ID: 960789113

View in Genome Browser
Species Human (GRCh38)
Location 3:121407312-121407334
Sequence AACCGCCATATGAAGTTTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960789110_960789113 7 Left 960789110 3:121407282-121407304 CCTGTATGGACCGAATGGGTGGA 0: 1
1: 0
2: 0
3: 0
4: 40
Right 960789113 3:121407312-121407334 AACCGCCATATGAAGTTTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 67
960789111_960789113 -3 Left 960789111 3:121407292-121407314 CCGAATGGGTGGATTAATGCAAC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 960789113 3:121407312-121407334 AACCGCCATATGAAGTTTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960789113 Original CRISPR AACCGCCATATGAAGTTTGG AGG Exonic
904023219 1:27484326-27484348 ACCAGCCATATGAATTTGGGTGG - Intronic
909068660 1:70965578-70965600 AACTGTCATATTAAGTATGGAGG - Intronic
912486632 1:110034531-110034553 GGCCGCCATATTAAGTGTGGCGG - Intronic
915100088 1:153492934-153492956 AACCCCCATGAGAAGTTTGGGGG + Intergenic
917072655 1:171169219-171169241 ATCCACCACATGAAGTTGGGTGG - Intergenic
918798064 1:188931118-188931140 TACAGCCATTTCAAGTTTGGTGG + Intergenic
920906031 1:210169173-210169195 TACAGTCATAAGAAGTTTGGGGG + Intronic
923727603 1:236520919-236520941 AACAGCCATATGAAGATGGTGGG - Intronic
1067062455 10:43084830-43084852 AACCGCCCTGTGAAGGATGGAGG + Intronic
1073231853 10:101978274-101978296 ATTCACCATATGAATTTTGGGGG - Intronic
1077472416 11:2770239-2770261 GACCGCCCTGTGAAGTCTGGAGG - Intronic
1079072148 11:17356545-17356567 GGCCTCCATATGAATTTTGGAGG + Intronic
1084369896 11:68734258-68734280 AATCGCCAAATGCAGTTAGGAGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1092777020 12:11952638-11952660 ACCTGCCATATGAACTATGGAGG - Intergenic
1101017707 12:100519274-100519296 AACCGCCAGAAGAATTTTGGCGG - Intronic
1105432223 13:20347111-20347133 TACCAACATATGAATTTTGGAGG - Intergenic
1105948990 13:25212871-25212893 AATTGCAACATGAAGTTTGGGGG - Intergenic
1108840206 13:54603904-54603926 AATCACAATATGAAATTTGGAGG - Intergenic
1109431713 13:62245178-62245200 AGTCGCCATAGGAACTTTGGAGG + Intergenic
1110858581 13:80323593-80323615 AACCTCAACATGAATTTTGGTGG - Intergenic
1122402029 14:101473078-101473100 GTCCACCATATGAATTTTGGGGG + Intergenic
1129387687 15:75204874-75204896 AATCGCCATCTGCAGCTTGGGGG + Intronic
1133859553 16:9581416-9581438 AACTGCCATGTGAAGTTGCGGGG - Intergenic
1134442755 16:14308959-14308981 AACAGTCATCTGAAGTTTGGGGG + Intergenic
1137959693 16:52869790-52869812 AACAGCAAAATTAAGTTTGGTGG + Intergenic
1140047328 16:71450245-71450267 AACTGGCATAGGAAGTTTAGTGG + Intronic
1144930393 17:18854340-18854362 AGCAGCCATATGATGGTTGGGGG - Intronic
1149177148 17:53886299-53886321 CACCTCCATATGAGATTTGGTGG + Intergenic
1153748191 18:8201819-8201841 ATTCGACATATGAATTTTGGAGG + Intronic
1155917175 18:31568374-31568396 AATTCCCACATGAAGTTTGGAGG - Intergenic
1159442677 18:68501641-68501663 CATCAACATATGAAGTTTGGGGG - Intergenic
1163146523 19:15383061-15383083 AGCCACCAAATGAATTTTGGGGG - Intronic
931002808 2:57807843-57807865 AATCTCAATATGAATTTTGGAGG - Intergenic
931232732 2:60388289-60388311 ACCCTCCAAATGAGGTTTGGTGG + Intergenic
947794701 2:232886962-232886984 AACTGCCAGAGGAATTTTGGTGG + Intronic
1173120604 20:40285973-40285995 GACCGCCTTTTGAGGTTTGGTGG + Intergenic
1177289395 21:19091358-19091380 GAGGGCCATATTAAGTTTGGGGG - Intergenic
1179355645 21:40656162-40656184 TTCCACCATATGAATTTTGGGGG + Intronic
1180567331 22:16683553-16683575 TACCTCCATAAGAAGTTTGTTGG - Intergenic
1182024095 22:27103923-27103945 AACCACCAAATGAATTATGGAGG - Intergenic
956287027 3:67621494-67621516 AAGTGCCATATGACTTTTGGAGG - Intronic
959287739 3:104438599-104438621 AACAGCTATAGGAAGTGTGGAGG + Intergenic
960789113 3:121407312-121407334 AACCGCCATATGAAGTTTGGAGG + Exonic
964050333 3:152384495-152384517 AACCCACATCTGAAGTTTGATGG - Intronic
966687995 3:182716588-182716610 AAGCACCATTTGAAGCTTGGTGG + Intergenic
973308582 4:48681231-48681253 AAACGTCATATGAATTTAGGCGG + Intronic
982890358 4:160841307-160841329 AACTACCATATGCAGTTTGCTGG + Intergenic
984730456 4:183063631-183063653 AACCTTCATATGAAATTTTGTGG + Intergenic
988833298 5:35007758-35007780 AACTTCCATTTGAGGTTTGGAGG - Intronic
992517579 5:77510615-77510637 AACCACCCTATGAAGTTAGCAGG + Intronic
992743839 5:79799641-79799663 AACAGCGATTTGAATTTTGGGGG + Exonic
995556604 5:113336239-113336261 AATTTCCATATGAATTTTGGAGG + Intronic
996640403 5:125744605-125744627 AACTGACATATGAACTTTGGAGG - Intergenic
1004920870 6:20374342-20374364 AATTGCCACATGAACTTTGGAGG - Intergenic
1010435360 6:75823661-75823683 AACCCCCATATGTAGAATGGTGG + Intronic
1012128593 6:95462201-95462223 AACCCCCATATAAGATTTGGTGG + Intergenic
1013874934 6:114813493-114813515 AGCTGCTACATGAAGTTTGGTGG - Intergenic
1013942492 6:115681498-115681520 AAGGGCTATATGAAGGTTGGAGG - Intergenic
1014899094 6:126941511-126941533 AACAGCCAGATGAAGTTGAGAGG + Intergenic
1016190173 6:141255422-141255444 AGCCCCCATATGTTGTTTGGAGG + Intergenic
1016481919 6:144491370-144491392 AATCACCATGTGAAGTTAGGAGG + Intronic
1020345468 7:7157753-7157775 AACTGAAATTTGAAGTTTGGTGG - Intronic
1038286905 8:26213330-26213352 AACCACCCTATCTAGTTTGGTGG - Intergenic
1038286913 8:26213379-26213401 AACCACCCTATCTAGTTTGGTGG - Intergenic
1050816482 9:9819346-9819368 AAGCCCCAAATGAACTTTGGCGG + Intronic
1055483604 9:76734685-76734707 GTCAGCCATATGAAGTTAGGAGG - Intronic
1061718252 9:132534741-132534763 AACCTCCTTGTGCAGTTTGGAGG - Intronic
1189649667 X:43175975-43175997 AATTGCCATATGAGTTTTGGAGG + Intergenic
1191042407 X:56097942-56097964 AATCTCAATATGAAATTTGGAGG - Intergenic
1193393187 X:80953975-80953997 AATCTCCACATGAGGTTTGGAGG - Intergenic
1193934121 X:87594655-87594677 AACAGCAATATGTAGTTTGTGGG - Intronic