ID: 960788500

View in Genome Browser
Species Human (GRCh38)
Location 3:121400214-121400236
Sequence CTGGGTGAGAGGTAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 749}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960788500_960788508 -3 Left 960788500 3:121400214-121400236 CCTCCCACCTACCTCTCACCCAG 0: 1
1: 0
2: 5
3: 75
4: 749
Right 960788508 3:121400234-121400256 CAGGCGATGACTTAGTTTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 40
960788500_960788510 5 Left 960788500 3:121400214-121400236 CCTCCCACCTACCTCTCACCCAG 0: 1
1: 0
2: 5
3: 75
4: 749
Right 960788510 3:121400242-121400264 GACTTAGTTTGTTGGGAGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 156
960788500_960788509 -2 Left 960788500 3:121400214-121400236 CCTCCCACCTACCTCTCACCCAG 0: 1
1: 0
2: 5
3: 75
4: 749
Right 960788509 3:121400235-121400257 AGGCGATGACTTAGTTTGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960788500 Original CRISPR CTGGGTGAGAGGTAGGTGGG AGG (reversed) Intronic
900154945 1:1200208-1200230 GAGGGGGAGAGGGAGGTGGGGGG - Intergenic
900357983 1:2273894-2273916 GTGAGTGAGAGGGTGGTGGGCGG - Intronic
900479161 1:2889887-2889909 CTGGGGTGGAGGGAGGTGGGGGG + Intergenic
900509341 1:3051200-3051222 ATGGGTGAGTGGATGGTGGGTGG - Intergenic
900574575 1:3376769-3376791 TAGGCTGAGAGGGAGGTGGGAGG - Intronic
900605679 1:3522582-3522604 CCGGGTGAGTGATGGGTGGGTGG + Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900818486 1:4868630-4868652 CTGGGTGAGAGCTGTGTGTGAGG - Intergenic
901100416 1:6715267-6715289 CTGGGAGGGAGGGAGGTGGGGGG - Intergenic
901160607 1:7174078-7174100 CTCAGGGAGAGGGAGGTGGGAGG - Intronic
901225899 1:7612849-7612871 TTGGGTGAGAGGAAGGCGGTGGG + Intronic
901271012 1:7952925-7952947 CTGGGAGGGAGGTGGGGGGGGGG + Intergenic
901638882 1:10683220-10683242 CTGGGTTAGGAGTAGGTGTGGGG + Intronic
901813079 1:11778813-11778835 GAAGGTGAGAGGTAGGAGGGTGG + Exonic
901925840 1:12565498-12565520 CTGGCTGAGAGGGAGGGGGTGGG + Intergenic
902402842 1:16167508-16167530 GTGGAGGAGAGGCAGGTGGGAGG + Intergenic
903280851 1:22249033-22249055 CTGGGTGTGGGGCAGGGGGGAGG + Intergenic
903490119 1:23721990-23722012 CTACTTGGGAGGTAGGTGGGAGG + Intergenic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904774434 1:32898092-32898114 CTGGGAGGGTGGTTGGTGGGAGG - Intronic
905109519 1:35585055-35585077 GGGGGTGAGAGGGAGCTGGGGGG + Intronic
905241281 1:36583185-36583207 GTGGGTGAGTGGTGGGTAGGTGG - Intergenic
905524218 1:38624241-38624263 CGGAGTGGGAGGGAGGTGGGTGG + Intergenic
905914996 1:41678544-41678566 CTGGGGAAGAGGTGTGTGGGTGG - Intronic
906316155 1:44787488-44787510 TTGGGTTAGAGGGAGGTGGGTGG + Intronic
906350815 1:45057427-45057449 CTGGGACAAAGGTAGTTGGGAGG - Intronic
906429150 1:45740506-45740528 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
906640162 1:47436956-47436978 CTGGGAGCCAGGAAGGTGGGGGG + Exonic
906927831 1:50138131-50138153 CTTGGTGTGAGGTAGGTAGAGGG + Intronic
907554777 1:55334386-55334408 CTGGGAGGGAGGTAGCTGGAGGG + Intergenic
908445162 1:64192707-64192729 GTGGGTGAGTGGTAGGTAGCTGG - Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
910477658 1:87624032-87624054 CTGGGGGAGAGGCCGGGGGGTGG - Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
911738306 1:101361275-101361297 CTGGGGAAGAGGTATGTGGCTGG - Intergenic
911746270 1:101445133-101445155 GTGGGTGGGAGGTAGGGGGGAGG - Intergenic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912815041 1:112822243-112822265 CTTGCTGAGAGGTAGTGGGGTGG + Intergenic
913264474 1:117031071-117031093 ATGGGTGAGAGGCAGATGGTGGG + Intronic
913316153 1:117554559-117554581 GGGGGTGAGAGGCTGGTGGGGGG - Intergenic
914241148 1:145853970-145853992 CTGGCTGAGAGGCTGCTGGGTGG + Intronic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915170281 1:153972814-153972836 CTTGGTGAGGGGCAGGTGAGAGG - Exonic
915297553 1:154932036-154932058 CTGAGTGAGAGGGTGGTGTGAGG + Intronic
915623070 1:157097992-157098014 AGGGGTGAGAAGTAGGTGCGAGG + Intronic
916399267 1:164428544-164428566 CTGGGGGATAGGGAGGAGGGAGG + Intergenic
916406920 1:164506964-164506986 GTGGGTGAGAGGTGGATGGAAGG - Intergenic
917375733 1:174349462-174349484 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917860023 1:179135812-179135834 CCGGGAGGGAGGGAGGTGGGGGG + Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918528931 1:185496080-185496102 CTGGCTGAGATGAAGGTGGTGGG + Intergenic
918958321 1:191238589-191238611 CTGGGCAAGAGGTATGTGGATGG + Intergenic
920062469 1:203237050-203237072 AAGGCTGAGAGGTAGGCGGGTGG - Intronic
920416199 1:205800676-205800698 GTGGTTGAGAGGTAGGGGGTGGG + Intronic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
921265478 1:213417650-213417672 CTAGTGGAGAGGTAGGTTGGGGG + Intergenic
921601576 1:217111739-217111761 CTGGGAGAGTGGTAGTTGGGAGG + Intronic
921939619 1:220826607-220826629 CTGGGTGGGAAGGAGGTGGGCGG + Intergenic
922367271 1:224877801-224877823 CTGGGGGAAAGGTAGGAGGGGGG + Intergenic
922479740 1:225931240-225931262 CTTGGGGAGAGGGAGGTGGGAGG + Intergenic
922502089 1:226104750-226104772 CTGAGTGGGAGGGAGCTGGGTGG - Intergenic
922618803 1:226978419-226978441 GTGGGTGAGAGGTGGGTGTGTGG - Intronic
923480572 1:234379422-234379444 CTGGGAGTAAGGTAGGTTGGAGG + Intronic
924172667 1:241357516-241357538 GTGGGTGGGTGGTAGGTGGGTGG + Intergenic
924172669 1:241357520-241357542 GTGGGTGGTAGGTGGGTGGGTGG + Intergenic
924173077 1:241361241-241361263 CACGGTGAGAGGTAGGTGTGTGG - Intergenic
924194528 1:241591747-241591769 CTGGGAGAGAGGGAGAAGGGAGG + Intronic
1062812591 10:477609-477631 ATGGGTGGGAGGAAGGTGGATGG + Intronic
1063029250 10:2215183-2215205 CCGAGAGTGAGGTAGGTGGGTGG - Intergenic
1063552110 10:7043157-7043179 CTGGGCTAGAGGGAGGTGGCAGG + Intergenic
1064146941 10:12833252-12833274 CTGGATGAATCGTAGGTGGGAGG + Exonic
1064481485 10:15744661-15744683 ATGGGTGGGATGTAGGTGGCTGG + Intergenic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1065019943 10:21495648-21495670 CTGGATGAGAGGTAGGGTGAAGG + Exonic
1066048598 10:31615916-31615938 CTGGGGGAAAGGTAGGCAGGTGG + Intergenic
1066169522 10:32826977-32826999 TTGGGGAAGAGGTATGTGGGTGG + Intronic
1066379057 10:34885794-34885816 CTGGGTGAGAGGTTCAAGGGTGG - Intergenic
1067360620 10:45574831-45574853 CTTGCTGAGAGGTAGTGGGGTGG - Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1068005921 10:51392815-51392837 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1068860909 10:61846832-61846854 CTAGGTGAGAGGTACGTGGTGGG - Intergenic
1069498528 10:68929188-68929210 CTGTGGGAGACGGAGGTGGGTGG - Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069698907 10:70407731-70407753 CTGGGAGGGAGGTGGGGGGGGGG - Intronic
1069957490 10:72060965-72060987 CTGGGTGAGTGGTGGGTGTGGGG - Exonic
1070396289 10:76013659-76013681 CAGGGACAGAGGGAGGTGGGGGG + Intronic
1070421392 10:76241105-76241127 TTGGGGGAAAGGTGGGTGGGTGG + Intronic
1070540048 10:77409315-77409337 CTGTGTGTGTGGTAGTTGGGTGG - Intronic
1070976640 10:80610601-80610623 CTGGGTGAGAGGCAGGGGTGAGG - Intronic
1071553502 10:86585238-86585260 TTGGGTGGGAGGTAGGGGTGGGG - Intergenic
1072211930 10:93254215-93254237 CTGAGGCAGAGGTTGGTGGGAGG - Intergenic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073098953 10:100997231-100997253 CTGGGTGAGTGGTGGGGCGGCGG + Intronic
1073119173 10:101111192-101111214 CTGGGAGTGGGGTGGGTGGGAGG - Intronic
1073338428 10:102727788-102727810 CTTGGTAAGTGGTAGGTTGGAGG + Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1073846264 10:107558650-107558672 CTGGGTAAGAGGTAGCTAGTAGG - Intergenic
1074204639 10:111272217-111272239 CTGGATGAGAGGAAGAGGGGAGG + Intergenic
1074208456 10:111305177-111305199 TTGGGGGAGGGGCAGGTGGGAGG + Intergenic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1074423257 10:113328057-113328079 AAGGGGGAGAGGAAGGTGGGAGG - Intergenic
1074626074 10:115188035-115188057 CTGGGAGAGAGGGAGGGGGAGGG + Intronic
1074898897 10:117800272-117800294 CTGGGGGGGGGGGAGGTGGGGGG - Intergenic
1075136978 10:119794800-119794822 CTGGGAGGGAGGGAGGTGGGGGG - Intronic
1075137107 10:119795081-119795103 CCGGGAGGGAGGGAGGTGGGGGG - Intronic
1075439530 10:122468504-122468526 CTGGGGATGAGGTGGGTGGGTGG + Intronic
1075618061 10:123905784-123905806 CTGGGTGAGGGTGGGGTGGGAGG - Intronic
1075899639 10:126030327-126030349 CTAGCAGAGAGGTGGGTGGGGGG + Intronic
1076595653 10:131623202-131623224 TTGGGGGAGAGGTAGGGGAGAGG + Intergenic
1076595697 10:131623335-131623357 ATGGGAGAGAGGTAGGAGAGAGG + Intergenic
1076875634 10:133214321-133214343 CTGGGGGAGAGCTGGGAGGGCGG - Intronic
1076882390 10:133245847-133245869 CGGGCTGTGAGGGAGGTGGGAGG + Intergenic
1077025218 11:436983-437005 GTGGGTGAGCGGGAGGTGAGCGG + Intronic
1077035170 11:490985-491007 CTGGGTGACAGGGAGCTTGGTGG - Exonic
1077093658 11:790354-790376 GTGGGTGAGGGGTCGGTGGGTGG + Intergenic
1077357649 11:2126143-2126165 GTGAGTGAGAGTTAAGTGGGTGG + Intergenic
1077357811 11:2126851-2126873 GTGAGTGAGTGGTAAGTGGGTGG + Intergenic
1077539932 11:3141784-3141806 CTGGGTGGGAGGCGGGTGGGGGG - Intronic
1077554114 11:3217821-3217843 CAGGGTAAGAGCTAGGTGGTGGG + Intergenic
1077680776 11:4237943-4237965 CTGCCTGGGAGGGAGGTGGGGGG + Intergenic
1078846562 11:15124088-15124110 CTGGGTGACAGATGGGTGTGTGG - Intronic
1078857936 11:15221574-15221596 CTGGGTGACGGGCAGGTGTGGGG - Exonic
1079459243 11:20665575-20665597 ATGGGTTGGAGGAAGGTGGGAGG + Intergenic
1079601407 11:22316292-22316314 CGGGGAGAGAGAGAGGTGGGGGG - Intergenic
1079641902 11:22816171-22816193 ATGGGGGAGGGGGAGGTGGGCGG - Intronic
1080555901 11:33417313-33417335 CTGGGTGGGAGGCAGGGTGGGGG - Intergenic
1080994233 11:37580667-37580689 CTGGCTGAGAGGTAGTGGAGTGG + Intergenic
1081775123 11:45671276-45671298 ATGTGTGAGAGGTGAGTGGGCGG - Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1082884068 11:58065940-58065962 TTGGGTGAGAAGTAAGTTGGTGG - Intronic
1082951609 11:58821938-58821960 GTGGGTTAGAGGGAGGCGGGAGG + Intergenic
1083154631 11:60815362-60815384 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1083288072 11:61673863-61673885 CGGGTTGAGAGGTGGGTGGATGG + Intergenic
1083438921 11:62663207-62663229 CTGGGACAGAGGTGGGTGAGGGG - Intronic
1083665751 11:64273578-64273600 CAGAGTGAGAAGCAGGTGGGGGG + Intronic
1083729435 11:64644803-64644825 CTGGGAGAGAGGAGGCTGGGAGG + Intronic
1083883694 11:65560445-65560467 CTGGGAGAGATGTATTTGGGAGG + Intergenic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084662909 11:70557626-70557648 CTGGGGGAGCTGTGGGTGGGGGG + Intronic
1084713589 11:70859536-70859558 ATGGGTGATAGGTAGATAGGTGG + Intronic
1085049439 11:73372576-73372598 CTGGGTCAGAGGTAGTTTGCTGG + Intergenic
1085464267 11:76713481-76713503 GTGGGTGAGTGGTTGATGGGTGG + Intergenic
1085523301 11:77150594-77150616 CTGGGCGAGAGGGAGGAGGCAGG + Intronic
1085532952 11:77202537-77202559 CTGGGTCAGAGGGAGCTGGAGGG + Intronic
1085686047 11:78622822-78622844 CTGGGGGAGAGGTATGTGGATGG + Intergenic
1085745690 11:79112493-79112515 TAGGGTGAGAGGTAGGTGGGTGG + Intronic
1086173441 11:83861728-83861750 AGTGGTGGGAGGTAGGTGGGGGG + Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086430589 11:86732506-86732528 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1086735083 11:90296461-90296483 CTGGGTGGCAGGGGGGTGGGTGG + Intergenic
1087282921 11:96232433-96232455 CTGGGTAGGATGTGGGTGGGTGG + Intronic
1088736858 11:112734819-112734841 CTTGGAGTGAGGAAGGTGGGTGG + Intergenic
1088760412 11:112924037-112924059 CTGGGTGAGACAGAGGAGGGTGG + Intergenic
1089173725 11:116533775-116533797 CTGGGGGAGAGGCAGGAGGCTGG - Intergenic
1089355101 11:117844431-117844453 CTGGGAGAGAGGCAGGGGGATGG - Intronic
1089590597 11:119537963-119537985 CTGGGCAAGAGATAGGGGGGAGG + Intergenic
1089606481 11:119644395-119644417 CTGGCTGAGAGGGGGGTGGTCGG - Intronic
1089984987 11:122804205-122804227 CTGGGTGAGAGGTGGGGATGGGG + Intronic
1090266896 11:125359019-125359041 CTGGGTGGGAGGCAGGTTGCAGG + Intronic
1090398941 11:126436156-126436178 GTGGGTGAGAGGGAGGAGGCAGG - Intronic
1090611630 11:128476286-128476308 GTGGGTTAGGGGTATGTGGGAGG - Intronic
1090637056 11:128695724-128695746 GTAGGTGAGAAGTAGGTGAGAGG + Intronic
1090663738 11:128901154-128901176 ATGGGTGTGAAGTAGGAGGGTGG + Exonic
1091074968 11:132606852-132606874 TGGGGTGAGCGGTGGGTGGGGGG - Intronic
1091197877 11:133747359-133747381 CTGGGTGAGAAGGATGGGGGTGG - Intergenic
1091879986 12:3969247-3969269 ATGGGGGAAAGGTGGGTGGGAGG - Intergenic
1091949407 12:4580537-4580559 CTGGGAGGGAGGGAGGTGGCTGG - Intronic
1092843869 12:12566267-12566289 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1093031776 12:14295303-14295325 CTGGGGAAGAGGTATGTGGGTGG - Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093881928 12:24414588-24414610 CTGGGTGAGAGGCAGGCAGATGG - Intergenic
1094057225 12:26279786-26279808 CTTTGTGAGAGGCAGGTGGTAGG - Intronic
1094079701 12:26519997-26520019 CTGGCTGGGAGGTAGGTGGGAGG + Intronic
1095485489 12:42680134-42680156 GTGGGTGGGAGGCAGGTAGGTGG + Intergenic
1095485491 12:42680138-42680160 GTGGGAGGCAGGTAGGTGGGTGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095983074 12:47983671-47983693 CTGGGTTCCAGGTAGGTGGCTGG - Exonic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096498453 12:52051734-52051756 CTGGGTGCGGGGTAGGAGGTAGG + Intronic
1096718437 12:53504589-53504611 CTAGGTGAGAGGAAGGAGAGAGG - Intronic
1096856520 12:54488117-54488139 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
1097216692 12:57419548-57419570 CTACTTGAGAGATAGGTGGGAGG - Intronic
1098731083 12:74037613-74037635 CTGGGGGAGAGAAGGGTGGGTGG - Intergenic
1099102093 12:78455151-78455173 TTTGGTTAGAAGTAGGTGGGAGG - Intergenic
1099255396 12:80307873-80307895 CCGGGAGGGAGGGAGGTGGGGGG - Intronic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1100595069 12:96064547-96064569 CTGGGTGAGTAGTGAGTGGGTGG - Intergenic
1101381326 12:104216107-104216129 CTGGCTGTGAGAGAGGTGGGAGG + Intronic
1101727313 12:107398699-107398721 CTGGGGGACAGGTAGGGGGGTGG + Intronic
1102042380 12:109809097-109809119 ATGGGTGAATGGTGGGTGGGTGG - Intronic
1102756123 12:115342472-115342494 CGGGGTGGGGGGCAGGTGGGGGG - Intergenic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103534953 12:121627624-121627646 CTGCGTGTGAGGGAGGAGGGAGG + Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103741661 12:123095515-123095537 CTGGGTGACAGGTCGGAGGCGGG - Intronic
1103908605 12:124339906-124339928 CTTGGTGGGAGGTATATGGGAGG - Intronic
1103970961 12:124671199-124671221 GTGGGTCAGAGGTGGGTTGGGGG - Intergenic
1104559008 12:129826795-129826817 CTGGGTGAAATGCAGGTGTGGGG + Intronic
1104766060 12:131331074-131331096 ATGGTGGATAGGTAGGTGGGTGG - Intergenic
1104925951 12:132313970-132313992 GTGGGTGATGGGTGGGTGGGTGG - Intronic
1105367931 13:19779715-19779737 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1105857821 13:24387613-24387635 GTGGGTGGGAGATAGCTGGGTGG - Intergenic
1106602827 13:31201517-31201539 CTGGGAGAAAGGGAGGTTGGAGG + Intronic
1107013172 13:35687653-35687675 GTGGGTGCGGGGGAGGTGGGTGG - Intergenic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107715277 13:43193586-43193608 CTGGTTGATTGGTAGGTGGATGG + Intergenic
1107769546 13:43775383-43775405 CTTGGTGAGACCAAGGTGGGAGG - Intronic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1109376446 13:61500439-61500461 CTCTGTGAGAGGTAGGAGGATGG - Intergenic
1109548535 13:63860798-63860820 CAGTGGGAGGGGTAGGTGGGTGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1113406378 13:110044659-110044681 CTGGGAGAGGTGGAGGTGGGGGG - Intergenic
1113934158 13:113984613-113984635 ATGGGTGAGTGATAGGTGGATGG - Intronic
1113934533 13:113986744-113986766 ATGGGTGAGAGATGGGTGGATGG - Intronic
1113934835 13:113988523-113988545 ATGGGTGAGTGATAGGTGGATGG - Intronic
1113934986 13:113989233-113989255 ATGGGTGAGAGATGGGTGGATGG - Intronic
1113935028 13:113989417-113989439 ATGGGTGAGAGATGGGTGGATGG - Intronic
1113935094 13:113989704-113989726 TTGGGTGAGAGATGGGTGGATGG - Intronic
1114387755 14:22272631-22272653 CAGGGTGAGAGGGAAGTGGTAGG + Intergenic
1114508052 14:23232772-23232794 CTGGGAGGGAGGTGGGGGGGGGG + Intronic
1114615202 14:24064592-24064614 GTGGATGAGAGGGAGGTGGGGGG + Intronic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1115505785 14:34092988-34093010 CTGGGGTAGCGGTAGGTCGGGGG - Intronic
1115612389 14:35061319-35061341 CTGAGTGAGAGGCAGAAGGGCGG - Intronic
1115980401 14:39045911-39045933 CAAGGTGAGATGTGGGTGGGTGG - Intronic
1116058989 14:39897558-39897580 TTGGGTAAGAGGTATGTGGATGG + Intergenic
1118073460 14:62271431-62271453 CTGGGGAAGAGGTTTGTGGGAGG - Intergenic
1118183070 14:63512987-63513009 CTTGGTGGGGGGTAGGGGGGTGG - Intronic
1118384328 14:65243247-65243269 GTGTGTGAGAGTGAGGTGGGTGG + Intergenic
1119159948 14:72444359-72444381 CTGAGTGGGAGGGAGGTGAGGGG + Intronic
1119197922 14:72731380-72731402 CTGGGTGTGAGGGTGGGGGGTGG + Intronic
1119254457 14:73184523-73184545 CTGTCCGAGAGGGAGGTGGGGGG - Intronic
1119422968 14:74518497-74518519 CTGGGTTGGAGATAAGTGGGAGG - Intronic
1119435920 14:74597778-74597800 GTGGTGGAGAGGAAGGTGGGAGG - Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1121097147 14:91225459-91225481 CTGGGTGACTGGCAGGCGGGTGG - Intronic
1121195126 14:92065104-92065126 GTGGGTAAAAGATAGGTGGGTGG - Intronic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121276217 14:92669633-92669655 CTGGGTGGGGGTGAGGTGGGGGG + Intronic
1122077609 14:99246141-99246163 CTGGGTCCGAGGAAGGCGGGGGG - Intronic
1122636979 14:103134640-103134662 ATGGATGAGAGCTAGATGGGTGG - Intronic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1202884109 14_KI270722v1_random:87983-88005 GTTGGTGGGAGGTAGGAGGGAGG + Intergenic
1124616464 15:31245764-31245786 CTCGGTGAGAGGCACATGGGTGG + Intergenic
1124636164 15:31366321-31366343 CTTGGTGAGAGGAAGGGGGCTGG - Intronic
1125016985 15:34946742-34946764 CCGGGAGGGAGGGAGGTGGGGGG + Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125420031 15:39496185-39496207 CTGGGTGAGAAATAGGAGGCTGG - Intergenic
1125580699 15:40783402-40783424 ATGGGTGAGAGGAAGGGAGGGGG + Intronic
1125611793 15:40976393-40976415 CTGGGGGGGTGGTAGGAGGGTGG + Intergenic
1125751245 15:42030575-42030597 CTGTGTGAGAGGGAGATGGTGGG + Intronic
1126172319 15:45704984-45705006 CTGGGTGCGAGGGACGGGGGCGG - Intergenic
1126672801 15:51131891-51131913 CTGGTGGAGAAGTTGGTGGGAGG + Intergenic
1127269032 15:57384213-57384235 CTGGGTGTGAGGCAGCTGGATGG + Intronic
1127292010 15:57579604-57579626 CTGGGTGAGGAGGATGTGGGTGG - Intergenic
1127719398 15:61684878-61684900 CTGGAAGAGTGGTAGGTGAGAGG - Intergenic
1127966629 15:63927557-63927579 CTGGGTGTGAGTTAGGTGTATGG + Intronic
1128489615 15:68134369-68134391 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1128661981 15:69508212-69508234 GTGGGGGAGAGGTGGGTGTGAGG - Intergenic
1128992901 15:72275217-72275239 CTGGGTGCCAGGTACTTGGGTGG + Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1131670765 15:94617304-94617326 CTTGGAGAGAGGAAGGAGGGGGG - Intergenic
1132019091 15:98344924-98344946 ATGGGTGGGAGGTGGGTGGATGG + Intergenic
1134122801 16:11596696-11596718 CAGGGGGAGAGGGAGGAGGGGGG + Intronic
1134224400 16:12380380-12380402 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224411 16:12380407-12380429 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224675 16:12381214-12381236 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134502545 16:14780535-14780557 CTTGGCGAGAGGTATTTGGGTGG - Intronic
1134578018 16:15348360-15348382 CTTGGCGAGAGGTATTTGGGTGG + Intergenic
1134724570 16:16409186-16409208 CTTGGCGAGAGGTATTTGGGTGG - Intergenic
1134942861 16:18302673-18302695 CTTGGCGAGAGGTATTTGGGTGG + Intergenic
1135067941 16:19326444-19326466 ATAGGTAAGATGTAGGTGGGTGG - Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135976032 16:27109493-27109515 ATGGATGAGTGGTGGGTGGGTGG + Intergenic
1136223910 16:28846156-28846178 TTGGGGGAGTGGTAGGTGGCTGG - Intronic
1136427286 16:30177400-30177422 CTGGGACACAAGTAGGTGGGTGG + Intergenic
1136553231 16:30992795-30992817 CTGGGAGAGAGAAGGGTGGGGGG + Exonic
1136556806 16:31011687-31011709 CAGGTTGGGGGGTAGGTGGGCGG - Intergenic
1138199713 16:55079632-55079654 TTGGGTGAGAGGTGGATGGATGG - Intergenic
1138543975 16:57705556-57705578 ATGGATGGGAGGTGGGTGGGAGG - Intronic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1139375745 16:66495371-66495393 CAGGGTGGGAGGGAGGTGGGAGG - Intronic
1139594239 16:67948823-67948845 TTGGGTGAGAGGAAGGGGTGTGG + Intronic
1140236820 16:73166578-73166600 CTGGGAGAGAGGCAGGGAGGGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140771217 16:78205768-78205790 ATGGGTGAAGGATAGGTGGGTGG - Intronic
1141178303 16:81734976-81734998 GTGGGTGAGAGAAGGGTGGGTGG + Intergenic
1141497020 16:84417230-84417252 GTGAGTGAGAGGCAGGTGTGGGG + Intronic
1141895610 16:86956979-86957001 ATGGATGGGAGGAAGGTGGGGGG + Intergenic
1142142705 16:88479699-88479721 CTGGGTAGCAGGTGGGTGGGGGG - Intronic
1142203894 16:88773639-88773661 TTGGGTGACAGGCAGGTCGGGGG + Intronic
1142203904 16:88773681-88773703 CTGGGTGACAGGCAGGTCGGGGG + Intronic
1142203912 16:88773723-88773745 CTGGGTGACAGGCAGGTCGGCGG + Intronic
1142262755 16:89050428-89050450 GGGGGTGAGAGGTTGGGGGGGGG + Intergenic
1142284153 16:89164948-89164970 CTGGGCCAGAGCTGGGTGGGAGG - Intergenic
1142285447 16:89169772-89169794 TTGTGTCAGAGGTAGGTGGCAGG - Intergenic
1142287571 16:89177632-89177654 CTGGGGGAGAGGCAGGGGAGAGG - Intronic
1142503967 17:351121-351143 GTTGGAGAGAGGTAGGTCGGAGG - Intronic
1142761101 17:2042321-2042343 CTGGGTGGGAGGAATGCGGGTGG - Intronic
1142866883 17:2796572-2796594 GTGGGTGACAGGTGGGAGGGTGG + Intronic
1142963001 17:3563062-3563084 CTGGGCCAGAGGGAGGTGGGAGG - Intergenic
1143023679 17:3929208-3929230 CTGGAGGAGAGGGAGGTGAGAGG - Intronic
1143341395 17:6214062-6214084 GGGGCTGAGAGGTAGGAGGGTGG + Intergenic
1143465855 17:7135789-7135811 CAGGGGGAGGGGTTGGTGGGCGG + Intergenic
1143943401 17:10567331-10567353 CTGGGTGAAGGGTATGTGAGAGG - Intergenic
1144037670 17:11382005-11382027 CTGGGTTTGAGGTTGGTGGTTGG + Intronic
1144730504 17:17523290-17523312 CTGGGGTGGAGGTAGGTGGCTGG - Intronic
1145684356 17:26638649-26638671 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145684546 17:26639080-26639102 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1146283503 17:31559736-31559758 CTGGGGGAGGGGGAGGTGCGGGG - Intergenic
1146286178 17:31575528-31575550 GTGGGTGAGAGGCAGGTTGCTGG - Exonic
1146826736 17:36029633-36029655 ATGGATGAGAGGTGGATGGGTGG - Intergenic
1146911584 17:36651744-36651766 CTGGGGGAGAGGTAGGTAGGGGG - Intergenic
1147052417 17:37805484-37805506 CTAGCTGAGAGGTGGGCGGGTGG - Intergenic
1147154894 17:38539490-38539512 CAGGGTGAGAGAGAGGTAGGTGG + Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1148350277 17:46936508-46936530 CAGGGTGTGAGGCAGGTGGAGGG - Intronic
1148471366 17:47895874-47895896 CTGGGTTAGAGGTGGGTGGAAGG + Intergenic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1149054511 17:52347031-52347053 CTGTGTGCAAGGTGGGTGGGGGG + Intergenic
1149712942 17:58759069-58759091 GTGGGGGAGTGGAAGGTGGGCGG - Intronic
1150625101 17:66836346-66836368 ATGGGTGTGAGGTGGCTGGGAGG - Intronic
1150802751 17:68294644-68294666 CTGGGTGGGAGCATGGTGGGTGG - Intronic
1151419087 17:73985662-73985684 CTGGGTGAGAGGCAAGGGGCTGG - Intergenic
1151512997 17:74573092-74573114 CTGGATGTGAGGGAGGAGGGAGG + Intergenic
1151713903 17:75821819-75821841 CTGGGTTGGCGGTGGGTGGGAGG + Intronic
1151720824 17:75855079-75855101 CGGGGTTGGAGGAAGGTGGGTGG - Intronic
1152033563 17:77858280-77858302 TTGGATGAGGGGTGGGTGGGTGG - Intergenic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152336527 17:79702375-79702397 CTGGGTGGGAGGTAGGGCCGGGG - Intergenic
1152444987 17:80337260-80337282 CTGGTAGAGAGGCAGGCGGGCGG + Intronic
1152485876 17:80592446-80592468 CTGGGTGTGATGGCGGTGGGAGG + Intronic
1152831111 17:82497460-82497482 CTGGGTGGGAGGGAGGTCGGCGG - Intergenic
1152862449 17:82703948-82703970 TTGGGTGAGAGTCAGGTTGGAGG - Intergenic
1152911843 17:83009714-83009736 CTGGGTGCGAGGGAGGAAGGAGG + Intronic
1153416384 18:4850414-4850436 GGGGGTGAGAGGAAGGTGGCTGG - Intergenic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1153544383 18:6191185-6191207 CTGGGGCAGAGGGAGGTGGCTGG + Intronic
1155659437 18:28230227-28230249 CTTGTTGAGAGACAGGTGGGAGG + Intergenic
1155963722 18:32017377-32017399 CTGGGTGTGAGCTACTTGGGAGG - Intergenic
1157009987 18:43635634-43635656 CAGAGTGAGAGGCAGGTAGGCGG + Intergenic
1157610559 18:48952360-48952382 AGGGGAGAGAGATAGGTGGGGGG + Intergenic
1157627204 18:49060703-49060725 GGGGGAGAGAGGGAGGTGGGGGG + Intronic
1157705314 18:49800256-49800278 CCGGGAGGGAGGGAGGTGGGGGG + Intronic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1158876632 18:61740219-61740241 CTGGCTGAGAGGTGGTGGGGAGG - Intergenic
1158883878 18:61806967-61806989 ATGGGGCAGAGGTGGGTGGGTGG - Intergenic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1160253122 18:77221453-77221475 ATGGGTGGGTGGTGGGTGGGTGG - Intergenic
1160253148 18:77221588-77221610 TTGGGTGAGTGGTGGGTGGAAGG - Intergenic
1160318199 18:77867313-77867335 CAGGTGGAGAGGAAGGTGGGTGG - Intergenic
1160409839 18:78667950-78667972 CTAGGGGAGAGGTGGGAGGGTGG - Intergenic
1160526522 18:79541947-79541969 ATGGGTGGGTGGTGGGTGGGTGG - Intergenic
1160960398 19:1718305-1718327 GTGGGTGGGTGGTGGGTGGGTGG + Intergenic
1160977714 19:1802079-1802101 GTGGGTGAGGGGTGGATGGGTGG - Intronic
1161090544 19:2357883-2357905 GTGGGTGGGTGGAAGGTGGGTGG - Intergenic
1161091883 19:2364633-2364655 CTGGGTGGAAGGTGGGTGTGCGG - Intergenic
1161262101 19:3343824-3343846 CTGGGACAGGGGTGGGTGGGTGG - Intergenic
1161335165 19:3709036-3709058 CAGGGTGAGGGGTTGGGGGGCGG - Intronic
1161488056 19:4546366-4546388 CTGCGGGAGAGGGAGGTGGGTGG - Intronic
1161499142 19:4603687-4603709 TGGGGTGAGAGGGTGGTGGGTGG + Intergenic
1161504332 19:4635933-4635955 CTGGGAGAGGGGTAAGGGGGAGG + Intergenic
1161685851 19:5702239-5702261 CTGGGAGGGAGGTTGGGGGGGGG + Intronic
1161750353 19:6091743-6091765 ATGGGAGAGAAGTAGGTGTGGGG + Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161984795 19:7647278-7647300 CTGGGTCTGTGTTAGGTGGGCGG + Intronic
1162184252 19:8892347-8892369 CTGGAGGAAAGGGAGGTGGGTGG + Intronic
1162188724 19:8927779-8927801 ATGGGTGAGAGGTAGGGGAGGGG + Intronic
1162771988 19:12954579-12954601 ATGGGTGAGATATGGGTGGGTGG - Intronic
1163450388 19:17373580-17373602 GTGGGTGAGAGATGGGAGGGTGG - Intronic
1163730590 19:18947090-18947112 CTGGGTGCCAGGTGGCTGGGCGG + Intergenic
1163828962 19:19538709-19538731 GTGTGTGGGAGTTAGGTGGGAGG - Intronic
1163844095 19:19628768-19628790 CAGGGTGAGGGGTACGGGGGCGG - Exonic
1163849237 19:19654195-19654217 CGGGGTGAGAGGTAGGGGCTTGG - Intronic
1163945290 19:20529994-20530016 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1164298408 19:23937143-23937165 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165175391 19:33925740-33925762 CTGGGTGAGGGATAGGAGGAAGG + Intergenic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165455687 19:35909331-35909353 CTTGGGGAGAGGCAGGTGGCTGG + Intergenic
1165710871 19:38009901-38009923 GTGGGTTGGAGGAAGGTGGGTGG + Intronic
1166047693 19:40238991-40239013 CAGGGTGGGAGGTGGGAGGGAGG + Intronic
1166180159 19:41103090-41103112 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1166315178 19:41985547-41985569 GTGGGTGAGTGGTGTGTGGGAGG + Intronic
1166390609 19:42407043-42407065 CTGGGTGAGCAGGAGCTGGGAGG + Intronic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166502985 19:43354587-43354609 CCGGGTGGCAGGTCGGTGGGAGG - Intronic
1166997852 19:46728292-46728314 GTCGGGGAGAGGCAGGTGGGAGG - Intronic
1167103233 19:47416774-47416796 CTCGGTGTGTGGTGGGTGGGAGG + Intronic
1167403145 19:49286409-49286431 ATGGTGGGGAGGTAGGTGGGAGG + Intergenic
1167441704 19:49512910-49512932 CTGGGTCTGAGGGAGGAGGGAGG + Intronic
1167811967 19:51841205-51841227 CTGGGTGAGAGGGGCCTGGGGGG - Intergenic
1167820322 19:51921916-51921938 CTCGGTGAGGGGGATGTGGGAGG - Intronic
1168325498 19:55536766-55536788 CTGGGTCGGAGGGAGGTGGGTGG - Intronic
1168723540 19:58568786-58568808 GTGGCTGAGAGGTAGATGGCAGG + Intronic
1202659527 1_KI270708v1_random:55117-55139 GTTGGTGGGAGGTAGGAGGGAGG + Intergenic
925499327 2:4486302-4486324 GTGGGGGAGAGGTATGTGGATGG - Intergenic
925519479 2:4726014-4726036 CTGTGTGTGAGGTTGGTGGGAGG + Intergenic
925619136 2:5773662-5773684 CTGGGTGAGAGGGAGGCCGTGGG - Intergenic
926221980 2:10942366-10942388 CTGGGTGAGGGATATGAGGGTGG - Intergenic
927067362 2:19486821-19486843 TTGGGTGAGTGGTAACTGGGAGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
929690189 2:44067257-44067279 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
930136369 2:47906557-47906579 CGGGGGGAGGGGTGGGTGGGCGG + Intergenic
932414898 2:71567742-71567764 CTTGGTGAGGGGTAGGGGGTGGG + Intronic
932451351 2:71812727-71812749 CTGGAAGAGCTGTAGGTGGGAGG + Intergenic
932457245 2:71857599-71857621 TTTGGTGAGGGGTAGGAGGGAGG - Intergenic
932597110 2:73101018-73101040 CTGGGAGAAAGGTTGGTGGTGGG + Intronic
932626419 2:73299828-73299850 GAGGGTCAGAGGTAGGTGGACGG + Intergenic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
933726567 2:85430649-85430671 CTGGGTGAGGGCTAGGAGGTGGG + Intronic
934674844 2:96242254-96242276 ATGGATGAGAGGGAGGTGGGTGG - Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935589800 2:104835828-104835850 CAGGGTGTGGGGGAGGTGGGGGG + Intergenic
936109547 2:109653648-109653670 CTGGGTGTGACATAGGTGGTGGG + Intergenic
937273854 2:120671864-120671886 CAGGGAGAGAGGGAGGTGAGGGG + Intergenic
937346746 2:121130672-121130694 CTGGCTGAGAGGTGGGAGGAGGG - Intergenic
937378841 2:121357410-121357432 CTGGGTGGGAGGTGGGGGGCAGG - Intronic
938143261 2:128813195-128813217 CTGGGGGTGAGGTGGGAGGGAGG - Intergenic
938293806 2:130164241-130164263 CTGAGTGACAGGTGGGTGGTGGG + Intronic
938462739 2:131508721-131508743 CTGAGTGACAGGTGGGTGGTGGG - Intergenic
938463472 2:131512287-131512309 CTGCGTGTGAGGCAGGGGGGTGG + Intergenic
938828795 2:135033248-135033270 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
939984238 2:148814317-148814339 CTGGGTGGGGTGGAGGTGGGAGG + Intergenic
940194639 2:151080195-151080217 CTGAGAGAGAGGACGGTGGGTGG + Intergenic
940579493 2:155559590-155559612 GAGGGTGAAAGGTAGGTGGAGGG + Intergenic
940652394 2:156451749-156451771 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
941095493 2:161236989-161237011 CTGGGTGGGCGGGAAGTGGGGGG - Intergenic
941423367 2:165312144-165312166 CTGGATGAGTGGGAGGTGGCAGG - Intronic
942665101 2:178309108-178309130 CTGGTTGAGAGGAGGGTGGTGGG - Intronic
943005842 2:182386784-182386806 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
943317840 2:186411689-186411711 TTGGGGAAGAGGTATGTGGGTGG - Intergenic
943548233 2:189308201-189308223 TTGGCTGAGAGGGAGGGGGGAGG - Intergenic
944255383 2:197618991-197619013 CCGGGAGGGAGGGAGGTGGGGGG + Intronic
944591299 2:201220312-201220334 CTGGCATAGAGGGAGGTGGGGGG + Exonic
945251599 2:207769595-207769617 CTGGGCGGGAGGAAGGCGGGAGG + Intergenic
945642264 2:212444466-212444488 CTGGGGAAGAGGTATGTGGGTGG + Intronic
946011056 2:216563828-216563850 CTGGGTGGGGGGTGGGTAGGCGG - Intronic
946021020 2:216640131-216640153 CTGCTTGCTAGGTAGGTGGGTGG + Intronic
946365708 2:219247754-219247776 CTGGGTGAGGAGCATGTGGGTGG + Exonic
947704349 2:232262266-232262288 CAGGGAGAGATGTAGGTGAGGGG - Intronic
947798016 2:232906328-232906350 CCGTGTGGGAGGGAGGTGGGGGG + Intronic
947798094 2:232906504-232906526 CCGTGTGGGAGGGAGGTGGGGGG + Intronic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948518130 2:238519150-238519172 CTGGGTGGGAGGGGGGTGAGGGG - Intergenic
948609741 2:239159353-239159375 GTGGGTGTGAGGTGGGTGTGGGG - Intronic
948671988 2:239574687-239574709 CAGGGTGAGAGTGAAGTGGGTGG - Intergenic
948765578 2:240217089-240217111 CAGGGTGAGGGGTGGGGGGGTGG + Intergenic
948992161 2:241560696-241560718 CTGGGTGGGAGCTAGGGGGTTGG + Intronic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
949048308 2:241882311-241882333 CCTGGTGAGAGGTGGCTGGGAGG + Intergenic
1168965591 20:1896063-1896085 CTGGGAGAGAGGGAGCCGGGAGG + Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169273362 20:4217197-4217219 CTGGGTGTGAGCTATGAGGGAGG + Intergenic
1169557921 20:6768898-6768920 CGGGGTGGGTGGTGGGTGGGAGG + Intronic
1169660429 20:7972910-7972932 CTGGGGAGGAGGTGGGTGGGAGG - Intergenic
1171183440 20:23108017-23108039 ATGGGTGAGAGAAAGGTAGGTGG - Intergenic
1171274915 20:23848236-23848258 GTGGGTGAGAGGAGGGTGTGGGG + Intergenic
1171861567 20:30405816-30405838 CTGCCTGGGAGGGAGGTGGGGGG + Intergenic
1172182975 20:33014880-33014902 CTGGGGGGGAGGTGGGAGGGTGG - Intronic
1172240827 20:33411483-33411505 CTGGGGGAGGTGGAGGTGGGTGG - Intronic
1172275555 20:33677082-33677104 GTGGGTGATGGGTAGGTGGGTGG - Intronic
1172298233 20:33829188-33829210 CTGGGAGAGAGGAGGGTGTGTGG + Intronic
1172327845 20:34050854-34050876 GTGGGTGAGAGCCTGGTGGGAGG - Intronic
1172354263 20:34268845-34268867 CTGGGGGAGCGGGCGGTGGGCGG + Intronic
1172479867 20:35264793-35264815 CTGGGAGAGAGGTGTGTAGGAGG - Intronic
1172479924 20:35265096-35265118 TGGGGTGAGAGGAAGGAGGGAGG + Intronic
1172502173 20:35435082-35435104 CTGGGAGAGAGATAGGTAGAAGG - Exonic
1172666949 20:36606666-36606688 CTGGGTGAGTGTGAGGTGTGGGG + Intronic
1173205650 20:40991194-40991216 CTGGTTGAGGAGTTGGTGGGGGG - Intergenic
1173222029 20:41138412-41138434 CTGGGGGAGAGGGAGGAAGGTGG + Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1174073989 20:47919147-47919169 CAGGGAGAGAGGGAGGTGAGTGG + Intergenic
1174263924 20:49318213-49318235 CTCGGTGACAGGTAGGAGGTGGG + Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174477640 20:50807650-50807672 AAGGGTGGGAGGTAGGTGAGGGG - Intronic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1174978483 20:55362846-55362868 CTGTGTGAGCTGTAGCTGGGAGG - Intergenic
1175151327 20:56937017-56937039 CTGGCTGGAACGTAGGTGGGAGG + Intergenic
1175191196 20:57213115-57213137 GTGGGTGAGAGGGCCGTGGGTGG - Intronic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175564027 20:59958632-59958654 CTGGCTGAGAAGGAGGTGTGTGG + Exonic
1175667914 20:60876269-60876291 CTGGCTGAAAGGGAGATGGGTGG - Intergenic
1175706358 20:61180658-61180680 CTGGGTGAGAGATAGGCAGGTGG - Intergenic
1175766072 20:61594010-61594032 GTGGGAGAGAGGGAGGAGGGAGG + Intronic
1175883529 20:62274353-62274375 GTGGATGAGAGGGATGTGGGTGG + Intronic
1176017983 20:62946680-62946702 CTGGGAGAGTGGTAGTTGGAAGG - Exonic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176283522 20:64328524-64328546 CTGGAGGAGAGGAAGGTGTGGGG + Intergenic
1176348306 21:5770714-5770736 CTGGGGGGGAGAGAGGTGGGCGG - Intergenic
1176355120 21:5891298-5891320 CTGGGGGGGAGAGAGGTGGGCGG - Intergenic
1176408997 21:6437591-6437613 CTGGCAGGGAGGCAGGTGGGAGG - Intergenic
1176496521 21:7553741-7553763 CTGGGGGGGAGAGAGGTGGGCGG + Intergenic
1176542627 21:8168784-8168806 CTGGGGGGGAGAGAGGTGGGCGG - Intergenic
1176561578 21:8351829-8351851 CTGGGGGGGAGAGAGGTGGGCGG - Intergenic
1177047704 21:16190998-16191020 CTGGGTGACACGTTGGTGTGTGG + Intergenic
1177178303 21:17720144-17720166 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1178688111 21:34727560-34727582 ATGGATGAGAGGCAGGTGGTGGG - Intergenic
1179452305 21:41474879-41474901 GTGGGTGAGGGGTGGGTGAGGGG + Intronic
1179684490 21:43045913-43045935 CTGGCAGGGAGGCAGGTGGGAGG - Intergenic
1180326995 22:11438678-11438700 GTTGGTGGGAGGTAGGAGGGAGG + Intergenic
1181068169 22:20316357-20316379 CTGGGTGACAGTGGGGTGGGAGG - Intronic
1181084607 22:20433762-20433784 CTGGGTCAGGGCTGGGTGGGTGG - Intronic
1181185899 22:21103407-21103429 CTGGGTGGGGGGGAGGGGGGAGG + Intergenic
1181324296 22:22032860-22032882 CAGGGTGAGAGGTGGGTCAGTGG - Intergenic
1181875240 22:25935509-25935531 TTGGGTGAGGGGGAGGTGAGAGG + Intronic
1182089786 22:27586277-27586299 ATGGGTGAGGGATAGGTTGGTGG - Intergenic
1182616390 22:31592185-31592207 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182616590 22:31592637-31592659 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182778507 22:32849268-32849290 TGGGGTGAGAGGGAGGTTGGAGG - Intronic
1182892670 22:33832013-33832035 CTGGGTGAAAGGAAGAAGGGAGG - Intronic
1182961311 22:34477952-34477974 GTGGGTGAGAGACAGGTGAGAGG + Intergenic
1184150643 22:42636363-42636385 CTGGGGGAGGGGGAGGAGGGAGG + Intronic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1184765826 22:46571965-46571987 CTGGGTGATAAGCAGGTGGGAGG - Intergenic
1184773947 22:46613904-46613926 CTGGGAGGGAGGTGGGTGAGGGG + Intronic
1185079373 22:48701309-48701331 CGTGGTGAGAGGAAGCTGGGTGG + Intronic
1185192864 22:49449920-49449942 CTGGGCGAGAGGTGGACGGGTGG - Intronic
1185192877 22:49449968-49449990 CTGGGCGAGAGGTGGACGGGTGG - Intronic
1185340451 22:50288591-50288613 CTGGATGAGGGGTGGCTGGGTGG - Intronic
1185348092 22:50319426-50319448 CTGGGCAAGAGGTGGTTGGGTGG - Intronic
1203247492 22_KI270733v1_random:85027-85049 CTGGGGGGGAGGGAGGTGGGCGG - Intergenic
949268826 3:2190612-2190634 CTGCATGGGTGGTAGGTGGGAGG + Intronic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
949693548 3:6667855-6667877 CTGTGTGGGAGGTGGGTGTGGGG + Intergenic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
950118242 3:10464942-10464964 CTGGGGTAGAGGTGGGTGGCAGG - Intronic
950785109 3:15427755-15427777 CTGGGTGCGAGGCAGGTGCGGGG + Exonic
951204273 3:19909548-19909570 CTGGGGGTGGGGTAGGTGGTGGG + Intronic
951451907 3:22849601-22849623 GTGGGTCGGAGGTAGGCGGGAGG + Intergenic
952470141 3:33639299-33639321 CTTGGGGAGATGGAGGTGGGTGG - Intronic
954059585 3:48056648-48056670 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
954396231 3:50294854-50294876 CTGGGTGGGAGGTAGATGCTGGG + Exonic
954406834 3:50349894-50349916 CGGGGTGAGCGGTGGGTGGCAGG - Intronic
954409408 3:50363933-50363955 CAGGGCGAGGGGTTGGTGGGAGG - Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956717717 3:72092857-72092879 TTGGGGGCGAGGGAGGTGGGAGG + Intergenic
956718327 3:72097892-72097914 CTGGGAGAGAGAAAGGTTGGAGG + Intergenic
956790053 3:72673393-72673415 CGGGGTTAGAGGTAGGTGAGAGG + Intergenic
957165838 3:76672630-76672652 CTAGGTTAGAGGTATGTAGGGGG + Intronic
957373645 3:79328794-79328816 CTGGGTGAAAGATGGGAGGGGGG - Intronic
960494657 3:118360124-118360146 TTGGGGAAGAGGTAAGTGGGTGG - Intergenic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
961204524 3:125070734-125070756 GTGAGTGAGAGGTAGGTGAATGG + Intergenic
961457655 3:127032171-127032193 CTGCGTGAGATGCAGGTGGTGGG + Intronic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962730837 3:138282051-138282073 CTGGCTGAGAAGTAGGAGCGGGG - Intronic
962754115 3:138455390-138455412 CTGGGTGGGAGAAAGGTGGGAGG - Intronic
964037005 3:152211209-152211231 GTGGGTGGGAAGTACGTGGGAGG + Intergenic
964384842 3:156136648-156136670 TTGGAGGAGAGGTAGGTGAGCGG - Intronic
964468855 3:157030133-157030155 CATGGTGAGAGAGAGGTGGGGGG + Intronic
965291662 3:166888962-166888984 TTGGGTAAGAGGTATGTGGATGG - Intergenic
965590885 3:170358457-170358479 CCGGGTTAGAGATAGGTGGGTGG + Intronic
966202020 3:177367469-177367491 GTGGGTGAGAAGAAAGTGGGTGG + Intergenic
966622675 3:181982829-181982851 CTGAGTGGGATGTTGGTGGGAGG + Intergenic
966729670 3:183140161-183140183 CTGTGTGAGACTGAGGTGGGTGG + Intronic
966881080 3:184351689-184351711 CAGGGTCAGAGCTAGGCGGGAGG - Intronic
967506975 3:190263482-190263504 CTGGTTGAGAGGGAGGGTGGTGG + Intergenic
968434505 4:577435-577457 GTGGGTGAGAGGAAGGCGTGGGG + Intergenic
968455374 4:695766-695788 CAGGGACAGAGGTAGGTGGGAGG + Intergenic
968682147 4:1928737-1928759 CAGGGGCAGAGGTGGGTGGGAGG + Intronic
969100620 4:4765546-4765568 CTGGGTTGAAGGTGGGTGGGAGG - Intergenic
969344280 4:6561456-6561478 CTGGGTCGGAAGGAGGTGGGGGG + Intronic
969501589 4:7556742-7556764 ATGGGTGGTAGGTAGATGGGTGG - Intronic
969575613 4:8034490-8034512 GTGGGTGGGTGGTAGGTAGGTGG + Intronic
969575623 4:8034519-8034541 GTGGGTGGGTGGTAGGTAGGTGG + Intronic
969575653 4:8034605-8034627 GTGGGTGGGTGGTAGGTAGGTGG + Intronic
971803400 4:31321851-31321873 CTGGGTGGGAGGTACGTGTGAGG - Intergenic
972793549 4:42395339-42395361 CTGGGCGAGGGGTTGGGGGGAGG - Intergenic
973593597 4:52465313-52465335 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
974516338 4:62917838-62917860 CTGGGTGAGTGATAAGTGAGTGG + Intergenic
976515022 4:85955219-85955241 CGGGGTGGGGGGTAGGCGGGGGG - Intronic
976970241 4:91094516-91094538 CTTGGGGACAGGTAGGAGGGGGG + Intronic
977930320 4:102743190-102743212 TTGGGGAAGAGGTACGTGGGTGG - Intronic
980349384 4:131666963-131666985 CTTGCTGAGAGGTAGGGGAGTGG - Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981677482 4:147358048-147358070 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
984533561 4:180945067-180945089 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
985522960 5:387557-387579 CAGGGTGAAAGGCAGGTGGAGGG - Intronic
985537257 5:472452-472474 CTGGGTGAGAGGTGGCCTGGCGG - Intronic
985676192 5:1232413-1232435 CTGGATGAGAGGTGGGGCGGGGG + Intronic
985838910 5:2291120-2291142 CTGGGTGATTGGGAGCTGGGCGG - Intergenic
985998344 5:3610437-3610459 GAGGGTGAGAGGTATCTGGGAGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
987132958 5:14875711-14875733 CTTGGTGAGGGGTCGGTGGGGGG - Intergenic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
988730616 5:33969438-33969460 CAGGATTAGAGGTAGGTGGATGG - Intronic
989343363 5:40402209-40402231 CAGGGTCTGAGGCAGGTGGGGGG - Intergenic
990325767 5:54673921-54673943 CTGTGTGTGTAGTAGGTGGGTGG - Intergenic
990449100 5:55918794-55918816 CTGGGTGGGTGGTGGGGGGGTGG - Intronic
990870987 5:60431176-60431198 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
991513154 5:67402757-67402779 CTGGTTGAGAGAAACGTGGGAGG + Intergenic
991569289 5:68037426-68037448 CTGGATAAGAGGTATGTTGGTGG - Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
991947624 5:71915010-71915032 GTGGGTGGGCGGAAGGTGGGGGG + Intergenic
995188804 5:109298957-109298979 ATGTGTGTGAGTTAGGTGGGAGG + Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
997305476 5:132832684-132832706 AGAGGTGAGTGGTAGGTGGGTGG - Intergenic
997305490 5:132832778-132832800 AGAGGTGAGTGGTAGGTGGGTGG - Intergenic
997305503 5:132832871-132832893 AGAGGTGAGCGGTAGGTGGGTGG - Intergenic
997309291 5:132866502-132866524 CTGGGTGACCCGTAGGTGGGAGG - Intronic
997734362 5:136202649-136202671 CTGGATGAGAGGTGGGCTGGGGG + Intergenic
997874786 5:137537884-137537906 CCGGGAGGGAGGGAGGTGGGGGG - Intronic
998375971 5:141691059-141691081 CTAGGAAAGAGGTAGATGGGTGG - Intergenic
998375992 5:141691191-141691213 CTAGGAAAGAGGTAGATGGGTGG - Intergenic
998764188 5:145466878-145466900 CAGGGTGGGTGGTAGGTGTGAGG - Intergenic
999079783 5:148832295-148832317 GTGGGTGGGAGGTTGGAGGGGGG - Intergenic
999242553 5:150136294-150136316 CTGGGTGGGAGAGAGATGGGAGG + Intronic
999743422 5:154574116-154574138 CTGAGGGAGAGGCAGGTGCGTGG - Intergenic
999870272 5:155742644-155742666 CTTGGTATGAGGTGGGTGGGGGG - Intergenic
1001121916 5:168987848-168987870 TTCGGTGTTAGGTAGGTGGGGGG + Intronic
1001287478 5:170434611-170434633 CTGGGGGACGGGTCGGTGGGTGG + Intronic
1001318772 5:170663415-170663437 CTGGGGGAGAGGCACCTGGGTGG - Intronic
1001374492 5:171243188-171243210 TGGGGTGAGAGGTAGGGGGAAGG - Intronic
1001492850 5:172168012-172168034 CTGGCTGAGTGGCAGGTGTGAGG + Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1002065287 5:176648566-176648588 CTCGGTGACACGTGGGTGGGGGG - Intronic
1002169185 5:177366013-177366035 CTGAGTGGGAGGGAGGAGGGAGG + Intronic
1002408401 5:179054170-179054192 CTTGGGGACAGGTAGGAGGGGGG + Intergenic
1002805862 6:573395-573417 CGGGGCGGGAGGCAGGTGGGAGG - Intronic
1004421412 6:15473540-15473562 ATGGGTGTGAGGTGGGTGGCAGG - Intronic
1005063385 6:21797067-21797089 CGGGGAGAGAGGGAGATGGGGGG - Intergenic
1005063458 6:21797247-21797269 CCGGGAGAGAGGGAGGTGGGGGG - Intergenic
1005158926 6:22836939-22836961 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1005189988 6:23210448-23210470 CAGGGGGAAAGGTAGGTGGGAGG - Intergenic
1006029875 6:31170747-31170769 GTGGAGGAGAGGGAGGTGGGGGG + Intronic
1006437068 6:34031216-34031238 CGGGCTAAGAGGCAGGTGGGTGG - Intronic
1007291571 6:40791200-40791222 CTGGGTGTGAGGAAGATAGGAGG - Intergenic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007486090 6:42181724-42181746 CTGGGTGTGGGGGAGGTGTGGGG + Intergenic
1007787592 6:44290014-44290036 CTGGTTGAGAGGCGGGTGGCAGG + Intronic
1009270074 6:61604027-61604049 CTGGTTGAGAGGTAGTGGAGGGG - Intergenic
1009712696 6:67346324-67346346 GTGGGTGAGTGGCAGGTAGGTGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010395173 6:75383552-75383574 CTTGGTGAGTGGAATGTGGGAGG - Intronic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011281085 6:85678686-85678708 CTGGGCGGGTGGTAGGTGAGTGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012943154 6:105438517-105438539 AAGGGTGAGAGGGAGGAGGGAGG - Intergenic
1013610355 6:111788869-111788891 GTGGGTGGGAGGGAGGTGGGAGG + Intronic
1014645056 6:123962911-123962933 GTGGGTGAGTGGCAGGTGGCTGG - Intronic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015253791 6:131155255-131155277 CTTTGTGAGACCTAGGTGGGAGG - Intronic
1015262980 6:131259881-131259903 CTGGGTGATGGGTTGATGGGTGG - Intronic
1015548293 6:134385386-134385408 ATGGGCCAGAGGTAGGTGGTTGG - Intergenic
1017078084 6:150638422-150638444 CTGGCTGAGTGGTAGGGGGAGGG - Intronic
1017635240 6:156436822-156436844 CTGGGCTAAAGGTAAGTGGGAGG - Intergenic
1018027264 6:159816173-159816195 CAGGGGGAGAGGTGGGGGGGAGG - Intronic
1018176811 6:161184418-161184440 ATGGGGGAGAGGAAGGTGTGTGG + Intronic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018586079 6:165360626-165360648 CTGGGGAAGAGGTGGCTGGGAGG + Intronic
1018631033 6:165822674-165822696 CTGGGTGAGTGATAAGTGAGTGG + Intronic
1019187375 6:170228693-170228715 GTGGCTGAGAGTGAGGTGGGAGG - Intergenic
1020014070 7:4820866-4820888 CGTGGTGAGAGGGAGGTGGCGGG - Intronic
1021207497 7:17802168-17802190 CTAGGTGAGAAGTAGGTTTGTGG + Intronic
1021491807 7:21227162-21227184 ATAGGTGACAGGTGGGTGGGTGG - Intergenic
1022041360 7:26584739-26584761 CTGCGCGAGAGGTAGGTAAGTGG - Intergenic
1022091985 7:27113873-27113895 GTGGGGGAGGGGTGGGTGGGTGG - Intronic
1022424777 7:30257817-30257839 CTTAGTGGGAGGTATGTGGGAGG + Intergenic
1022447690 7:30483299-30483321 CTTGCTGAGAGGTAGGGGAGCGG - Intergenic
1022534463 7:31087175-31087197 CTGGCTGAGACGCAGCTGGGTGG - Intronic
1022539178 7:31120787-31120809 CTGGCTGAGAGGAAGGTGGCTGG + Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1023160614 7:37292773-37292795 CTGGGAGGGAGGGAGGTGGGGGG + Intronic
1024048555 7:45601764-45601786 CGGGATGAGAGGTAGGGGTGAGG + Intronic
1024202951 7:47125127-47125149 CTTGCAGAGAGGAAGGTGGGAGG - Intergenic
1024935649 7:54709509-54709531 GTGGGTGTGAGGTGTGTGGGAGG - Intergenic
1025024605 7:55506105-55506127 CTGGGTGAGAGATGGGAGGTGGG - Intronic
1026362994 7:69619813-69619835 GTGGGGGAGAGGTGGGTGAGTGG + Intronic
1026613529 7:71881827-71881849 CTTTGGGAGACGTAGGTGGGAGG + Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1028032188 7:85930238-85930260 GTGAGAGAGAGGGAGGTGGGTGG - Intergenic
1028837988 7:95396142-95396164 CTGGGTGAGATGGAGGAGTGAGG + Intronic
1029548693 7:101224783-101224805 ATGGGTGACAGGGAGGTGGCGGG + Intergenic
1029609409 7:101618723-101618745 CTGCGTGAGAGGCTGGTGGGAGG - Intronic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1031474364 7:122204729-122204751 TTGGGGAAGAGGTATGTGGGTGG - Intergenic
1032416934 7:131743032-131743054 GTGGGTGACAGGTGGGTGGGAGG - Intergenic
1032501075 7:132400378-132400400 CTGGGTGACAGGTAGGAGACAGG - Intronic
1032908644 7:136403526-136403548 CTGGGTGAGTGGTGAGTGAGTGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033206590 7:139428383-139428405 CTGAGTGGGAGGGTGGTGGGTGG - Intergenic
1033366167 7:140673682-140673704 CTGGGAGCCAGGTAGGTGAGGGG - Exonic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034221086 7:149446792-149446814 GTGGGTGAGGAGCAGGTGGGAGG - Intronic
1034423649 7:151001798-151001820 CTGCGGGAGAGGAAGGTGTGAGG - Intronic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1034560581 7:151877155-151877177 CTGGGCGAGAGGGAGGGCGGCGG + Intergenic
1034723301 7:153314808-153314830 CCGGGAGGGAGGTGGGTGGGGGG - Intergenic
1034843642 7:154422741-154422763 ATGGGTGGGTGGGAGGTGGGTGG + Intronic
1035425481 7:158769351-158769373 CTGTGTGTGAGAAAGGTGGGTGG - Intronic
1035683680 8:1507808-1507830 CTGGGAGGGAGGGTGGTGGGTGG - Intronic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1035863900 8:3060430-3060452 CTTTGTGAGACGAAGGTGGGTGG - Intronic
1036195973 8:6715226-6715248 GTGGGTGAGAGGTAGGGGTTTGG + Intronic
1036549981 8:9807162-9807184 CTTGCTGAGAGGTAGTGGGGTGG - Intergenic
1036627076 8:10480934-10480956 CAGGTTGAGTGGTAGATGGGGGG + Intergenic
1036648275 8:10625613-10625635 CTGTGTGGGAGGTGGGTTGGGGG - Intronic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037739644 8:21597992-21598014 ATGGGAGAGAGGCAGGAGGGAGG + Intergenic
1037829068 8:22177544-22177566 CTGGGAGAGAGGGAGGAGGCGGG - Intronic
1037909214 8:22733760-22733782 CTGGGTGAAATGTAGGGGTGGGG + Intronic
1037949078 8:23007143-23007165 CTGAGTGAGGGGGAGCTGGGGGG + Exonic
1038526512 8:28278769-28278791 CTGGGTGAGGGGTAGACGGAGGG + Intergenic
1041536016 8:58926239-58926261 CTGGGTGAGAGGAAGATGGCTGG + Intronic
1041617737 8:59928007-59928029 TTGTGTGAGGGGTAGGTGAGTGG + Intergenic
1041737426 8:61126246-61126268 TGGGGTGAGAGCTGGGTGGGAGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043118800 8:76294962-76294984 TTGAATGACAGGTAGGTGGGAGG - Intergenic
1045362866 8:101449113-101449135 CTGGGTGGGAGGTCGGGGTGGGG + Intergenic
1045576848 8:103431761-103431783 ATGAGTGTTAGGTAGGTGGGAGG - Intronic
1047730332 8:127722779-127722801 CAGGGCGAGGGGGAGGTGGGAGG - Intergenic
1048797900 8:138168185-138168207 CTGGGGGCTAAGTAGGTGGGTGG - Intronic
1048824693 8:138412612-138412634 GTGGGTGCAAGGCAGGTGGGAGG - Intronic
1049545376 8:143228373-143228395 CTGCGGGAGAGGGAGGCGGGGGG + Intergenic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050558209 9:6807778-6807800 CTGGGAGGGAGGTGGGGGGGGGG + Intronic
1051070887 9:13165548-13165570 CTGGGGGAGGTGTAGATGGGAGG - Intronic
1051379041 9:16436419-16436441 CTGGTTGGGAGGGAGGTTGGAGG + Exonic
1052492726 9:29189014-29189036 CCGTCTGGGAGGTAGGTGGGGGG - Intergenic
1052503731 9:29325966-29325988 CTGGATGAGAGGAAGGTTGGAGG - Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053123418 9:35561929-35561951 AAGGGAGAGAGGTGGGTGGGAGG - Exonic
1053233283 9:36430057-36430079 CTGGGTGAGAGTAGGGTAGGAGG - Intronic
1053470965 9:38346020-38346042 CCGGGTAAGATGCAGGTGGGAGG - Intergenic
1053783389 9:41633113-41633135 CTTGCTGAGAGGTAGGGGAGTGG + Intergenic
1054171343 9:61843255-61843277 CTTGCTGAGAGGTAGGGGAGTGG + Intergenic
1054666191 9:67737557-67737579 CTTGCTGAGAGGTAGGGGAGTGG - Intergenic
1055138558 9:72851058-72851080 CCGGGAGGGAGGGAGGTGGGGGG - Intergenic
1055242248 9:74198004-74198026 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1056110231 9:83388027-83388049 CTGAGTGAGACGAAGGTGGCAGG - Intronic
1056477140 9:86963776-86963798 CTGGGGGAGAAGTAGGTTTGAGG - Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056564128 9:87758444-87758466 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056564280 9:87758826-87758848 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056775032 9:89505629-89505651 CTGGGTGGGAGGCAGGCGTGAGG - Intergenic
1057291458 9:93809896-93809918 CTGGGAGAGAGGGAGGGAGGGGG + Intergenic
1057691292 9:97288792-97288814 CTGGGTGACAGGTAGGGGCAAGG - Intergenic
1058476897 9:105344396-105344418 CTGGGTGAGAGCTTAGGGGGAGG + Intronic
1058655556 9:107217363-107217385 CTGGGAGAGATGAAGATGGGAGG + Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1059121070 9:111641385-111641407 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059470019 9:114497872-114497894 CTGGGAAGGAGGCAGGTGGGAGG + Intronic
1059699041 9:116757431-116757453 CAGGGTGTGAGATATGTGGGTGG + Intronic
1059898562 9:118895846-118895868 CTAGGTGAGAGGTAAGTTGGTGG + Intergenic
1060687310 9:125624191-125624213 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1060702672 9:125772003-125772025 TGGGGTGGGAGGTAGGTAGGTGG + Intronic
1060703716 9:125780417-125780439 CTGGGAGGGAGGTGGGGGGGGGG - Intronic
1060827494 9:126695311-126695333 CAGGGAGAGAGGTCGGTGTGGGG - Intronic
1060863506 9:126975874-126975896 CTGGCTGAGAGGTGGGAGAGAGG - Intronic
1060989267 9:127838887-127838909 GTGGGTGGGTGGTAGATGGGCGG - Intronic
1061264893 9:129499172-129499194 CTGAGTAAGAGGTAGGCAGGTGG - Intergenic
1061282412 9:129604977-129604999 CTAGGTGAGAGGCCGGGGGGAGG + Intergenic
1061403440 9:130381055-130381077 CAGGGTGAGAGGTGAGTGGTAGG - Intronic
1061923019 9:133792680-133792702 CTGGGTGGGGGGTGGGGGGGGGG - Intronic
1061932261 9:133839153-133839175 GTGGATGAGTGGTAGATGGGTGG + Intronic
1062025861 9:134340380-134340402 CTGGCTGAAAGGTCAGTGGGTGG - Intronic
1062114642 9:134801849-134801871 CTGGGGGGAAGGGAGGTGGGGGG + Intronic
1062127373 9:134870806-134870828 TGGGGTGGGAGGGAGGTGGGAGG + Intergenic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062145997 9:134989964-134989986 CTGGGGGAGAGGTGGGTGAAAGG + Intergenic
1062190334 9:135244768-135244790 CTGGCAAAGAGGCAGGTGGGAGG + Intergenic
1062425866 9:136505929-136505951 CTGGGTGTGAGGTGGCGGGGGGG - Intronic
1062520955 9:136957621-136957643 TTGGATGATGGGTAGGTGGGTGG + Intronic
1062692294 9:137848560-137848582 CTTGCTGAGAGGTAGTTGGGGGG - Intronic
1203463900 Un_GL000220v1:68262-68284 CTGGGGGGGAGGGAGGTGGGCGG - Intergenic
1203405794 Un_KI270539v1:836-858 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1185459886 X:328981-329003 CGGGGAGAGAGGGAGGGGGGCGG - Intergenic
1185459896 X:329001-329023 CGGGGAGAGAGGGAGGGGGGCGG - Intergenic
1185566199 X:1097288-1097310 CTGGGAGAAAGGTGGGTGTGAGG + Intergenic
1185566221 X:1097402-1097424 CTGGGGGAAAGGTAGGTGTGAGG + Intergenic
1185695643 X:2192464-2192486 GTTGGTGAGAGTTAGGTGTGGGG - Intergenic
1186840325 X:13478666-13478688 CTTGGGGAGAGGTTGGTGCGTGG - Intergenic
1186848149 X:13552224-13552246 CAGGGTGAGGGGTAGGGGTGGGG + Intergenic
1187416023 X:19094217-19094239 GAGGGTGAGAGGTAGGTGAGGGG + Intronic
1187483136 X:19676350-19676372 CTGGGTGGGGGCTGGGTGGGAGG + Intronic
1187738075 X:22324640-22324662 CAGGCTTAGAGGTAGGTGGAAGG - Intergenic
1187900823 X:24025511-24025533 CTGGGAGAGAGGGCGGAGGGTGG + Intronic
1187949781 X:24460475-24460497 CTGAGAGAGAGAGAGGTGGGGGG + Intergenic
1188024266 X:25192587-25192609 CTGGGTGTGAGGAATGTGGGTGG + Intergenic
1189178342 X:38980180-38980202 CTGGGTTTGATCTAGGTGGGAGG + Intergenic
1189195498 X:39148867-39148889 CTGGCTGAGAGATAGTGGGGTGG - Intergenic
1189207831 X:39257025-39257047 CTGGGGGAGGGGTGGGGGGGAGG - Intergenic
1189911671 X:45816414-45816436 CTGGGTAAGAATTATGTGGGAGG - Intergenic
1190256031 X:48762830-48762852 GTGAGTGAGAGATAAGTGGGAGG - Intronic
1190416351 X:50184032-50184054 CTGGGTGCCCAGTAGGTGGGAGG + Intergenic
1191033972 X:56005744-56005766 CTGGCAGAGAAGTTGGTGGGTGG + Intergenic
1191036252 X:56028947-56028969 CTTGGGGACAGGTAGGAGGGGGG + Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1191946434 X:66539647-66539669 CTGGGGAAGAGGTATGTGGCTGG + Intergenic
1192259299 X:69494763-69494785 TTGGGTGAAATGTGGGTGGGGGG - Intergenic
1192378215 X:70586818-70586840 CTGGGTGACAGGTAAGAGGTTGG + Intronic
1192476939 X:71452111-71452133 CTGGGAGGGAGGTGGGGGGGGGG - Intronic
1192503815 X:71669109-71669131 CTGGAAGAGAGGTGGGTGGGGGG - Intergenic
1192522575 X:71815161-71815183 CTGGAGGAGAGGTGGGTGGGGGG - Intergenic
1193114431 X:77763086-77763108 CTGGGTGACAGGTACTTAGGGGG + Intronic
1193207402 X:78765295-78765317 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1195124155 X:101788405-101788427 CTGGGGGAAGGGTAGTTGGGAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196402433 X:115330491-115330513 CGGGGGGAGGGGGAGGTGGGCGG + Intergenic
1198772375 X:140144711-140144733 CTGGGTGGGGGGTGGGCGGGGGG - Intergenic
1198791134 X:140347636-140347658 CTTGGTGGGAGCTTGGTGGGAGG - Intergenic
1198960145 X:142174783-142174805 CTGGGTGAGGGGTGGAGGGGAGG - Intergenic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1199766787 X:150947158-150947180 CTGAGTGGGAGGTAGGGGGCAGG + Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200542926 Y:4481627-4481649 CCGGGTCACAGGTAGGTGAGAGG + Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic
1201680725 Y:16641560-16641582 CTTGGGGACAGGTAGGAGGGGGG + Intergenic