ID: 960789586

View in Genome Browser
Species Human (GRCh38)
Location 3:121413686-121413708
Sequence TTGAAGAAACCTTGTGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960789585_960789586 0 Left 960789585 3:121413663-121413685 CCATTCAAGGAGTTCAAGAACTC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 960789586 3:121413686-121413708 TTGAAGAAACCTTGTGATTAAGG 0: 1
1: 0
2: 0
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960789586 Original CRISPR TTGAAGAAACCTTGTGATTA AGG Intronic
903860896 1:26363908-26363930 TTGAAGGCACATTGTGGTTATGG - Intronic
905251159 1:36649393-36649415 TTCAAGAAACTTTGTGTTTGAGG - Intergenic
908382845 1:63612811-63612833 TTGTAGACACCTTGTGCTTTGGG + Intronic
908524941 1:64978691-64978713 TAGAATAAGCCTTGTTATTACGG - Intergenic
911523336 1:98954829-98954851 ATGAAGAAGACTTGTGATTTAGG - Intronic
911825261 1:102476120-102476142 TTAAAGAAAAACTGTGATTAAGG + Intergenic
914967333 1:152271723-152271745 TTGAAGAAGCCTTGTGACCCAGG - Intergenic
914969035 1:152290390-152290412 TTGAAGAAGCCTTGTGACCCAGG + Intergenic
917282366 1:173390641-173390663 TTGAAGAAATATAGTGATTTAGG - Intergenic
918708439 1:187697110-187697132 TTGAAGAAAAATCGTGTTTACGG - Intergenic
921938339 1:220815228-220815250 TTTAGGAAACCATGTGAATATGG + Exonic
922174691 1:223188262-223188284 TTGAGGACCCCTTGTGATGATGG + Intergenic
922244238 1:223778981-223779003 GTGAAGGGATCTTGTGATTACGG + Intergenic
923463223 1:234225313-234225335 TAGAAGAAAGCTTTTGTTTATGG - Intronic
1065013096 10:21437202-21437224 TAGTAGAAACCTTATGCTTAGGG + Intergenic
1066204461 10:33174065-33174087 TTCAAGCTACCTTGTGATTTGGG - Intergenic
1069164670 10:65138736-65138758 TTGAAGAAAACTAGTGACTGTGG + Intergenic
1069315966 10:67102673-67102695 ATCAAGAGACCTTGTGATAAAGG + Intronic
1069410411 10:68147583-68147605 TTGAAGAGAACTTGGGATTTGGG - Intronic
1069816861 10:71202220-71202242 TTCCAGTAACCTTCTGATTAAGG + Intergenic
1074507330 10:114083067-114083089 TTGAAGAACGCTTGTGTTTTGGG - Intergenic
1074512292 10:114126243-114126265 TTTAAGAAACCATCTGAATAAGG - Intronic
1074732057 10:116389617-116389639 TATAAGGACCCTTGTGATTACGG + Intergenic
1075187068 10:120272246-120272268 TTGTAAAAATCATGTGATTAAGG - Intergenic
1076454678 10:130581824-130581846 ATGAAGAAAGCTTTTGAGTATGG - Intergenic
1078484628 11:11710245-11710267 TTGGAGAAACCTAGAGATCATGG - Intergenic
1079562488 11:21839772-21839794 TTAAAGAAACATTGTGCTTCAGG - Intergenic
1079921760 11:26441582-26441604 TTGAATAAACCTTATGATTTAGG - Intronic
1080334088 11:31175537-31175559 TTGAAGCAACCTTGTTTTTGTGG + Intronic
1084702350 11:70795704-70795726 TTTAAGAACCTGTGTGATTATGG - Intronic
1087122764 11:94592023-94592045 TTGAAGAAAACATGGGAGTACGG - Intronic
1090831036 11:130421022-130421044 GGGAAGAAATCTTGTGATGACGG - Intronic
1092217108 12:6691233-6691255 TTCAAGAAACCTTGACATCAGGG + Intergenic
1098972951 12:76875031-76875053 TTGAGGAAAGCTTGTGGTTCTGG - Intronic
1099125723 12:78754811-78754833 TTGAAGAAACCTAGAGCTTAGGG + Intergenic
1099153699 12:79147364-79147386 TTCAAGAAAGTTTGTGATTAGGG - Intronic
1100222079 12:92516251-92516273 TTGAAGAAACATTTTTATTGAGG - Intergenic
1100621320 12:96276983-96277005 TTGAATAAACCTTTGGATAAAGG + Intergenic
1102845261 12:116174584-116174606 TTGGAGAAACTTAGTCATTATGG - Intronic
1103125413 12:118418010-118418032 TTGAAATAAACTTGTGATTGAGG + Exonic
1107218117 13:37946452-37946474 GTGAAGAAACCTTGGCATGAAGG - Intergenic
1107334169 13:39335469-39335491 TTAAGGAAACCTTGAGATTAAGG - Intergenic
1108733796 13:53261366-53261388 ATGTAAAAACCTTGAGATTATGG - Intergenic
1109164619 13:59018462-59018484 TCCAGGAAACCCTGTGATTAGGG + Intergenic
1110486603 13:76051861-76051883 ATGAAGATACCTTGTCTTTATGG + Intergenic
1110551867 13:76819710-76819732 TTAAATAAACCTTTTTATTATGG - Intergenic
1110599024 13:77350362-77350384 TTCAAGAAACTTTGAGCTTAGGG - Intergenic
1110920028 13:81072708-81072730 TTGAATATACCGTGTGTTTAGGG + Intergenic
1112061625 13:95745770-95745792 TTGAAGAATGCTTGTTATTTAGG + Intronic
1113032404 13:106008726-106008748 TTTAAGAAATCTTGCCATTAAGG - Intergenic
1114820818 14:26017343-26017365 TTGAAGAAACTTAGAGACTAAGG + Intergenic
1114925105 14:27386703-27386725 TTGAAGAAAACATCTGCTTATGG + Intergenic
1115244539 14:31281868-31281890 TGGAGGAAACCTTGTGAAGATGG + Intergenic
1116362425 14:44017558-44017580 GTCAAGAAACATTGTGAATAGGG - Intergenic
1120109860 14:80541006-80541028 TTGTGGTAACCTTCTGATTAAGG + Intronic
1120414176 14:84198475-84198497 TATAAGAATCCTTGTGTTTATGG - Intergenic
1128422796 15:67510111-67510133 TTGAAGAAGCCATGTGACTGTGG - Intergenic
1130699032 15:86160647-86160669 TAGAAGAAGCCTTGTGAATAGGG - Intronic
1131672292 15:94632484-94632506 TTGAAGAAACCTGGGGCATACGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1141259079 16:82434454-82434476 AAGAAGAAAACATGTGATTATGG - Intergenic
1142842973 17:2648357-2648379 TTGAACCAACCTTGTAATCACGG - Intronic
1142845543 17:2672656-2672678 CTGAAGAAACATTGTGGTCATGG - Exonic
1149403874 17:56327157-56327179 ATGAAGAAACCAAGTGAGTATGG - Intronic
1150867548 17:68869711-68869733 TTGAAGAAAGCTTGGGCTAAAGG + Exonic
1150877104 17:68982573-68982595 TTGAAGAAAGCCTGTGATAAAGG + Exonic
1157056551 18:44235748-44235770 TATAAGAACACTTGTGATTATGG + Intergenic
1158835461 18:61326972-61326994 TTGAAGATGACTTTTGATTATGG - Intergenic
1160422887 18:78760161-78760183 TTGAAGACACCCTGTGTTGATGG + Intergenic
1163126412 19:15246597-15246619 TGGAAGAAACCTTGTTTTTTTGG + Intronic
1166636066 19:44452768-44452790 TTGCAGAAACCTTGGGATAATGG + Intergenic
927035664 2:19173386-19173408 TTAAAGAAAGCTTATAATTAAGG - Intergenic
929167476 2:38897630-38897652 TTGTGGAAACCTTGGGAGTATGG + Intronic
929404633 2:41627723-41627745 TTTAAGTAAGCTTGTGATGAAGG - Intergenic
929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG + Intronic
930442191 2:51423331-51423353 TTGTAGAAAGTTTGTGGTTAAGG - Intergenic
932045174 2:68341244-68341266 TTTAAGAAAACTTTTTATTATGG + Intergenic
932443974 2:71760504-71760526 TTGAAGGGCCCTTGTGATGATGG + Intergenic
936595885 2:113847434-113847456 TTGAAGAGTCCTTGTGGTTTGGG - Intergenic
938241108 2:129742807-129742829 TTGAAGAAACATTCTGTCTAGGG + Intergenic
939716986 2:145596176-145596198 TTTTAGAAAACTTGAGATTATGG - Intergenic
940234585 2:151496091-151496113 TTAAAGCAACCTTGTTATTATGG + Intronic
943949900 2:194120268-194120290 TTGAAGCAACCTTGTGTTAGTGG - Intergenic
943993383 2:194727834-194727856 GTGAAGAAATCTGGTGATTTGGG + Intergenic
945367320 2:208971361-208971383 TTGCAGGAACTGTGTGATTACGG + Intergenic
948697681 2:239741375-239741397 TTGAAGGAACATTGTTATGAAGG - Intergenic
1171218150 20:23368109-23368131 TTAAAGAAAGCTTGGGATTGGGG + Intronic
1171347264 20:24475442-24475464 TATAAGAAACCTTGTCCTTATGG + Intronic
1173074538 20:39804556-39804578 TTTAAGAATGCTTGTGATTTTGG - Intergenic
1174890762 20:54389438-54389460 TTGAATAAACCTTCTTAGTAGGG - Intergenic
1175729889 20:61347027-61347049 TTGAAGAACCCTTGGGCTAATGG - Intronic
1176254124 20:64141695-64141717 TTGAATAAACCTTAAGAATAAGG + Intergenic
1177027410 21:15936504-15936526 CTGAAGAAACCCTGTGAATGGGG + Intergenic
1177151874 21:17463343-17463365 TGGAAAACACCTTGTGATTCAGG + Intergenic
1178229488 21:30764819-30764841 TTGAAGAAACTTGGTGGTGAAGG - Intergenic
1178728932 21:35081158-35081180 TTGAAGAATCCCTGTGAGAATGG + Intronic
1178775970 21:35550983-35551005 TTGAAAAACCCTTGTTATAAGGG + Intronic
1179062738 21:37994846-37994868 CTGAGGAAACCCTGTGAGTACGG + Intronic
1179476228 21:41647891-41647913 TTGAATTAGCCTTGTGATTTGGG - Intergenic
949256989 3:2060384-2060406 TTGTAGAAAACTTTTGATTTAGG - Intergenic
950003915 3:9679140-9679162 GAGCATAAACCTTGTGATTAGGG - Intronic
950358890 3:12436499-12436521 TTCAAGAAAGCTTGTAAATAAGG - Intergenic
953106032 3:39879987-39880009 TTGAAGAAGCCTTATAAATATGG + Intronic
953156574 3:40380629-40380651 TTGAAAAAAATTTGTGATTCTGG - Intergenic
954702901 3:52460896-52460918 TTGAAGTAACCTGTGGATTATGG + Intronic
955447687 3:59031579-59031601 TTAAAGAAACCTAGTGACCATGG + Intronic
956830309 3:73040087-73040109 TTGAAGAAGCCCTGGGATGAGGG + Intronic
957953880 3:87159322-87159344 TTTATTAGACCTTGTGATTATGG - Intergenic
958691805 3:97478818-97478840 TTGAAGAAATCTTGAGAGCATGG + Intronic
958853795 3:99360091-99360113 TTTAAGGAATCATGTGATTATGG - Intergenic
958859660 3:99431214-99431236 TTGAAGAAAGATTTTGATTTAGG + Intergenic
960789586 3:121413686-121413708 TTGAAGAAACCTTGTGATTAAGG + Intronic
961434804 3:126909524-126909546 TTGAAGAAACACTGTGACTTTGG + Intronic
961519484 3:127458608-127458630 TGGCAGAAACTTTGTGATCAAGG - Intergenic
963811664 3:149783089-149783111 TTGTATAAACCTTGTTTTTATGG + Intronic
963887488 3:150598510-150598532 CCGAAGAAACCATGTGTTTATGG - Intronic
965126944 3:164642997-164643019 TTGAAGAAAACTTGTCCTCATGG + Intergenic
965962644 3:174446925-174446947 CTTAAGAAACCTTGTGGTTCTGG + Intronic
967661703 3:192119218-192119240 TTGAAGAATTCTTGTCATTGAGG - Intergenic
970362531 4:15324029-15324051 GTGGAGAAACCTAGTGATTATGG - Intergenic
971215482 4:24658465-24658487 TTGGAAAAACCTTGTTTTTAAGG - Intergenic
972570995 4:40310353-40310375 TGGAAGAAACCTGGTGATCAGGG - Intergenic
972967437 4:44528726-44528748 TGGAAGAAAGCTTGTGAAAAAGG - Intergenic
974319293 4:60324163-60324185 GTGAAAAATCCTTTTGATTATGG + Intergenic
975211304 4:71703389-71703411 TTGAAGAACACTTATGATAAGGG + Intergenic
975373268 4:73612847-73612869 TTGAAGAAAACTTGAGAGTCAGG - Intronic
976012631 4:80509641-80509663 TTGAAGAAAACTATTCATTAGGG + Intronic
976683185 4:87780278-87780300 TAGAAGAAACCTTGTAGTAAAGG + Intergenic
976932581 4:90586986-90587008 TTTAAGGAACCCTGTGATTATGG - Intronic
977413527 4:96698926-96698948 ATGCAGAAACCTTTTGATGAAGG + Intergenic
978532221 4:109726985-109727007 CTGGAGAAACATGGTGATTAAGG - Intronic
980929067 4:139168258-139168280 TTGAAGAAACCAAGTGACCATGG - Intronic
981069860 4:140523847-140523869 CGGAAGAAACCCTGTGCTTACGG - Intergenic
981601643 4:146495847-146495869 TTAAAGAAACATTTTGATTTGGG - Intronic
982640242 4:157949820-157949842 AAGAAGAATCCTTGTGATGATGG + Intergenic
983465676 4:168085935-168085957 TAGAAGAAACATTGTGATCTTGG + Intergenic
985522776 5:386426-386448 TTTAAGGATTCTTGTGATTACGG - Intronic
986723814 5:10579717-10579739 TTAAAGAAACCTAGTGAGAAAGG + Intronic
986779323 5:11049630-11049652 TTCAAGAAGCCTTGTAATGAGGG - Intronic
987879584 5:23726114-23726136 TTGAAGAAACTATGTGCCTATGG + Intergenic
988561397 5:32284948-32284970 TTGAACAAAGCTTGCCATTATGG + Intronic
989014959 5:36919567-36919589 TTGAACACACCCTGTGATGAAGG + Intronic
989608751 5:43271776-43271798 TTGAAGGGCCCTTGTGATAATGG - Intronic
990085238 5:51968641-51968663 TAGAAGAAACCTTGCAATTTGGG - Intergenic
990562200 5:56994394-56994416 TTGAAGTATCCATGTGATTAAGG - Intergenic
992979673 5:82155887-82155909 TTAAAGATTCCTTTTGATTAGGG + Intronic
994025168 5:95073570-95073592 TTGGGGAAACCTTTTGAGTATGG - Intronic
994116511 5:96067209-96067231 TTCAAGCAATCTTGTGCTTAAGG + Intergenic
995082649 5:108071859-108071881 TTTAAGAAATTTTGTGATTTAGG - Intronic
995477966 5:112566805-112566827 TTGAAAAAACCTTACAATTATGG + Intergenic
995855516 5:116587425-116587447 TTGAAGAAAGCTCTTGATTCAGG + Intergenic
996465758 5:123800778-123800800 TTGAAGGGAGCTTTTGATTAAGG + Intergenic
996502737 5:124234867-124234889 TACAAAAAACCCTGTGATTAGGG - Intergenic
997542083 5:134671530-134671552 TTGAAAAAGCCTTGTTATTTGGG + Intronic
997677788 5:135726415-135726437 ATGAGGGATCCTTGTGATTATGG - Intergenic
998706605 5:144769204-144769226 TGGAAGAAACTTTCTGATTCTGG - Intergenic
998775570 5:145597181-145597203 TTGTAGAAGCCTTATAATTAAGG - Intronic
1000715852 5:164643380-164643402 TTAAAGAAACTTTCTAATTAAGG + Intergenic
1001001524 5:168012142-168012164 TTTTAGAAACATTGTTATTAGGG - Intronic
1001478274 5:172066410-172066432 TGTAAGAAACCTTGTGTTTCTGG + Intronic
1002803373 6:548458-548480 ATGAAGTAACCTTGTTATTAAGG - Intronic
1004939693 6:20542765-20542787 ATGAGGAATCCTTGTGATGATGG - Intronic
1005359702 6:25019885-25019907 TTGAAGAATTCTTGTTATCATGG + Intronic
1008221538 6:48860240-48860262 TTCATGATTCCTTGTGATTAGGG - Intergenic
1011862890 6:91782554-91782576 TTGAGGAAACCCTGGAATTAAGG - Intergenic
1012779758 6:103542884-103542906 TTGAACAAACATTGGGATTTAGG - Intergenic
1016043917 6:139461825-139461847 TTTAAGAAAACTTTTTATTATGG + Intergenic
1017307529 6:152936487-152936509 TTGAAGAAAACATTTGTTTATGG - Intergenic
1018688524 6:166323086-166323108 TTAAAGCAAGCTTGTGATTTAGG - Intronic
1020335093 7:7056982-7057004 GTGAAGAAACCCTGTGATATGGG - Intergenic
1020937718 7:14488433-14488455 TAGAAGAAACTTTGTATTTAAGG - Intronic
1034684514 7:152958561-152958583 TTCAAGAAACATTGTGAATTTGG - Intergenic
1034960653 7:155362337-155362359 TTGAAAAAAACATGTGATCAGGG - Intronic
1035895114 8:3391221-3391243 TGGAAGAAACATTGTGATAAAGG - Intronic
1036625580 8:10468897-10468919 ATGCAGAAACCTTATGTTTAAGG + Intergenic
1039239041 8:35534464-35534486 TTTGAGAAACCTTGTGTTGATGG + Intronic
1040787627 8:51184740-51184762 TTTAAAAAATCTTATGATTAAGG + Intergenic
1043310272 8:78850414-78850436 TTTAGCAAACTTTGTGATTAAGG + Intergenic
1045551636 8:103178274-103178296 ATGAAGAATCCTTGTGGTGATGG + Intronic
1048089398 8:131222629-131222651 GTGAAGAAACCTTGAGGTTTAGG + Intergenic
1050365684 9:4871526-4871548 TTTAAGAACCATTGTTATTATGG + Intronic
1050589864 9:7149785-7149807 TTCTAGAAATCTTGTGCTTAGGG - Intergenic
1050658701 9:7858802-7858824 ATAAAGAAACAGTGTGATTAGGG + Intronic
1051335952 9:16066131-16066153 GTGAAGAAATCTTGTCATCAAGG - Intergenic
1051619855 9:19039588-19039610 TTGAAGAAATCAAGTGATAAAGG + Intronic
1052689062 9:31792016-31792038 TTGTAGCAACCATGTGATTTGGG - Intergenic
1055047607 9:71946125-71946147 TTGAAGAAACCAAGTTAGTAGGG + Intronic
1057025336 9:91730849-91730871 TTGAGTGAACCTTGTGATGAGGG - Intronic
1057044790 9:91877286-91877308 TGGATGAAACCTTGTGTGTATGG - Intronic
1057868299 9:98698954-98698976 TGGAAGAAGCCTTGCTATTAGGG + Intronic
1058267134 9:102915642-102915664 TTGGAGAGGCTTTGTGATTATGG - Intergenic
1058365562 9:104204629-104204651 TTGCAGAAATCTTGGTATTAAGG + Intergenic
1186092400 X:6063898-6063920 TGGAAGAAACCATGTGAGTTAGG - Intronic
1187280341 X:17853798-17853820 TTAAAGAAATATTGTGATGATGG + Intronic
1191706948 X:64103824-64103846 TTCAAGAAAACATGTGCTTAGGG + Intergenic
1192545665 X:72010872-72010894 TTGAAGTATCCTTGTGGTGATGG - Intergenic
1192598189 X:72433686-72433708 TTGGAGAAACCTTGTGCTTCTGG + Intronic
1196259586 X:113562713-113562735 ATAAAGAAAACTTGTGTTTACGG + Intergenic
1196351955 X:114742132-114742154 TTGAAGAAACCTTTTCTTTCTGG + Intronic
1199830152 X:151541388-151541410 TTAAACCAACCTTGTGTTTATGG + Intergenic