAAGCCCCACCTCCTGGG - Intronic
1059495942 9:114709564-114709586 GCCACCACGCCCTACCCCCTGGG + Intergenic
1059917786 9:119122890-119122912 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1060105199 9:120868985-120869007 CCCCCGAGGCCCCACCCCCGCGG + Intronic
1060360929 9:122956572-122956594 CACTGCAAGCCCCACCTCCTGGG - Intronic
1060779279 9:126399717-126399739 CCCACCAGGGGACTCCTCCTGGG - Intronic
1061193503 9:129095318-129095340 CCCACCAGGGCTCAGCTCCTTGG - Exonic
1061255302 9:129451723-129451745 CCCCCCAGGCCCTCCCTCCCTGG - Intergenic
1061498960 9:130991404-130991426 TCCACCAGGCCGTGCCTCCTGGG + Intergenic
1061805140 9:133133541-133133563 ACCCCCAGGCCCCAGCGCCTCGG - Intronic
1061889287 9:133609191-133609213 CACACCAGGCGCCACCGCCGTGG - Intergenic
1061937892 9:133868285-133868307 CCCACCGCGCCCCACCTCATGGG - Intronic
1062171383 9:135136766-135136788 CCCACCCGGCCTCAGCTCCAAGG - Intergenic
1062274898 9:135726028-135726050 CCTGACAGGCCCCTCCTCCTGGG - Intronic
1062393469 9:136343190-136343212 GCAACCAGCCCCCACCTCCCTGG + Intronic
1062465448 9:136678834-136678856 CACTCCAGCCTCCACCTCCTGGG + Intronic
1062505173 9:136870302-136870324 CACAGCAGGCCCAACCTCCCAGG + Intronic
1062522410 9:136963816-136963838 CCCAGCCGGCCCCATCTCCTGGG - Intergenic
1062547015 9:137068419-137068441 GCCAGCAGGCCACACCTCCAGGG + Intronic
1202789951 9_KI270719v1_random:78243-78265 CACTGCAGGCTCCACCTCCTGGG - Intergenic
1185545171 X:937819-937841 CACAGCAGACTCCACCTCCTGGG - Intergenic
1185546546 X:950100-950122 CCCTGCAGCCTCCACCTCCTGGG + Intergenic
1185635332 X:1547857-1547879 CACTGCAGACCCCACCTCCTGGG - Intergenic
1186401661 X:9266229-9266251 CACTGCAGCCCCCACCTCCTGGG + Intergenic
1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG + Intergenic
1187981012 X:24757513-24757535 CACTGCAGGCTCCACCTCCTGGG + Intronic
1188894681 X:35652785-35652807 CCCACAAGACCCCAGCCCCTGGG - Intergenic
1189282958 X:39832117-39832139 GCCACAACGCTCCACCTCCTGGG + Intergenic
1189886007 X:45545710-45545732 CCCACCAGGCCCCACCCATTGGG + Intergenic
1190025363 X:46917226-46917248 CCCACCCGCCCCCACCAGCTTGG - Intronic
1190179118 X:48176751-48176773 CACTGCAGCCCCCACCTCCTGGG + Intergenic
1190268908 X:48847245-48847267 CACAACAACCCCCACCTCCTGGG - Intergenic
1190681627 X:52831171-52831193 CCCACCTGTCCCCAGCTCCTGGG - Intergenic
1190998699 X:55637155-55637177 CCCACTTGTCCCCAGCTCCTGGG - Intergenic
1191668254 X:63725180-63725202 CCCACCGTGACCCTCCTCCTGGG + Intronic
1191796274 X:65025222-65025244 CACAGCAGCCTCCACCTCCTAGG + Intronic
1191900945 X:66040182-66040204 CCCCCCTTCCCCCACCTCCTTGG + Intergenic
1192407763 X:70903894-70903916 CACTGCAGGCTCCACCTCCTAGG + Intronic
1192464800 X:71346838-71346860 CACCCCAGCCTCCACCTCCTGGG - Intergenic
1193523330 X:82557330-82557352 CACTGCAAGCCCCACCTCCTGGG - Intergenic
1193887940 X:87006459-87006481 CCAAGCAGGCCCCACCTCTGAGG + Intergenic
1195197897 X:102516932-102516954 CTCCCCAGGCCCCACCTCCCAGG + Intergenic
1195347146 X:103962453-103962475 CTCCCCAGGCCCCACCTCCCAGG - Intronic
1195360296 X:104076388-104076410 CTCCCCAGGCCCCACCTCCCAGG + Intergenic
1195447489 X:104971059-104971081 CCCACCATGCCCGGCCTCGTAGG - Intronic
1196420507 X:115515894-115515916 CTCACCAGTCTCGACCTCCTGGG - Intergenic
1196616366 X:117770595-117770617 TCCACCATACCCCACCTACTTGG + Intergenic
1196830117 X:119769218-119769240 CCCAGCAACCTCCACCTCCTGGG + Intergenic
1197705617 X:129632526-129632548 CCCACCAGGCCCACCAGCCTTGG + Intergenic
1197959024 X:131983630-131983652 CTCACCAGCCTCCAACTCCTGGG - Intergenic
1198082057 X:133249445-133249467 CCCCCCAACCCCCACCCCCTTGG + Intergenic
1198198719 X:134392873-134392895 CACTGCAGCCCCCACCTCCTGGG + Intronic
1198279354 X:135126547-135126569 AGCACCTGGCCCCACATCCTGGG - Intergenic
1198291603 X:135245973-135245995 AGCACCTGGCCCCACATCCTGGG + Intergenic
1198438830 X:136641913-136641935 CCCACCCCGCCCCACCCCCTGGG + Intergenic
1200232646 X:154451721-154451743 CGCTGCAGCCCCCACCTCCTGGG + Intergenic
1200795599 Y:7338588-7338610 CCCTGCAACCCCCACCTCCTGGG + Intergenic
1201585761 Y:15559369-15559391 CCCTCCAACCCCCAACTCCTTGG - Intergenic