ID: 960790445

View in Genome Browser
Species Human (GRCh38)
Location 3:121424466-121424488
Sequence TTCTGGCTTTGCAGTCAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960790445_960790446 -9 Left 960790445 3:121424466-121424488 CCTTCTTGACTGCAAAGCCAGAA 0: 1
1: 0
2: 2
3: 29
4: 280
Right 960790446 3:121424480-121424502 AAGCCAGAAAATAAACTAGATGG 0: 1
1: 0
2: 3
3: 49
4: 645
960790445_960790450 15 Left 960790445 3:121424466-121424488 CCTTCTTGACTGCAAAGCCAGAA 0: 1
1: 0
2: 2
3: 29
4: 280
Right 960790450 3:121424504-121424526 GGTTTTGGACAATTGTACACAGG 0: 1
1: 0
2: 1
3: 7
4: 120
960790445_960790448 -6 Left 960790445 3:121424466-121424488 CCTTCTTGACTGCAAAGCCAGAA 0: 1
1: 0
2: 2
3: 29
4: 280
Right 960790448 3:121424483-121424505 CCAGAAAATAAACTAGATGGTGG 0: 1
1: 0
2: 1
3: 25
4: 266
960790445_960790449 0 Left 960790445 3:121424466-121424488 CCTTCTTGACTGCAAAGCCAGAA 0: 1
1: 0
2: 2
3: 29
4: 280
Right 960790449 3:121424489-121424511 AATAAACTAGATGGTGGTTTTGG 0: 1
1: 0
2: 0
3: 29
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960790445 Original CRISPR TTCTGGCTTTGCAGTCAAGA AGG (reversed) Exonic
900629659 1:3627486-3627508 TTCTGACTTTTCAGGCGAGAAGG + Exonic
902093242 1:13921320-13921342 TTCCGGCTTTGCAGGCCAGATGG + Intergenic
905328929 1:37178499-37178521 TTCAGGCTGTGCAGGCTAGAAGG - Intergenic
907484625 1:54768600-54768622 GGGTGGCTTTGCAGTCAGGAAGG + Intergenic
908489094 1:64625042-64625064 TTCTGGCTTTGCAGACCATAAGG - Intronic
908977675 1:69919199-69919221 TTCAGGCTCTGCAGTCCATAGGG + Intronic
909265731 1:73555976-73555998 TTCACCCTTTCCAGTCAAGAAGG - Intergenic
909342092 1:74543647-74543669 TTTTGGGTTTGGAGTAAAGAGGG - Intronic
910332088 1:86085613-86085635 TTCTGCGTTTGGAATCAAGATGG - Intronic
910934920 1:92479947-92479969 TCCTGCCTTTTCAGTCGAGAGGG + Intronic
914837350 1:151218661-151218683 TTTTGTATTTTCAGTCAAGACGG - Intronic
916093281 1:161326029-161326051 TTTTGTATTTTCAGTCAAGATGG - Intronic
916854834 1:168738632-168738654 TGCTGGCTTTGCATTGAAGAGGG - Intergenic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
919583186 1:199403114-199403136 TGCTGGCTTTGCAGTATTGAGGG + Intergenic
920727121 1:208446358-208446380 TTCAGCCTGTGCAATCAAGAAGG - Intergenic
920869859 1:209784850-209784872 TTCTGGATTCCCAGTCAAGTGGG - Intergenic
922063501 1:222114001-222114023 TTTTGGATTTTCAGTAAAGATGG + Intergenic
922388780 1:225116129-225116151 TTCTGGATTTGTAAGCAAGATGG + Intronic
922416337 1:225426798-225426820 TTCTGCCTTTACAGCCAGGAAGG - Intronic
922678546 1:227569968-227569990 TTCTGGGCTTGCAGTAAAAAGGG + Intronic
923302231 1:232651944-232651966 TTTTGTATTTTCAGTCAAGATGG - Intergenic
923901708 1:238333154-238333176 TTCTCTCTTTGGAGGCAAGAAGG - Intergenic
924539102 1:244964346-244964368 TTCAGGCCTCTCAGTCAAGAGGG - Intergenic
924725475 1:246665818-246665840 TACTGACTTTGCAGACAACATGG + Exonic
924947501 1:248856205-248856227 TCATGGCTTTGCAGACTAGAGGG - Intronic
1063089246 10:2847487-2847509 TTTTGTATTTGCAGTAAAGATGG - Intergenic
1063545548 10:6977616-6977638 TTCTGTCTCTTCAGACAAGAGGG + Intergenic
1064139691 10:12779978-12780000 TCGTGGCTTTGCAGCCAACATGG - Intronic
1064310959 10:14211368-14211390 TTCTGGGTTTGAAGTCACGTGGG + Intronic
1064516330 10:16152951-16152973 TGCTGGCTTTGCAGTTATGTGGG + Intergenic
1064532217 10:16322155-16322177 TGCTGGCTTTGAAGACAAAAGGG + Intergenic
1064685736 10:17859486-17859508 TTTTGCATTTTCAGTCAAGACGG + Intronic
1065163800 10:22953166-22953188 TTCTGGCTTTGAAGACGAAAGGG + Intronic
1065866356 10:29918663-29918685 TTCTGGCTCACCAGTTAAGACGG - Intergenic
1069782240 10:70964274-70964296 TACAGGCTTTGCAGCCAGGAGGG - Intergenic
1070217382 10:74400948-74400970 TTTTAGCTTTTCAGTCAGGAAGG - Intronic
1070291063 10:75114373-75114395 TTCTGCCATCGCAGTCATGATGG - Intronic
1075440847 10:122478296-122478318 TTCTGGCATTGCAGAGAGGATGG + Intronic
1076215537 10:128690739-128690761 TTCTGGCTTTGCTGTCAACAAGG - Intergenic
1076996806 11:301209-301231 TTTTGTATTTGCAGTCGAGACGG + Intergenic
1077132064 11:978022-978044 TTCCCGCTTTGCAGTCAAGGAGG + Intronic
1078407024 11:11079332-11079354 ATCTGGTTTTGCAGACAAGTTGG + Intergenic
1078584441 11:12569881-12569903 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1081490227 11:43562329-43562351 TTTAGGCTTTGCAGCCAAGAAGG + Intronic
1084750488 11:71201748-71201770 GGCTGGCTTTGAAGTCCAGAAGG + Intronic
1085251671 11:75148060-75148082 TTCTGGCCTGGCAGCCAGGAAGG - Intronic
1085524380 11:77155781-77155803 TCCTGGCTTTGGAGTCATGTGGG - Intronic
1085769736 11:79314078-79314100 GACTGGATTTGCAGTCATGAAGG + Intronic
1088585901 11:111360032-111360054 TCCTGGCTTTGATGGCAAGAGGG - Intronic
1089096043 11:115920917-115920939 TTAATGCTTTGCAGTCAAGCAGG + Intergenic
1090177611 11:124664944-124664966 AACTGGCTTGGAAGTCAAGAAGG + Intronic
1090751151 11:129747602-129747624 TTCTGGCTTCTAAATCAAGATGG - Intergenic
1091218342 11:133917124-133917146 TTCTGGCTTTCCAGGCGAGAAGG - Intronic
1091295231 11:134469049-134469071 TTCTTGCTTTGCAGGCCATACGG - Intergenic
1091705040 12:2688065-2688087 TTCTGGCTTTACAGACATGCAGG + Intronic
1092596449 12:10010481-10010503 TTCTTGCTGTGCAGCAAAGAAGG - Intronic
1094032660 12:26030829-26030851 TTTAGGCTTTGCAGGCAATATGG + Intronic
1094045911 12:26166762-26166784 TTTTGGCTTTGCAGGCTATATGG - Intronic
1094647550 12:32340958-32340980 TTCTGATGTTGCTGTCAAGAAGG + Intronic
1095794962 12:46209176-46209198 TTCTGGCATTACAGTTTAGAAGG + Intronic
1098747787 12:74262589-74262611 TTCCTGCTTTGCCTTCAAGAAGG + Intergenic
1099019478 12:77385380-77385402 TTATGTCTTTGCATTAAAGAGGG + Intergenic
1099506257 12:83479877-83479899 TTCTGGATTTGTATGCAAGATGG + Intergenic
1100761976 12:97817726-97817748 TTTAGGCTTTGCAGGCAATAGGG + Intergenic
1100882807 12:99037342-99037364 TTCTGTATTTTTAGTCAAGATGG - Intronic
1106160376 13:27196024-27196046 TAATGGCTTTCCAGTCAAGGTGG + Intergenic
1106719659 13:32425442-32425464 TCCTGGCTCTGGAGTGAAGAAGG - Intronic
1108613929 13:52112422-52112444 TTCTGGCTGTGGAATCAAGATGG + Intronic
1108780698 13:53827744-53827766 ATCTGGCATTGCAGTCTGGAGGG + Intergenic
1110658318 13:78027312-78027334 TTCTCTCTTTGCAGTAGAGATGG + Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1112708550 13:102100439-102100461 TCCTGGCTTTGCAGAACAGAAGG + Intronic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1116465209 14:45223529-45223551 TTGTGGCATTGCACTCCAGACGG + Intronic
1117517163 14:56513262-56513284 TTCTGTCTTTGCTGCCAAGATGG - Intronic
1118981933 14:70724234-70724256 TTCTGGCTCTGCAGCCCTGAGGG - Intronic
1119035170 14:71223626-71223648 TTTTGGTTCTGGAGTCAAGATGG - Intergenic
1121684421 14:95823783-95823805 TTTTGGCTTTGTATTCATGAAGG - Intergenic
1121896381 14:97651832-97651854 TTCAGGCTTTGCAGACCATATGG + Intergenic
1122182718 14:99967627-99967649 TACTGGCTTTGAAGGCAGGAGGG - Intergenic
1122647505 14:103205109-103205131 TTCTTGCTATGCAGTCCAGATGG + Intergenic
1123105317 14:105838737-105838759 TGCTGGCTCAGCAGACAAGAGGG + Intergenic
1124076239 15:26447337-26447359 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1125557199 15:40595940-40595962 TTCAGGCTTTGCAGGCTACATGG + Intronic
1126274747 15:46863705-46863727 TTCTGGCTTCACAGTATAGAAGG + Intergenic
1126468950 15:48986343-48986365 TTCAGGCTTTGCAGGCCATATGG + Intergenic
1127236287 15:57056310-57056332 TTCTGTATTTTCAGTCGAGATGG + Intronic
1129797947 15:78392197-78392219 TTTTGGCTTTGGAGTCACCAAGG - Intergenic
1131499414 15:92947324-92947346 TGCTGGCTATACAGACAAGAGGG + Intronic
1132891601 16:2207473-2207495 TTCTGGCTTTGCTGGCAAGGTGG - Intronic
1133458710 16:5967144-5967166 TTGTGGCTTTGCGGGCCAGATGG - Intergenic
1133583386 16:7167821-7167843 TTTAGGCTTTGCAGGCCAGATGG - Intronic
1134196391 16:12162435-12162457 TTTTGGCTTTGCAGGCCATATGG + Intronic
1134204992 16:12229960-12229982 TTTTGGCTTTGTTGTCCAGATGG + Intronic
1134601959 16:15540637-15540659 TTATCGCCTTGCAGGCAAGAAGG - Intronic
1134633601 16:15775555-15775577 TTCAGGCTTTGCAGGCCAGGTGG - Intronic
1137061110 16:35792418-35792440 TTCTGGATTTGCGGTGAAGTGGG - Intergenic
1137352607 16:47726775-47726797 TCCTGGCTTTGCAGTCTGGCTGG + Intergenic
1137527932 16:49253104-49253126 TTTTGGCTTTGCAGGCCATATGG + Intergenic
1139305181 16:65979713-65979735 TTCTGGCTCAGAAGTCAAGGAGG - Intergenic
1139713028 16:68790957-68790979 TTCTGGCCTTGTTGTCAAGAAGG + Intronic
1140172183 16:72617450-72617472 TGCTGGCTTTGAAGACAGGAAGG - Intergenic
1140825105 16:78699036-78699058 TTCTAGCTTTGCAGTTCAGATGG + Intronic
1141700637 16:85640500-85640522 CACTGGCTTTGCAGGCAAGAGGG + Intronic
1141835454 16:86536023-86536045 TTCTGTATTTTCAGTAAAGACGG + Intronic
1142656132 17:1395554-1395576 TTCTGTCTATGCATTTAAGAAGG + Intronic
1143294093 17:5857605-5857627 TTCAGGCTTTGCAGGCCATATGG - Intronic
1144084645 17:11797905-11797927 TTCTGCCTTAAAAGTCAAGATGG + Intronic
1145741774 17:27280843-27280865 TTCTGGATTTGCAGCGATGAGGG - Intergenic
1148258108 17:46154660-46154682 TTAAGGCTTTGCAGTGAAGATGG - Intronic
1148737062 17:49870892-49870914 TTCTCCCTTTGCTGGCAAGAAGG + Intergenic
1150203370 17:63379740-63379762 TTCTGGTTTTCCCGCCAAGAGGG + Exonic
1150453594 17:65289383-65289405 TTCAGGCTTTGCTTTCTAGAGGG + Intergenic
1150821473 17:68437647-68437669 GTCTGCGTCTGCAGTCAAGATGG + Intronic
1151023967 17:70655720-70655742 TTTTGGCTTTGCAGGCCATATGG + Intergenic
1151597761 17:75088433-75088455 TGCTGGTTTTGCAGTGAATATGG + Intronic
1153197174 18:2613268-2613290 TTTAGGCTTGGCAGTCTAGATGG - Intronic
1153197563 18:2617429-2617451 TTCTGGCTTTGCAGGCCACATGG - Intergenic
1153740182 18:8117174-8117196 TTTTGACTATGTAGTCAAGATGG - Intronic
1155063314 18:22247518-22247540 TTCTGTCTTTTCTGTCAAGCTGG + Intergenic
1156056172 18:33006716-33006738 CTCTGTCTTTGCAGATAAGAAGG + Intronic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1160275746 18:77433285-77433307 TTTTGGGTTTGCAGGCCAGATGG - Intergenic
1160758947 19:772971-772993 TTCCGGCTGTGCAGGCAAGCAGG + Intergenic
1161317753 19:3626188-3626210 TTCTGGCTTTGAGGTGGAGAAGG - Intronic
1162648292 19:12065803-12065825 TTCTGTATTTTCAGTAAAGACGG + Intronic
1163345383 19:16738178-16738200 TTTTGGCTTTACAGGCCAGATGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164799579 19:31065194-31065216 TTCTGGTTTGGGAGACAAGAAGG + Intergenic
925254732 2:2473531-2473553 TTCTGGCTATGCACCCAACACGG - Intergenic
927364632 2:22279796-22279818 TTCTGGCTTTGCAGGCCATATGG - Intergenic
928847290 2:35692224-35692246 TTCAGGTTTTGCAGACAATATGG + Intergenic
929260102 2:39857029-39857051 TTTTGGCTTTGCAGGCCATATGG + Intergenic
931822064 2:65962040-65962062 TTCTGGCATTTCAATCAAGGAGG + Intergenic
932091773 2:68812108-68812130 TTTAGGCTTTGCAGGCCAGATGG + Intronic
933666548 2:84970116-84970138 ATCGCGCTTTGAAGTCAAGACGG - Intergenic
933870614 2:86562557-86562579 TTCTGGCTTCACAGTCGAGAAGG + Intronic
934266135 2:91510260-91510282 TTCTGGCTTGGCTGTCTAGCTGG + Intergenic
934267397 2:91515913-91515935 TTCTGGCTTGGCTGTCTAGCTGG + Intergenic
934604960 2:95687557-95687579 TACTGGCTATGCCTTCAAGAAGG + Intergenic
935178941 2:100673447-100673469 TTCAGGCTTTGCAGGCCATACGG + Intergenic
935858458 2:107300960-107300982 TTCTGGTTTTGTAGCCAAGCAGG + Intergenic
935940781 2:108236914-108236936 CTCTTGCTATGCAGTCCAGATGG - Intergenic
936392129 2:112084926-112084948 TTTTGGCTTTGCAGGCCATATGG + Intronic
937636333 2:124159327-124159349 TTCTGGCTTTGCAAGCCATATGG + Intronic
939136326 2:138298754-138298776 TTTTGGCTTTGTAGCCAAGTTGG + Intergenic
940677729 2:156745729-156745751 TTCAGGCTTTGCAGGCCATACGG + Intergenic
942697841 2:178665847-178665869 TTCTGTATGTGCAGTTAAGATGG - Intronic
943195547 2:184743224-184743246 TTTTGGCTTTGAATTCAAGTGGG - Intronic
944526946 2:200629028-200629050 CTCTGGCTGTGCACTCAGGATGG - Intronic
944541860 2:200761672-200761694 TTCTGGCTTCACAGTCAGCATGG - Intergenic
945036982 2:205712505-205712527 TTCTGGCTTTGGAATAAATACGG - Intronic
945465795 2:210170417-210170439 GGCTGGCTTTGCAGTCGGGAGGG - Intronic
946402401 2:219475516-219475538 TTCTGGCCGTGCTGTGAAGATGG + Intronic
946792061 2:223311005-223311027 TTCCTGCTTTGCAAACAAGATGG - Intergenic
947327752 2:228996486-228996508 TTCTGGCTCTTCTGCCAAGAGGG - Intronic
947693692 2:232164026-232164048 TTTTGGCTTTGCAGGCCATATGG - Intronic
1168789593 20:567397-567419 GTCTCACTTGGCAGTCAAGAAGG + Intergenic
1169819364 20:9691483-9691505 TTCAGGCTATTCAGTCAAGGTGG - Intronic
1169989659 20:11487105-11487127 TTCTGGCTTTCCAATCAACTGGG - Intergenic
1172588651 20:36102466-36102488 TACTGGCTTTGCTGTGAAGGTGG + Intronic
1173621399 20:44439627-44439649 TGCTGGCTTTGAAGACAAGGGGG + Intergenic
1173900738 20:46586841-46586863 TTTTGGCTTTGCAGGCCACATGG + Intronic
1175151477 20:56938315-56938337 TTCAGGCTTTGCAGGTCAGAAGG - Intergenic
1175271923 20:57740094-57740116 CCCTGACATTGCAGTCAAGATGG - Intergenic
1175660062 20:60804657-60804679 TTCTGTGTTTCCAGTCAACACGG + Intergenic
1176745088 21:10644526-10644548 TTCTGGATTTTCAGTAGAGATGG + Intergenic
1178058394 21:28825135-28825157 TTCAGGCTTTGAAGTCTAGCTGG + Intergenic
1179027603 21:37692655-37692677 TTCTGGCTTTGGAGTGAATCAGG + Intronic
1180239800 21:46494532-46494554 TTCTGGCCTTTGAGTGAAGAAGG - Intronic
1181223052 22:21374367-21374389 TGCTGCCTTTGCACTCAAAAGGG - Intergenic
1181255686 22:21561267-21561289 TGCTGCCTTTGCACTCAAAAGGG + Intronic
1182220451 22:28754497-28754519 TTTTGTATTTGCAGTAAAGACGG - Intronic
1183438199 22:37807619-37807641 TTCTGCCTTTGGGGTCCAGAGGG + Intergenic
1184874911 22:47268216-47268238 TTCTGCCTTTGAAGTCAGCACGG + Intergenic
1184942691 22:47780750-47780772 TTCTGGCTATGCAGTGATGGGGG + Intergenic
1185173535 22:49306748-49306770 TTCTGGCTTGGCAGTGAGGATGG - Intergenic
1185286713 22:50003900-50003922 TTCTCGCTTTGAAATGAAGAAGG + Intronic
950167394 3:10811783-10811805 TTTTGGATTTTCAGTAAAGATGG - Intergenic
950186805 3:10950523-10950545 TTCTGGCTTGGGCGACAAGATGG - Intergenic
951403741 3:22268481-22268503 ATCTGGCTTTGCAGGTCAGAGGG + Intronic
952506977 3:34016251-34016273 TTTAGGCTTTGCAGTCCATATGG + Intergenic
952928536 3:38341170-38341192 CTCAGGCTTAGCAGTAAAGAGGG - Intergenic
953110640 3:39934648-39934670 ATCTGGCTTTGGAGTCCAGCTGG + Intronic
953967813 3:47323571-47323593 TTCTGCCTGAGCAGTTAAGAAGG + Intronic
956448000 3:69344715-69344737 TTCAGGTTTTCCAGTCAGGAGGG - Intronic
957002634 3:74903994-74904016 TTTTGGCTTTGCAGGCCAAATGG - Intergenic
957970584 3:87376656-87376678 TTCTGGTTCTTCAGTAAAGAAGG + Intergenic
959579463 3:107968804-107968826 TTCAGGCTTTGCAGGCCATATGG + Intergenic
960442375 3:117704659-117704681 GCCTGGTTTTGAAGTCAAGAAGG + Intergenic
960509541 3:118531827-118531849 TTGTGGGTGTTCAGTCAAGATGG + Intergenic
960790445 3:121424466-121424488 TTCTGGCTTTGCAGTCAAGAAGG - Exonic
961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG + Intronic
962512231 3:136113959-136113981 TTCTGGAATTGCTGGCAAGATGG + Intronic
962541500 3:136387179-136387201 TTTAGGCTTTGCAGTCCATATGG + Intronic
962883542 3:139601564-139601586 TTCCTGCTTTTAAGTCAAGAGGG + Intronic
964502332 3:157362199-157362221 TTCTGTATTTGCAGTAGAGACGG + Intronic
964719813 3:159760260-159760282 TTATGTCTGTGCAGTGAAGAAGG - Intronic
965590921 3:170358695-170358717 TTTTGGCTTTTCTCTCAAGAAGG + Intronic
970692596 4:18636755-18636777 TTTTGTCTTTGCAGTCACAATGG + Intergenic
971056981 4:22924335-22924357 TTTTGGCTTTGCAGGCAATATGG - Intergenic
971488103 4:27182139-27182161 TTCAGGGTTTGCAGTGAAAATGG - Intergenic
973318651 4:48787389-48787411 TTTTGGCTTTGCAGGCCATATGG + Intergenic
975259606 4:72281898-72281920 TTCTGGCTTTGCTGTGAGCAAGG + Exonic
976277837 4:83295714-83295736 TTCTGGCTTTGGAGTCCATATGG - Intronic
978347966 4:107791589-107791611 GTCTGGCTGTGCTGTCTAGAAGG + Intergenic
978687834 4:111469246-111469268 TTCTCACTGTGCAGTCAAAAAGG - Intergenic
979722503 4:123918031-123918053 TTCTGGCTTTCCATTTAGGAAGG + Intergenic
983177770 4:164611551-164611573 TCTTGGCTTTGAAGTCAATAGGG - Intergenic
984077113 4:175196983-175197005 TGCTGTATTTTCAGTCAAGACGG - Intergenic
984552983 4:181182713-181182735 TGCTGGCTTTGAAGACAAAAGGG + Intergenic
986576007 5:9213730-9213752 TTTAGGCTTTGCAGTCCACATGG - Intronic
987556927 5:19464385-19464407 TTCTGCCTTTTCAGTAAACAAGG + Intergenic
989142106 5:38211579-38211601 TTTTGGCTTTGCAGACCATATGG - Intergenic
990064670 5:51697952-51697974 TTCTGGATATGCAGAAAAGAGGG - Intergenic
990645770 5:57842788-57842810 TGATGGCTCTGCAGTCAGGATGG + Intergenic
991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG + Exonic
992868523 5:80982367-80982389 TTCTGGCTTTGTGGTCAGGGAGG + Intronic
994151062 5:96448045-96448067 TTCTGGCTGTGCAGAGATGAGGG + Intergenic
995305104 5:110636872-110636894 ATCTGGCTTTGCAGATAACAGGG + Intronic
995341411 5:111065220-111065242 TTTAGGCTTTGCAGGCCAGATGG + Intergenic
995377408 5:111491304-111491326 TTTAGGCTTTGCAGTCCATATGG - Exonic
995593378 5:113723124-113723146 TTTAAGCTTTGCAGGCAAGATGG + Intergenic
995889934 5:116939773-116939795 TTCTGGGTCTGATGTCAAGAGGG - Intergenic
995957786 5:117800237-117800259 TTCTGTCTTAGCACTCATGATGG - Intergenic
998675625 5:144404661-144404683 TTCTGGCTTCTCAATGAAGAGGG - Intronic
999319903 5:150607688-150607710 TGCTGGCATTGCAGTCAGGAGGG - Intronic
999562012 5:152813761-152813783 TTCTAGCTTTGCAATCAACATGG - Intergenic
999934153 5:156467028-156467050 TTTAGGCTTTGCAGGCCAGATGG + Intronic
1000082545 5:157861567-157861589 TTTTGGCTTTACATTCCAGATGG - Intergenic
1000200349 5:159003892-159003914 TTCTGGCTTTGCAGTCAGGCAGG - Intronic
1003084382 6:3049676-3049698 CTCTGGCTTTGCAATCCAGGGGG - Intergenic
1003132589 6:3408128-3408150 TTCAGGCTTTGCAGGCCATATGG - Intronic
1006922709 6:37637070-37637092 CCCTGTCTTTGCAGTAAAGAAGG + Exonic
1007073175 6:39050743-39050765 TTCTGTCTATGAAGTCAAAAGGG + Intronic
1007115492 6:39340194-39340216 TTCTGGCTTTTCAGTGACCACGG - Intronic
1008078892 6:47174350-47174372 TTTTGTATTTTCAGTCAAGATGG + Intergenic
1009821389 6:68806051-68806073 TTCTCCCTTTGTAGTCAATAGGG + Intronic
1010634481 6:78240497-78240519 TTCTGGCTTAGCCTACAAGATGG + Intergenic
1011898851 6:92266739-92266761 CTCTAGCTTTGAAATCAAGAAGG + Intergenic
1012195053 6:96331201-96331223 TTTAGGCTTTGCAGGCCAGATGG + Intergenic
1013810472 6:114039482-114039504 CTCTGGCTTTGAAGTAAGGAAGG - Intergenic
1015142491 6:129950826-129950848 ATTTGGTTTTGCAGCCAAGAAGG + Intergenic
1015658341 6:135545307-135545329 TTATGGCTTTGCAGGCCACATGG - Intergenic
1018887284 6:167950740-167950762 GTCTGGCTCTGCAGTGGAGATGG + Intronic
1019204321 6:170346543-170346565 TTCAGGCTTTGCAGGCCACATGG + Intronic
1020104922 7:5418373-5418395 TTCTGCCTTTTGGGTCAAGATGG - Intronic
1020368784 7:7410663-7410685 TTGTTTATTTGCAGTCAAGAAGG + Intronic
1022045778 7:26621131-26621153 GTCTGGCTTTGGAGTTAGGATGG - Intergenic
1022654006 7:32302097-32302119 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1026646878 7:72178516-72178538 TTTTGTCTTTTCAGTAAAGAGGG - Intronic
1028186014 7:87785692-87785714 TCCTGGCTCTGCAGTCAGTAGGG + Intronic
1032583122 7:133121704-133121726 TTTTGGTTTTGGACTCAAGATGG + Intergenic
1033460023 7:141538401-141538423 TTCTGGCTTTTCTCTCAACACGG - Intergenic
1033894014 7:146050272-146050294 TTCTGGTTTTGCAGGCCAGGTGG - Intergenic
1033963780 7:146948282-146948304 TTTAGGCTTTGCAGGCAACATGG - Intronic
1034691122 7:153014615-153014637 TTTTGGATTTGCAGTAGAGATGG + Intergenic
1035561431 8:607106-607128 TTCTGGTTTTCAAGTGAAGACGG + Intergenic
1039565738 8:38551459-38551481 TGCTGGACTTCCAGTCAAGATGG - Intergenic
1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG + Intergenic
1039682416 8:39754882-39754904 TTCTTACTTTGCATTCAATATGG - Intronic
1040590583 8:48789012-48789034 TGCCGGCTCTGCAGCCAAGATGG + Intergenic
1040605324 8:48926022-48926044 ATCAGTCTGTGCAGTCAAGAAGG + Intergenic
1040786411 8:51169914-51169936 TTCTGCCTTTGGACTCAAGCTGG - Intergenic
1042035182 8:64525392-64525414 TGCTGGCTTTGCTCTCAAGCAGG + Intergenic
1042505431 8:69554805-69554827 TTCTGTATTTTCAGTAAAGACGG - Intronic
1043702363 8:83305076-83305098 TTTTGGCTTTGCTGAAAAGATGG - Intergenic
1044191371 8:89322402-89322424 ATCTGCCTTGGCAGTCAAGGGGG - Intergenic
1045020281 8:98037240-98037262 TTCTGGCATTGCTGCCAAGGTGG + Intronic
1045819464 8:106319286-106319308 TTCTGGCTCTGCGGCAAAGAGGG - Intronic
1045946425 8:107801774-107801796 TTCTGGCTTTGCTATCAGGCAGG - Intergenic
1046292325 8:112179417-112179439 TGCAGGCTTTGCAATCATGAAGG + Intergenic
1046935800 8:119884226-119884248 TTCTGTATTTTCAGTAAAGATGG + Intronic
1048088077 8:131206252-131206274 TTATGGTTTTGCATTCATGAGGG - Intergenic
1049053976 8:140220488-140220510 TTTGGGCTCTGCAGTAAAGAAGG - Intronic
1050307515 9:4320433-4320455 TTCTGGCTTGGCAATAAAGTGGG - Intronic
1050517701 9:6462251-6462273 TTTTGGCTTTGCAGGCTAGATGG - Intronic
1050646661 9:7726925-7726947 CTGTAGCTTTGCAGTCAAGTTGG - Intergenic
1051865682 9:21678439-21678461 TTCTGACTTTTCAGGCAATATGG + Intergenic
1055316054 9:75035679-75035701 GACTGGCTTTGCAGTGAAGGTGG - Intergenic
1055525677 9:77130868-77130890 TTAAGGCTTTGCAGCCCAGATGG - Intergenic
1055912582 9:81369243-81369265 TAGTGGCTTTGCAGGCCAGATGG - Intergenic
1056537503 9:87542792-87542814 GTCTGGCTTTGGAGTCAATATGG + Intronic
1056578686 9:87874492-87874514 TCCTTGCTATGCAGTCCAGATGG - Intergenic
1057807576 9:98230906-98230928 TTCTGGTTTTGCACTCAGCAAGG - Intronic
1057995136 9:99815616-99815638 GTCTGGCTTTGCTGCCATGAAGG - Intergenic
1058474815 9:105322194-105322216 TTCTGGTTTTGAAGGCAGGAAGG + Intronic
1058621847 9:106891507-106891529 TTCTGCTTTTGAAGTTAAGATGG + Intronic
1059495570 9:114706392-114706414 TTGAGCCTTTGCAGTCCAGATGG - Intergenic
1059819806 9:117959110-117959132 TTTTGGCTTTGTGGGCAAGATGG + Intergenic
1186547986 X:10471031-10471053 TTTAGGCTTTGCAGTCCATATGG - Intronic
1186555066 X:10549540-10549562 TTCTGGCATTGCAGGCCATATGG - Intronic
1187416791 X:19100323-19100345 TTTAGGCTTTGCAGCCAAAATGG + Intronic
1187563098 X:20420705-20420727 TTCAGGCTTTGCAGGCCATAGGG + Intergenic
1189238099 X:39504071-39504093 TTCTGGCTTTGCAGGTAAGTAGG - Intergenic
1190664416 X:52683971-52683993 TTCTGTCTTTTCAGTAGAGACGG + Intronic
1190675006 X:52774451-52774473 TTCTGTCTTTTCAGTAGAGACGG - Intronic
1198334938 X:135656842-135656864 TTCTGGCTTTACAGTAATCATGG + Intergenic
1198585866 X:138121357-138121379 TTATAGCATTGCGGTCAAGAGGG + Intergenic
1198674272 X:139115466-139115488 TGCTGGCCTTCCAGTCAGGAAGG - Intronic
1199856913 X:151766817-151766839 TTCTGGCATAGCAGGAAAGAAGG + Intergenic
1199925081 X:152453913-152453935 TTTTTGGTTTGCAGTCAAGTGGG - Intergenic
1200742276 Y:6867168-6867190 TTCTGGCTTTGCCCTCAAAAAGG - Intronic
1200955209 Y:8937660-8937682 TTCTGTCTTTGCAGTAAGGAAGG + Intergenic
1200960224 Y:8989616-8989638 TTCTGTCTTTGCAGTAAGGCAGG + Intergenic