ID: 960789041

View in Genome Browser
Species Human (GRCh38)
Location 3:121406402-121406424
Sequence CTTTCTCTGCATGATGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960789039_960789041 9 Left 960789039 3:121406370-121406392 CCCTTGAGACATTATCAGTCTAA 0: 1
1: 0
2: 0
3: 14
4: 152
Right 960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 292
960789040_960789041 8 Left 960789040 3:121406371-121406393 CCTTGAGACATTATCAGTCTAAG 0: 1
1: 0
2: 0
3: 16
4: 108
Right 960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960789041 Original CRISPR CTTTCTCTGCATGATGTAAA AGG Intronic
906062160 1:42956044-42956066 CTTTTTGTGCATGATGTTAGAGG - Intronic
906573615 1:46867310-46867332 CTCTTTCTCCAAGATGTAAATGG - Intergenic
906598248 1:47099595-47099617 CTCTTTCTCCAAGATGTAAATGG + Intronic
909510767 1:76449128-76449150 CTTTATCTGCATTGTGAAAATGG + Intronic
909986501 1:82167133-82167155 CTTACTCTGCCTGATATAAAAGG - Intergenic
910703966 1:90106628-90106650 CTTTCTATGCATCATTCAAAAGG + Intergenic
911390711 1:97237741-97237763 CTATCTCTGCATAATATAACTGG + Intronic
911465989 1:98252546-98252568 CTTTATCAGCATCATGAAAATGG + Intergenic
911530482 1:99037646-99037668 CTTTATCAGCAGCATGTAAATGG - Intergenic
911930928 1:103902616-103902638 CTTTCTCCACATGATGGGAAAGG + Intergenic
911931050 1:103903895-103903917 CTTTCTCCACATGATGGGAACGG - Intergenic
915026796 1:152838324-152838346 CTTTCTTTGGATGATGAGAAAGG + Intergenic
915492706 1:156260182-156260204 CTTTCTCTGCCTTCTGTAAAGGG - Intronic
916286459 1:163110439-163110461 CTTTGTCTGCATCATGAAAATGG - Intergenic
916590152 1:166182317-166182339 CTTTTTCTGCTTAAGGTAAATGG + Intergenic
917332340 1:173894489-173894511 CTTTCTCTCCATGAAGTCTAAGG + Exonic
917628065 1:176865719-176865741 CTTTCTCAGCAGCATGAAAACGG - Intronic
917798349 1:178548264-178548286 GTTCCTCTGCAGGATGTAAAAGG + Intronic
919040037 1:192374379-192374401 CTTTTTTTGTATAATGTAAAAGG - Intergenic
920414575 1:205790220-205790242 CTTTCTCTGCCAGATTCAAAGGG + Exonic
921424242 1:214984028-214984050 CTTTATCAGCAGGATGAAAACGG + Intergenic
921588338 1:216974756-216974778 CTTTCCCTGGATGAAGTATATGG + Intronic
921797181 1:219359900-219359922 CTTTCTATGCATTATATAACCGG - Intergenic
922680889 1:227594659-227594681 CTTTATGTGCAAGATGTATAAGG - Intronic
1062920120 10:1273223-1273245 CTTTCAATGCATGCTGTCAAGGG + Intronic
1063156540 10:3384368-3384390 TTTTCTCTGCTTTATTTAAAAGG - Intergenic
1063878077 10:10500652-10500674 CTTTCTCAGCAGCATGAAAATGG + Intergenic
1064007590 10:11710803-11710825 CTTTCACAGCATGATGTCTAAGG - Intergenic
1064666713 10:17660447-17660469 CTTTCTCTGTAGATTGTAAAGGG - Exonic
1065002270 10:21347841-21347863 CTTTCTCTTAATCAAGTAAATGG + Intergenic
1065527351 10:26636636-26636658 AATTCTCTTCATGCTGTAAAGGG - Intergenic
1065788085 10:29234867-29234889 GTTTCTATGCATGATGAAGAGGG - Intergenic
1066211785 10:33247375-33247397 CATTCTCTGCAAGTTGTAACAGG + Intronic
1069014482 10:63413114-63413136 CTTTGTCTGCCTGATTAAAATGG - Intronic
1070975126 10:80600332-80600354 GTTTCTCTGCAGGATGTAACCGG + Intronic
1071056420 10:81515291-81515313 CTATCTCTGCATTATCTAAATGG - Intergenic
1071695499 10:87864384-87864406 CTTCTTCTGCAGGATGGAAATGG - Exonic
1073023231 10:100464957-100464979 ATTTCTCTGCATGGCATAAAGGG - Intronic
1073887710 10:108059675-108059697 CTTCCTCTACAAGATGTAAATGG - Intergenic
1074058831 10:109946285-109946307 CTTTCTCTCCAGGATGGAAGTGG - Intronic
1075976209 10:126697718-126697740 CTTTATCTGCAGCATGAAAATGG + Intergenic
1076127270 10:127984879-127984901 CTTTATCAGCATCATGAAAATGG + Intronic
1077005290 11:352274-352296 GTTTCTCTACATGGTCTAAAAGG - Intergenic
1077123471 11:921821-921843 CTTTTTCTGCATTATGTCCAGGG + Intergenic
1078871886 11:15354647-15354669 CTTTCTCTGGGTGAAGTAACAGG + Intergenic
1079044802 11:17092020-17092042 CTTTCTCATCACGAAGTAAAGGG + Exonic
1080088403 11:28315023-28315045 CTTTATCTGCAGCATGAAAATGG + Intronic
1081028997 11:38054058-38054080 CTTTCTCTACCTGGGGTAAATGG + Intergenic
1084061776 11:66680027-66680049 ATTTGTATGCATTATGTAAATGG + Intergenic
1084776975 11:71383724-71383746 CTTTCTCTGCCTGATGCAGGGGG + Intergenic
1085249955 11:75136455-75136477 CTTTATCAGCATCATGAAAAAGG + Intronic
1085823939 11:79822821-79822843 ATTTCTCTTCATGATTGAAATGG - Intergenic
1087241120 11:95781562-95781584 TTGTCTTAGCATGATGTAAAAGG - Intronic
1087496134 11:98893185-98893207 CTTTATCAGCATCATGAAAATGG - Intergenic
1087533525 11:99414317-99414339 CTTTCTCTGCCCCATGGAAAGGG + Intronic
1087819570 11:102696691-102696713 CTTTCTCAGGATGATATCAATGG - Exonic
1088241475 11:107777587-107777609 CTTTCTTGGCATAACGTAAATGG - Intergenic
1088435093 11:109803869-109803891 CTTTATCAGCATCATGAAAACGG - Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1093207374 12:16267196-16267218 CTTTCTCTGGAATATTTAAATGG - Intronic
1093704995 12:22265214-22265236 TTTTCTTTTCATGATGGAAAGGG + Intronic
1093978560 12:25450680-25450702 CTTTATCAGCAGCATGTAAACGG + Intronic
1094694304 12:32802402-32802424 CTTTCTCTGCAGAATGAAATTGG - Exonic
1095591125 12:43905216-43905238 CTTTCTCTGCATAACTTAAGGGG - Intronic
1096025425 12:48356822-48356844 CTGTCTCTGCATGATCTTGAAGG + Intergenic
1097145584 12:56937291-56937313 CACTCTCTCCATGATGGAAATGG - Intergenic
1097750419 12:63346283-63346305 CTTCCTATGCATGAGGTATAAGG + Intergenic
1098479936 12:70945801-70945823 CCTTCTCAGCATGATGTGGAAGG - Intergenic
1098587151 12:72167368-72167390 TGTTCTTTCCATGATGTAAAGGG - Intronic
1098840778 12:75475722-75475744 CTTTATCAGCAGGATGAAAATGG - Intergenic
1099268264 12:80476503-80476525 CTTTGTCTTCATGAAGTAACCGG - Intronic
1099891803 12:88598046-88598068 CTTTATCAGCATCATGAAAACGG + Intergenic
1100244756 12:92746237-92746259 TTTTCTCTGGATGATCCAAAAGG - Intronic
1101590858 12:106124084-106124106 CTTTTTCTGCTTGAAGCAAAGGG + Intronic
1107587035 13:41861688-41861710 CTTTCTGTGGCTGTTGTAAATGG - Intronic
1107838607 13:44433372-44433394 ATTTGACTGCATGAAGTAAAAGG - Intronic
1109527487 13:63596096-63596118 ATTTTTCTGAATGATGAAAATGG + Intergenic
1109704374 13:66070896-66070918 TTTTCTCTTCATTATGTGAAAGG - Intergenic
1110122561 13:71901410-71901432 CTAACTCTTTATGATGTAAATGG + Intergenic
1110333868 13:74303477-74303499 CTTCCTCTCCATCATATAAATGG + Intergenic
1110645220 13:77875307-77875329 TTTTCTATGAATGATGTAATTGG - Intergenic
1111450035 13:88403171-88403193 CTTTCATAGAATGATGTAAATGG + Intergenic
1112574411 13:100622712-100622734 CTTTATCAGCATTATGAAAATGG + Intronic
1113064339 13:106358508-106358530 CTTTATCTGCAGCATGAAAATGG + Intergenic
1114796074 14:25716635-25716657 CTTTCTTTGCATGATTTCACTGG - Intergenic
1116276068 14:42833562-42833584 CTTTATCAGCATCATGAAAACGG - Intergenic
1116925678 14:50634303-50634325 CTTTCTCAACATGCTTTAAAAGG + Exonic
1118138560 14:63054547-63054569 CTTTATCTTAATGATGAAAATGG - Intronic
1118443249 14:65830518-65830540 CTTTATCAGCATCATGAAAATGG + Intergenic
1119463864 14:74836890-74836912 TTTTCTTTGCAGGATGAAAAAGG - Intronic
1119880816 14:78098097-78098119 CTTTATCAGCATCATGAAAATGG - Intergenic
1120206121 14:81589393-81589415 CTTTATCAGCAGCATGTAAACGG + Intergenic
1120684037 14:87517275-87517297 CTTTATCAGCATCATGAAAATGG - Intergenic
1122040088 14:98981235-98981257 ATTTCTCAGCATGCTGTTAATGG - Intergenic
1126460091 15:48905605-48905627 CTGACTCTGCATGATGAAGAAGG + Intronic
1126462927 15:48932435-48932457 CTTTCTTAGAATGATGTACAGGG + Intronic
1127592536 15:60440093-60440115 CTTTCTGTGCATGAACTCAATGG + Intronic
1127615070 15:60676520-60676542 CTTTCTGTCCATTATATAAAAGG + Intronic
1127646133 15:60961282-60961304 AATGCCCTGCATGATGTAAAAGG + Intronic
1129570503 15:76678581-76678603 GTTTCTCTGGATGATGAAGAGGG + Intronic
1129638407 15:77348131-77348153 CTTGCTCTACATGAGGTATATGG + Intronic
1130200095 15:81817647-81817669 CTTTTTCTGCATCATGTATTTGG + Intergenic
1132093993 15:98968650-98968672 CTGTCTCTGCATCATGGAAAGGG - Exonic
1132806329 16:1776773-1776795 CTTGCTCTGCATGCTGTCAGCGG - Exonic
1134229498 16:12417897-12417919 CTTTCTCTGCCTGCAGTAATTGG + Intronic
1136519281 16:30785985-30786007 GATTCTCTGCAGGGTGTAAATGG - Intronic
1138123477 16:54419849-54419871 CTTTTTGGGGATGATGTAAAAGG + Intergenic
1138312417 16:56039167-56039189 CTATCTCTGACTGATGTAACAGG - Intergenic
1139074492 16:63427530-63427552 TTTTCACTGCATCATGTCAAAGG - Intergenic
1142627320 17:1200610-1200632 CTTGTTCTGCTTGATGTAACGGG - Intronic
1144421933 17:15106819-15106841 CTTCCTCAACATGCTGTAAAGGG - Intergenic
1144500247 17:15779978-15780000 CTTTATCAGCATCATGAAAAAGG - Intergenic
1146984691 17:37204121-37204143 CTTTCTCTGCAAGAAGTCCATGG + Intronic
1147562031 17:41515189-41515211 CATTCTCTGCATGAGATAGATGG - Intronic
1150984207 17:70176977-70176999 CTTTTCCTCCATGATGTTAATGG + Exonic
1151154515 17:72115548-72115570 CTTTCTCTCACTGATGTAAAAGG - Intergenic
1151427707 17:74041766-74041788 CTGTCCCTGCATGGGGTAAAAGG + Intergenic
1153786565 18:8540117-8540139 CTTTTTCTGCATAATTTAATAGG + Intergenic
1153875279 18:9364876-9364898 ATTTTTCTGTATAATGTAAATGG + Intronic
1156705735 18:39879293-39879315 CAGTCTCTGCATCCTGTAAAAGG + Intergenic
1157689526 18:49669612-49669634 ATTTCTCTTCATGATGCTAATGG + Intergenic
1158452464 18:57579401-57579423 CTCACTCTGCCTGATGTTAAAGG + Intronic
1158555539 18:58471706-58471728 CTTTTTCTGAAAGATGGAAAAGG + Intergenic
1159154293 18:64562791-64562813 TTTTCTCAGCATGATGTTTATGG + Intergenic
1159283024 18:66311324-66311346 CTTTATCAGCATCATGAAAATGG - Intergenic
1159329072 18:66965361-66965383 CTTTAGCTGCATGATGGTAAAGG + Intergenic
1159366635 18:67474694-67474716 CATTCCCTTCAAGATGTAAAAGG - Intergenic
1159561250 18:69997397-69997419 ATTTTTCTGCCTGTTGTAAAAGG - Intergenic
1163192090 19:15684804-15684826 CTTTCTCTTCAGGATGAAGATGG + Exonic
1165360314 19:35332562-35332584 CTTTCTCTGACTCAAGTAAATGG + Exonic
1167692918 19:50997958-50997980 CTTTCTTTCCAGGATGTAATGGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926502569 2:13674091-13674113 CTTTATCAGCAGGATGAAAATGG - Intergenic
927741166 2:25570813-25570835 CATTCTCTTCATGGTGTAAGTGG + Intronic
928246978 2:29638854-29638876 CATTCTCTGCATTTTGTATATGG - Intronic
929238789 2:39632245-39632267 CTTTCTCTGCAAATTGGAAATGG + Intergenic
929687600 2:44047889-44047911 CTTTCTCAGCAGCATGAAAACGG - Intergenic
930546339 2:52772064-52772086 CTCTTTGTGCATGCTGTAAATGG - Intergenic
933983462 2:87572348-87572370 CTTTCCCTGCATGATTTGATGGG - Intergenic
935528326 2:104200506-104200528 CAAGCTCTGCATTATGTAAAGGG + Intergenic
936310387 2:111378446-111378468 CTTTCCCTGCATGATTTGATGGG + Intergenic
936959070 2:118054511-118054533 ATTTCTCTGAATGAAGAAAATGG + Intergenic
937793295 2:125985966-125985988 CTTTCTGTGCTTTGTGTAAAAGG - Intergenic
938849895 2:135249856-135249878 CTTTATCTGCAGCATGAAAATGG + Intronic
939306775 2:140421902-140421924 CTTCGTCTGCAGGATGGAAAGGG - Intronic
940006103 2:149010680-149010702 ATTTCTCTGCAAGGTGTGAAGGG + Intronic
940349491 2:152665970-152665992 CTTGCTTTCCATAATGTAAAAGG - Intronic
941509607 2:166389435-166389457 CTTTATCAGCAGGATGAAAATGG - Intergenic
943215436 2:185027753-185027775 CTTTATCAGCAGGATGAAAACGG - Intergenic
944384959 2:199153813-199153835 CTTTCTCTGCTTGACTTTAAAGG - Intergenic
945240447 2:207671756-207671778 CCTTCTCAACATGCTGTAAAAGG - Intergenic
945325108 2:208472685-208472707 CTTTATCAGCAGCATGTAAATGG + Intronic
945484654 2:210381244-210381266 CTTTATCTGCAGCATGGAAATGG + Intergenic
948477205 2:238227737-238227759 CTTTCTCAGCATGGTGAACATGG + Exonic
949073841 2:242042483-242042505 CTTTCTCAGCGTCATGAAAATGG + Intergenic
1170574474 20:17652231-17652253 CTGTCTCTGCACTGTGTAAAGGG + Intronic
1171207886 20:23295135-23295157 CATTCTCCCCATGATGTCAAAGG + Intergenic
1172572343 20:35980478-35980500 CTTCTTCTGCATGATCTGAATGG - Exonic
1173905542 20:46626025-46626047 CATTCTGTACATGATATAAATGG + Intronic
1174124433 20:48292597-48292619 CTTTCTCTGCAACATGGAGAGGG + Intergenic
1174468461 20:50736302-50736324 CTTTCTCTACATGATGCTTAAGG + Intronic
1175242235 20:57558204-57558226 CTTTCTCTGCATGCCAGAAATGG - Intergenic
1175955233 20:62605661-62605683 CTTTCTCTGGCTGATGGAGAGGG + Intergenic
1177018198 21:15817516-15817538 CTTTATCAGCAGCATGTAAATGG - Intronic
1177261192 21:18732395-18732417 CTTTATCAGCAAGATGAAAACGG + Intergenic
1177455988 21:21340310-21340332 CATTCTCTGCATAATATATAAGG - Intronic
1177473765 21:21592980-21593002 CTTTCTCAGCAGCATGAAAATGG - Intergenic
1177884542 21:26732624-26732646 CTTTGTGAGCATGATGTTAACGG + Intergenic
1178707551 21:34888391-34888413 CTTTCTCCCCCTGTTGTAAAAGG + Intronic
1178780917 21:35602984-35603006 CTGTCTCTGCATCATGCAGATGG + Intronic
1179242593 21:39605266-39605288 CTTTCTCAGCATTTTGTACAGGG + Intronic
1182024769 22:27109462-27109484 CTTTATCTGCAGCATGAAAATGG - Intergenic
1182815339 22:33157095-33157117 CTTTATCAGCAGGATGAAAATGG + Intergenic
1184296810 22:43530215-43530237 CTTTCTTTGCATGAGGGATAGGG + Intronic
1184962642 22:47942726-47942748 CTTTCTCAGCAACATGAAAATGG - Intergenic
1184994588 22:48196148-48196170 CTTTATCAGCAGGATGAAAATGG + Intergenic
1185059508 22:48598949-48598971 CATTCCCTGCTTGTTGTAAAGGG + Intronic
951773349 3:26282830-26282852 CTTTATCAGCAGGATGAAAATGG - Intergenic
952508330 3:34028400-34028422 CTTACTCTGAATGAGATAAAAGG - Intergenic
952714911 3:36471041-36471063 CTTTATCAGCATCATGAAAATGG - Intronic
952898519 3:38094992-38095014 CTTTCTGGGCATGATGGAGAAGG - Exonic
955853540 3:63247871-63247893 CATTCTCTTCATGATGGAAATGG - Intronic
956004328 3:64762415-64762437 CTTTCAATGCATGATGTAGCAGG + Intergenic
956267833 3:67417709-67417731 CTTTCTCTGCTGGAGGAAAAGGG - Intronic
957355900 3:79085664-79085686 CATTCTCTGAATGAAGGAAAAGG - Intronic
957981889 3:87520678-87520700 CTTTATCAGCATCATGAAAATGG + Intergenic
958147174 3:89640441-89640463 ATTTCTCTGCTTGAGGAAAAAGG + Intergenic
959197389 3:103201964-103201986 CTTTCTCTGCATTATTCCAAGGG + Intergenic
959915522 3:111812729-111812751 CTTTCTCTGCAGAAAGTCAAAGG - Intronic
960171756 3:114470471-114470493 GTTTCTCTTCAAGATGAAAAAGG - Intronic
960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG + Intronic
962007023 3:131359938-131359960 CTTTTTCTGGATGAAGAAAATGG - Intergenic
965275004 3:166671031-166671053 CTTTCTCTGCATCTCGTCAAAGG + Intergenic
969878124 4:10150964-10150986 GTTACTCTGCATGAAGAAAAAGG + Intergenic
970516867 4:16840848-16840870 CTTTCTCTGCCTGCAGTAACAGG + Intronic
970935068 4:21559689-21559711 CTTTCTCTGCATAGTCTAGAAGG - Intronic
974563580 4:63553982-63554004 CTTTCTCAGCAGTATGAAAATGG - Intergenic
975481923 4:74890427-74890449 CTTTTTCTGGATGAGGTAAACGG + Intergenic
976993341 4:91397961-91397983 ATTTCTCTGCAAAATGTACAAGG - Intronic
977832422 4:101609250-101609272 CTTTATCAGCAGGATGAAAATGG + Intronic
979369062 4:119862062-119862084 CTTTCTCAGCAGCATGAAAATGG - Intergenic
980145581 4:128979422-128979444 CTTTGTCTTCACGAAGTAAAAGG - Intronic
980533425 4:134084602-134084624 CTTTTTCTGTAAGATGTAACTGG - Intergenic
980649980 4:135700059-135700081 ATTTATCTGCATTATTTAAATGG + Intergenic
981633069 4:146843807-146843829 CTTTCTCTGTAAGAAGCAAAGGG + Intronic
983303864 4:165961211-165961233 CTTTCTGTGGCTAATGTAAATGG - Intronic
984579556 4:181495451-181495473 ATTTCTCTCCATTATGAAAAAGG + Intergenic
985948998 5:3208959-3208981 CTTTATCAGCATCATGAAAAAGG - Intergenic
986296184 5:6440728-6440750 CTTTATCAGCAGCATGTAAATGG - Intergenic
986470225 5:8066500-8066522 TCTTCTCTGCATGATATGAAAGG - Intergenic
986531679 5:8743121-8743143 CTTTATCAGCAGCATGTAAATGG + Intergenic
987053445 5:14167647-14167669 CTTTCTCTTCATGATGTCTGGGG - Intronic
987476894 5:18401591-18401613 ATGTCTCTGCATGGTGTAAGAGG + Intergenic
987604143 5:20111150-20111172 TTTTCTCTGCTCTATGTAAAGGG + Intronic
989088803 5:37706910-37706932 CTTTTTATGTATTATGTAAAGGG + Intronic
990103775 5:52229387-52229409 CTTTATCAGCATCATGAAAACGG + Intergenic
990744237 5:58942514-58942536 CTTTCTGTGCCTGATTTATAAGG - Intergenic
991012800 5:61901388-61901410 CCTTCTCTGCATCAGGGAAATGG + Intergenic
991041871 5:62184605-62184627 CTATCTCTCCCTAATGTAAATGG - Intergenic
991135691 5:63179726-63179748 CTTTTTTTGCATGAAGAAAATGG - Intergenic
991171720 5:63634253-63634275 CTTTATCAGCAGCATGTAAATGG + Intergenic
991296084 5:65083034-65083056 CATTCTCTGTGTGATGGAAAAGG + Intergenic
992091114 5:73317749-73317771 TGTTCACTGCATGATGTAAAAGG + Intergenic
994552687 5:101257869-101257891 CTTTATCAGCAGCATGTAAATGG + Intergenic
996250303 5:121320438-121320460 CTTTATCAGCATCATGAAAATGG + Intergenic
996693375 5:126366109-126366131 CTTTCTCTGCATCCTCTCAAAGG + Intronic
997944538 5:138188066-138188088 CTTTATCTAGATGAGGTAAAGGG - Exonic
998552302 5:143089394-143089416 CTTTCTATTCATGCTGTAAAGGG + Intronic
998757777 5:145399678-145399700 CTTTCTCGGCAGCATGAAAACGG - Intergenic
998775190 5:145591861-145591883 CTTCCTCAGCTTGATGTTAATGG + Intronic
1000699157 5:164426793-164426815 CCTTCTCTGTATGACTTAAAGGG - Intergenic
1000851349 5:166343682-166343704 CTTTCTCCGAATGATTCAAAAGG + Intergenic
1003583451 6:7363694-7363716 CTTCCTCTGCACCATGTCAAGGG + Intronic
1004288469 6:14344973-14344995 CTCTTTCTGAATTATGTAAATGG + Intergenic
1004294328 6:14396497-14396519 CTTCCTCTGCAGGCTGTAATAGG + Intergenic
1004671191 6:17798936-17798958 TTATGTGTGCATGATGTAAAAGG + Intronic
1006099225 6:31675714-31675736 CTGTCTGTGCTTGATGGAAATGG + Intergenic
1009634815 6:66252245-66252267 CTTTATCAGCAGCATGTAAATGG - Intergenic
1010007946 6:71016079-71016101 CTTTCTCTGAATGTTTTAACTGG - Intergenic
1010205402 6:73318370-73318392 CTTTATCTGCAGCATGAAAATGG - Intergenic
1010531673 6:76976042-76976064 CTTGCTCTGCATGGTTCAAAGGG - Intergenic
1010920484 6:81674041-81674063 CTTTATCAGCAGGATGAAAATGG - Intronic
1012380464 6:98614610-98614632 CTTTATCTGCAGCATGAAAATGG - Intergenic
1013861518 6:114641699-114641721 CTTTAACTGCATCATGAAAATGG - Intergenic
1014493276 6:122089076-122089098 CTTGCTCTGCATGTTGAAATGGG + Intergenic
1014691310 6:124566588-124566610 TTTTCTCTGCAGGATATTAATGG + Intronic
1014773908 6:125486995-125487017 CTTTATCAGCATCATGAAAATGG + Intergenic
1015548851 6:134391348-134391370 CTTTCTCTGCACTAGGTAATAGG - Intergenic
1016520849 6:144944901-144944923 CTTTATCTGCAGCATGAAAACGG + Intergenic
1017397448 6:154018734-154018756 CTTTCTCTGCATGGTTTATACGG + Intronic
1017664107 6:156702783-156702805 CTTCCTCTGAATGATCTGAATGG + Intergenic
1017772206 6:157652072-157652094 CCTCCTCTGCAGGATGTCAAAGG - Intronic
1019890121 7:3939841-3939863 CTTTCTCTGCATTGTTAAAATGG - Intronic
1022414296 7:30164935-30164957 CCTTCTCAGCATGAGCTAAATGG - Intergenic
1023104031 7:36746437-36746459 CTTCCTGTGCATGATGTGCAGGG - Intergenic
1024441884 7:49429275-49429297 CTGCCTCTGCATGAGGTAAGAGG - Intergenic
1026271273 7:68839190-68839212 ATTCCTCTGCATGATGTAGATGG - Intergenic
1027956818 7:84888628-84888650 ATTTCTCTGCATCCTTTAAAAGG + Intergenic
1032690859 7:134285151-134285173 CCTTATCTGCATGATGTAGCAGG - Intergenic
1033793199 7:144817164-144817186 CTTCCAGTGCATGATGTCAAGGG - Intronic
1035135150 7:156696448-156696470 CTTTATCAGCATCATGAAAATGG - Intronic
1035348070 7:158220612-158220634 CTTTTTGTACATGTTGTAAATGG - Intronic
1037186658 8:16072511-16072533 ATTTCTGTGCTTTATGTAAATGG - Intergenic
1037218030 8:16482039-16482061 CTTTCTCTGCATTCTATCAAAGG + Intronic
1038773028 8:30501657-30501679 CTTTCTCTTCCAAATGTAAATGG - Intronic
1039797450 8:40927317-40927339 CTTTATCAGCAGCATGTAAATGG - Intergenic
1040481219 8:47829664-47829686 CTTTCTGTGGCTGTTGTAAACGG - Intronic
1041188859 8:55332304-55332326 ATTTTTCTGCAGGATTTAAAAGG - Intronic
1041338981 8:56822024-56822046 CTTTCTCAGCAGCATGAAAATGG + Intergenic
1041886787 8:62818438-62818460 CTTTCCATGCATCATGTACAGGG - Intronic
1046251738 8:111641975-111641997 CTTTATCAGCATCATGAAAACGG - Intergenic
1047330319 8:123880930-123880952 CTTGCACTGCATCAAGTAAAAGG - Intronic
1048058274 8:130890545-130890567 TTTTCTCAGCATGAGATAAAAGG + Intronic
1048486768 8:134855690-134855712 CTTTATCAGCATCATGAAAAAGG - Intergenic
1048698640 8:137058293-137058315 CTTTCTTAGTATGATGTTAATGG - Intergenic
1048874714 8:138827792-138827814 CTTCCTCTGTATCATGTACAGGG + Intronic
1051891048 9:21943375-21943397 ATATCTCTGCCTGATGAAAATGG + Intronic
1052071115 9:24082124-24082146 CTTTATCTGCAGCATGAAAATGG + Intergenic
1052078917 9:24179506-24179528 CTTTCTCAGCAACATGAAAATGG - Intergenic
1052267282 9:26589595-26589617 CTTTCTCAGCAGCATGAAAATGG - Intergenic
1052421008 9:28243035-28243057 CTGTTTCTTCATGATGTCAATGG - Intronic
1052544624 9:29859766-29859788 TTTTCTCTCCTTTATGTAAAGGG - Intergenic
1057518635 9:95742388-95742410 CTTTGTGTGCCAGATGTAAAAGG + Intergenic
1058482339 9:105408722-105408744 TTTTTTCTACATGATTTAAAAGG + Intronic
1058487816 9:105459676-105459698 CTTTCTCTTTATGATCTGAATGG + Intronic
1059100004 9:111461717-111461739 CTTTATCAGCATCATGAAAACGG - Intronic
1060118480 9:120965775-120965797 CTTTGTCAGCAGGATGGAAAAGG + Intronic
1061780753 9:132994844-132994866 CTTTCTCTGCTGTATGCAAATGG - Intergenic
1203489815 Un_GL000224v1:93978-94000 TTTTATTTTCATGATGTAAAAGG + Intergenic
1203502438 Un_KI270741v1:35864-35886 TTTTATTTTCATGATGTAAAAGG + Intergenic
1187801181 X:23064812-23064834 TTTTCTCTGCATGGTGCATATGG - Intergenic
1189003428 X:36969725-36969747 CTTGCTCTGCTTTAGGTAAATGG + Intergenic
1189312313 X:40028350-40028372 CTTTCACTGAAAGATGTATAGGG + Intergenic
1190940447 X:55035291-55035313 CTTTCTCTGCCTGCTGAATAGGG - Intergenic
1191171474 X:57451832-57451854 CTTTCTTTGCATAATGTCACTGG + Intronic
1192677386 X:73212388-73212410 CTTTCAATGAATGATGTAATAGG + Exonic
1193241377 X:79174178-79174200 CTTTTTTGGAATGATGTAAATGG - Intergenic
1193676398 X:84458354-84458376 CTTTTTCTGTACAATGTAAATGG + Intronic
1194000296 X:88420352-88420374 CTTTATCTGCAGCATGAAAATGG + Intergenic
1194169301 X:90562499-90562521 CTTTCTCTGTATGATATATACGG - Intergenic
1194562376 X:95438468-95438490 CTTTCTCTGAATGATCTAAGGGG - Intergenic
1195817364 X:108903321-108903343 CCTTCTCTGCTAGATGTAGAAGG - Intergenic
1196260765 X:113577989-113578011 CTTTCTGTGCATGCTTTACATGG - Intergenic
1196979147 X:121192177-121192199 CTTTATCAGCAGCATGTAAAGGG + Intergenic
1197023305 X:121717057-121717079 CTTTCTCAGCAGCATGAAAATGG - Intergenic
1197166746 X:123385739-123385761 CTTTCTCTGCCTATTGTCAATGG + Intronic
1197630082 X:128848384-128848406 CTTTCTCAGCAGGATCTATAGGG - Intergenic
1198620463 X:138502930-138502952 CTTTCTTTGCATGATTTGTATGG + Intergenic
1199370032 X:147036442-147036464 CTCTATCTCCATGACGTAAATGG + Intergenic
1199491132 X:148402064-148402086 CTTTATCAGCAGTATGTAAATGG - Intergenic