ID: 960794202

View in Genome Browser
Species Human (GRCh38)
Location 3:121467393-121467415
Sequence CACCGTAGACAGAAAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960794197_960794202 7 Left 960794197 3:121467363-121467385 CCTGGCATGACAAAGGAGAAAGG 0: 1
1: 0
2: 2
3: 24
4: 257
Right 960794202 3:121467393-121467415 CACCGTAGACAGAAAGATGGAGG 0: 1
1: 0
2: 1
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960794202 Original CRISPR CACCGTAGACAGAAAGATGG AGG Intronic
903387323 1:22936009-22936031 GAGCGGGGACAGAAAGATGGGGG - Intergenic
903782307 1:25828617-25828639 AACTGTAGACAGAAAGCTGGAGG - Intronic
904100968 1:28026723-28026745 CATCTTAGAAAGAAAGAAGGGGG + Intronic
904392984 1:30197952-30197974 AACCAGAGACAGAAAGAAGGAGG + Intergenic
905008784 1:34732651-34732673 GACTGAAGTCAGAAAGATGGAGG - Intronic
909177731 1:72381404-72381426 CTCCGAAGACAGGAAGATGCTGG - Intergenic
909580031 1:77223121-77223143 CTCAGAAGACAGAAAGATGTAGG - Intergenic
909939710 1:81596916-81596938 AACCAAAGACAGACAGATGGGGG - Intronic
910417258 1:87014025-87014047 CTCAGAAGACAGAAAGATGTGGG - Intronic
910625768 1:89304899-89304921 CAGCCAAGACAGAAAGATGGGGG - Intergenic
911466794 1:98264537-98264559 CAGCCTAGACATTAAGATGGAGG - Intergenic
912966519 1:114241870-114241892 GACCGTAGAAAGAAAGAAGGGGG - Intergenic
913484428 1:119320773-119320795 CACCCTAGACAGAAAGATTTGGG - Intergenic
915157513 1:153890577-153890599 AACCTAAGACAGAAAGCTGGTGG + Intronic
916802114 1:168225704-168225726 CTCCGGAGACACAAAGACGGGGG - Intergenic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
919788070 1:201272809-201272831 CACCTTAGCCAGGAAGTTGGTGG - Intergenic
921531162 1:216284725-216284747 CTCAGAAGACAGAAAGATGTGGG + Intronic
1063645368 10:7876602-7876624 CACCGTATACAGAATCACGGGGG + Intronic
1063958586 10:11287235-11287257 AACTGAAGATAGAAAGATGGTGG - Intronic
1064721525 10:18234462-18234484 CACAATAGCCAAAAAGATGGAGG + Intronic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1067321927 10:45229354-45229376 CTCAGAAGACAGAAAGATGAGGG + Intergenic
1067710780 10:48649512-48649534 CACAGTGGAGAGAAAGACGGTGG - Intronic
1068828142 10:61462794-61462816 CACTGCAGACACAATGATGGAGG + Intergenic
1070688010 10:78504217-78504239 CACCATAATCAGAAAGCTGGGGG - Intergenic
1071563790 10:86661456-86661478 CACGAGAGACAGAAAGGTGGTGG - Intronic
1071934265 10:90509394-90509416 CTCAGAAGACAGGAAGATGGGGG - Intergenic
1072207612 10:93218374-93218396 TAGCTTAGACAGACAGATGGTGG - Intergenic
1072425719 10:95328750-95328772 CACCTAAGAGAGAAAAATGGTGG - Intronic
1073864507 10:107786613-107786635 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1074657308 10:115606759-115606781 CACTGTAGAAATAAAAATGGTGG - Intronic
1079131295 11:17748401-17748423 CCACACAGACAGAAAGATGGAGG + Intronic
1083631666 11:64098474-64098496 CACTGGAGACAGAAGGCTGGGGG - Intronic
1084962840 11:72726368-72726390 CACCCAAGACAGAAACCTGGAGG + Intronic
1085756140 11:79202818-79202840 CACCCTAGACAGAAAGACCATGG + Intronic
1086669203 11:89526921-89526943 AACAGAAGACAGAAAGATGTGGG + Intergenic
1087571185 11:99929245-99929267 CTCAGAAGACAGAAAGATGGGGG - Intronic
1087938474 11:104063703-104063725 CACGGGAGAGAGAATGATGGGGG + Intronic
1088766210 11:112981831-112981853 CATCTTAGACATAGAGATGGAGG + Intronic
1091519580 12:1223537-1223559 CACTTTAGATAGCAAGATGGTGG + Intronic
1091811942 12:3406765-3406787 CTCAGAAGACAGAAAGATGTAGG - Intronic
1093038934 12:14357511-14357533 CACCTAAGAAAGAAAGATGATGG - Intergenic
1094421257 12:30273503-30273525 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1095883939 12:47169293-47169315 CACCGAAGATGGGAAGATGGAGG - Intronic
1095919297 12:47513496-47513518 CTCAGGAGACAGAAAGATGTGGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097727512 12:63091729-63091751 TACAATTGACAGAAAGATGGAGG + Intergenic
1101033934 12:100686278-100686300 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101193127 12:102355220-102355242 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101839286 12:108316378-108316400 CAACGTAGACAGAAAGAGAGGGG + Intronic
1104142607 12:126003304-126003326 CTCAGAAGACAGGAAGATGGGGG + Intergenic
1105947165 13:25200044-25200066 CACCATAAAAAGAAAGATGGTGG + Intergenic
1106472637 13:30071293-30071315 CCCCGTAGAGAGACAGAGGGAGG + Intergenic
1108100133 13:46945629-46945651 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1108154501 13:47571900-47571922 CTCAGTAGACAGGAAGATGTGGG + Intergenic
1109171824 13:59106896-59106918 CTCCGAAGACAGGAAGATGTGGG + Intergenic
1110515732 13:76410541-76410563 CAGTGTAGACAGATAGATGGTGG + Intergenic
1110897905 13:80779334-80779356 AGAGGTAGACAGAAAGATGGTGG + Intergenic
1112857342 13:103787479-103787501 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1114242085 14:20877429-20877451 CACAGGAGAGAGAGAGATGGCGG - Intergenic
1114248953 14:20941046-20941068 CACAGGAGAGAGAGAGATGGGGG - Intergenic
1116199421 14:41771780-41771802 CTCAGAAGACAGAAAGATGAGGG - Intronic
1116286984 14:42986485-42986507 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1117488117 14:56219271-56219293 CCCCGTACAGAGACAGATGGGGG + Intronic
1117742010 14:58828296-58828318 AAACGAAGCCAGAAAGATGGTGG + Intergenic
1120357965 14:83458538-83458560 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1120503765 14:85328327-85328349 CACTGTAGACAGACAGACTGGGG - Intergenic
1120808851 14:88782049-88782071 CTCCGAAGACAGGAAGATGTGGG + Intronic
1122018562 14:98817822-98817844 GAACGGAGACAGAAAGATGATGG + Intergenic
1129204749 15:74030259-74030281 CACAAAAGAGAGAAAGATGGTGG + Intronic
1130839410 15:87683687-87683709 CACCTTAGGCAGAAACACGGAGG - Intergenic
1134459594 16:14419915-14419937 CAGCGTGGACTGGAAGATGGCGG + Intergenic
1137758179 16:50919202-50919224 CACCCCAGACAGCAACATGGAGG + Intergenic
1140566250 16:76046286-76046308 CACTGGAGACAGAAAGAGTGAGG + Intergenic
1143130991 17:4676780-4676802 CACCCTAGACAGAAAAAATGAGG + Exonic
1146445737 17:32931566-32931588 AAACGAAGCCAGAAAGATGGTGG - Exonic
1146468450 17:33105678-33105700 CTCAGAAGACAGGAAGATGGGGG + Intronic
1148987130 17:51632748-51632770 CAGTGTGGAAAGAAAGATGGAGG - Intronic
1149516957 17:57288010-57288032 CACCCCAGACAGAGGGATGGAGG - Intronic
1154354895 18:13617073-13617095 CCCCTTAAAAAGAAAGATGGTGG + Intronic
1155298670 18:24408912-24408934 CATCATAGAGATAAAGATGGTGG + Intergenic
1157131763 18:45013856-45013878 CACAGCAGAAAGAAACATGGTGG - Intronic
1157990625 18:52491651-52491673 CAATGAAGACAGAAAAATGGAGG + Intronic
1158510277 18:58084446-58084468 CATTGTAGAAGGAAAGATGGGGG + Intronic
1158842675 18:61405199-61405221 CACCTAAGGCAGAAAGATGGTGG - Intronic
1160041861 18:75352797-75352819 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1160235907 18:77087144-77087166 CACCGCAAACGGAAAGAGGGAGG + Intronic
1160525123 18:79531381-79531403 TATCGTGGACATAAAGATGGCGG - Intergenic
1161865923 19:6832216-6832238 CTCTGTGGACAGAAAGAGGGAGG - Intronic
1162549676 19:11351542-11351564 CAGGGAAGACAGAAAGCTGGAGG + Intronic
1166322230 19:42025565-42025587 CATCCCAGACAGAAACATGGGGG + Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
926164904 2:10515623-10515645 TACCATAAACAGAATGATGGTGG - Intergenic
927639923 2:24839889-24839911 CACTGTAGCCAACAAGATGGAGG - Exonic
928278760 2:29925328-29925350 AACAGAAGACAGAAAGGTGGAGG + Intergenic
929211345 2:39360382-39360404 CTCAGAAGACAGAAAGATGTGGG - Intronic
935479156 2:103562924-103562946 CTCAGAAGACAGAAAGATGTGGG - Intergenic
935861092 2:107330454-107330476 CACCGAAGACCAACAGATGGGGG - Intergenic
936076405 2:109404469-109404491 GACAGGGGACAGAAAGATGGGGG + Intronic
936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG + Intronic
938042707 2:128089496-128089518 GAAAGTAGACAGAAAGATGTTGG + Intergenic
939153053 2:138495460-138495482 CACCATAGCCAGAAATATGGGGG + Intergenic
939456324 2:142441564-142441586 CACGGGAGACAGAGCGATGGGGG - Intergenic
942234225 2:173888824-173888846 CTCAGAAGACAGAAAGATGTGGG + Intergenic
943369870 2:187002914-187002936 CACCATAGGCAGCAAGCTGGTGG - Intergenic
945084821 2:206120358-206120380 CTCAGAAGACAGAAAGATGAGGG + Intronic
1174560771 20:51429215-51429237 CACCGTAGCCACCAAGATGTGGG - Intronic
1178261965 21:31107850-31107872 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1179448795 21:41453386-41453408 AACCTCAGACAGAGAGATGGTGG + Intronic
1179727181 21:43347129-43347151 CACCCAAAACAGACAGATGGGGG - Intergenic
1180698263 22:17768081-17768103 CTCCATAGACAGAAAGATTAGGG + Intronic
1183151315 22:36039930-36039952 CTCAGAAGACAGAAAGATGTGGG - Intergenic
949928131 3:9058066-9058088 CACCTGAGACAGCAAGATGAGGG + Intronic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
952808087 3:37376061-37376083 CTCAGAAGACAGAAAGATGAGGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952849515 3:37716016-37716038 CCCAGGAGACAGAAAGAAGGTGG + Intronic
954484715 3:50837082-50837104 CTCAGAAGACAGAAAGATGTGGG - Intronic
958057076 3:88427045-88427067 CTCAGAAGACAGAAAGATGTGGG + Intergenic
960056466 3:113279575-113279597 CACCACAGACAGCAACATGGAGG - Intronic
960794202 3:121467393-121467415 CACCGTAGACAGAAAGATGGAGG + Intronic
963926933 3:150960745-150960767 CACAGGAGACAGGCAGATGGAGG + Intronic
964897119 3:161612078-161612100 CTCAGAAGACAGAAAGATGTGGG + Intergenic
964919949 3:161884436-161884458 CACAGAAGACAGGAAGATGAGGG + Intergenic
965394943 3:168152021-168152043 CTCAGAAGACAGAAAGATGAGGG + Intergenic
965731918 3:171780691-171780713 CACTGGATACAGAAACATGGAGG + Intronic
969585485 4:8088963-8088985 CCTCGTAGACAGGAAGATGCTGG + Intronic
970150371 4:13082879-13082901 CACAGAAGACAGCAAGATGTGGG - Intergenic
971119547 4:23688792-23688814 CTCCGAAGACAGGAAGATGTGGG + Intergenic
971742968 4:30543499-30543521 CACCTTATACAGAAAGCTGTTGG + Intergenic
975204148 4:71624764-71624786 CTCAGAAGACAGAAAGATGTGGG - Intergenic
975307200 4:72864029-72864051 CATCCTAGACAGAAAGAGGCAGG + Intergenic
979282121 4:118879982-118880004 CACCGTTGAGAGAAATAAGGAGG - Intronic
979426891 4:120578833-120578855 TACAGTAGACAGTAAGATGCGGG - Intergenic
981453083 4:144921324-144921346 CACAGAAGACAGGAAGATGAGGG - Intergenic
981503198 4:145474253-145474275 CACAGAAGACAGGAAGATGTGGG - Intergenic
981877963 4:149571445-149571467 CACAGTAGAGAGTAAAATGGTGG + Intergenic
982478835 4:155884210-155884232 AGCTGTAAACAGAAAGATGGTGG + Intronic
983766270 4:171488779-171488801 CTCAGAAGACAGAAAGATGTGGG + Intergenic
983847319 4:172536360-172536382 CTCAGAAGACAGAAAGATGTGGG + Intronic
986507873 5:8471441-8471463 CTCAGAAGACAGAAAGATGTGGG - Intergenic
986601467 5:9477409-9477431 CTCAGAAGACAGGAAGATGGGGG + Intronic
987115182 5:14720897-14720919 CACGTCAGAGAGAAAGATGGCGG + Intronic
987453438 5:18114443-18114465 AACCGTAGACAGAAAAATGGTGG + Intergenic
988329611 5:29818430-29818452 TTCCGTAGCCAGAGAGATGGAGG - Intergenic
989708994 5:44373684-44373706 CATCATAAACAGAAAGCTGGTGG - Intronic
990794430 5:59524227-59524249 CTCAGAAGACAGAAAGATGTGGG + Intronic
991914680 5:71594217-71594239 CCCCTTAGACATTAAGATGGTGG + Intronic
991941260 5:71854420-71854442 CTCCGAAGACAGGAAGATGTGGG - Intergenic
992555325 5:77897440-77897462 CATCCTAGCCAGAAATATGGTGG + Intergenic
993781051 5:92065791-92065813 CTCAGAAGACAGAAAGATGAGGG + Intergenic
994292849 5:98050570-98050592 CATAGCAGACAGCAAGATGGGGG + Intergenic
995486717 5:112647079-112647101 CACCGAAGCCAAAAAAATGGTGG + Intergenic
998569409 5:143244064-143244086 CACCGTGGACAGATTGGTGGGGG - Intergenic
999758004 5:154679663-154679685 CAGAGAAGACAGACAGATGGTGG - Intergenic
1000077219 5:157802263-157802285 AAATGTAGACAGTAAGATGGGGG - Intronic
1000784564 5:165527893-165527915 CTCCGAAGACAGGAAGATGTGGG + Intergenic
1002794146 6:457202-457224 CTCAGAAGACAGGAAGATGGGGG - Intergenic
1003033254 6:2620899-2620921 CACTGCAGACTTAAAGATGGGGG + Intergenic
1005388902 6:25313488-25313510 CATAGTGGGCAGAAAGATGGGGG + Intronic
1012029125 6:94036349-94036371 ATCAGAAGACAGAAAGATGGAGG + Intergenic
1012097273 6:94978030-94978052 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1012514118 6:100038887-100038909 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1012768220 6:103396634-103396656 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1013602545 6:111718593-111718615 CACGGTAGGCACAAGGATGGGGG + Intronic
1014525981 6:122502200-122502222 CTCAGAAGACAGAAAGATGAGGG - Intronic
1015494330 6:133865068-133865090 CAGTGTAGTCAGCAAGATGGAGG + Intergenic
1016780155 6:147948979-147949001 AACAGGAGACAGAAAGATGGAGG + Intergenic
1018372907 6:163185172-163185194 CACCACAGAGAGAAAGATGGAGG + Intronic
1020775557 7:12450127-12450149 CTCAGAAGACAGGAAGATGGGGG + Intergenic
1028084141 7:86616238-86616260 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1031360761 7:120845791-120845813 CTCAGAAGACAGAAAGATGAGGG - Intronic
1031637468 7:124119251-124119273 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1031769864 7:125829840-125829862 CTCCAAAGACAGAAAGATGTGGG - Intergenic
1032478833 7:132230380-132230402 TAGCCTAGACAGAAAGATTGAGG - Intronic
1034510829 7:151533262-151533284 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1037065704 8:14574415-14574437 CAGCTTACACAGAAAGCTGGGGG - Intronic
1038880547 8:31606140-31606162 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1038896918 8:31794232-31794254 TACTGTAGAGAGAAAGAAGGAGG - Intronic
1039156854 8:34569728-34569750 CACCGTAAACAGATAGCTGGAGG + Intergenic
1042996523 8:74705626-74705648 GACCTTAGGCAGAAAGAAGGGGG + Intronic
1044778885 8:95723080-95723102 CAGCTTAGACAGAAAGCAGGAGG - Intergenic
1046318519 8:112538873-112538895 CACCTAAGGCAGGAAGATGGGGG + Intronic
1047115876 8:121841504-121841526 CTCAGAAGACAGAAAGAGGGGGG + Intergenic
1052526776 9:29628959-29628981 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1054875925 9:70096430-70096452 CACTTCAGACAGAAAGAGGGAGG + Intronic
1056086954 9:83160222-83160244 CTCAGAAGACAGAAAAATGGGGG + Intergenic
1058904426 9:109470260-109470282 CACTGTAGACACACAGATGCTGG + Intronic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1060553256 9:124495579-124495601 CACCGTAGACACCCAGGTGGTGG + Intronic
1186017718 X:5216761-5216783 GATAGTAGATAGAAAGATGGTGG + Intergenic
1187107573 X:16260088-16260110 CACCTTAAACAGAAACATGCAGG + Intergenic
1188457048 X:30379155-30379177 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1189788625 X:44582651-44582673 CACAGAAGACAGGAAGATGTGGG + Intergenic
1191211544 X:57890134-57890156 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1193008045 X:76643280-76643302 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1193678307 X:84484055-84484077 CTCAGAAGACAGAAAGATGTAGG - Intronic
1194054770 X:89117913-89117935 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1194555998 X:95360625-95360647 CACAGTAGAAAGAAAGCTGAGGG - Intergenic
1194817966 X:98468346-98468368 CTCAGTAGACAAAAAGATGAAGG - Intergenic
1194850127 X:98859214-98859236 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1196881162 X:120199266-120199288 TCCAGTAGACAGAAAGAGGGGGG - Intergenic
1197061400 X:122185465-122185487 CTCAGCAGACAGAAAGATGTGGG - Intergenic
1198959140 X:142165626-142165648 CCCCATAGACAAAAATATGGGGG + Intergenic
1199117489 X:144009460-144009482 CTCAGTAGATAGAAAGATGTGGG - Intergenic
1199155125 X:144537557-144537579 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1199357076 X:146875099-146875121 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic