ID: 960794652

View in Genome Browser
Species Human (GRCh38)
Location 3:121472815-121472837
Sequence ACATTTTTACAGATGTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 937
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 861}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960794652_960794661 29 Left 960794652 3:121472815-121472837 CCCTGAAACATCTGTAAAAATGT 0: 1
1: 0
2: 4
3: 71
4: 861
Right 960794661 3:121472867-121472889 ACTAATGTGTACAGTTTCCATGG 0: 1
1: 0
2: 1
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960794652 Original CRISPR ACATTTTTACAGATGTTTCA GGG (reversed) Intronic
900968387 1:5975510-5975532 AGATTTTTCCAGAGGTTTTAAGG + Intronic
901346402 1:8547613-8547635 ACATTTTTTCATATGTTTGAAGG - Intronic
901966171 1:12868618-12868640 ACATTTTTTCATATGTTTGTTGG + Intronic
901981560 1:13038871-13038893 ACATTTTTTCATATGTTTGTTGG + Intronic
902000522 1:13190042-13190064 ACATTTTTTCATATGTTTGTTGG - Intergenic
902019766 1:13335809-13335831 ACATTTTTTCATATGTTTGTTGG - Intergenic
904403465 1:30271970-30271992 TAATTTTTTCAGATGGTTCAAGG - Intergenic
904889620 1:33769968-33769990 ATATTTTTATAGATGTTTATAGG + Intronic
904980800 1:34499425-34499447 GCAATATTACAGATTTTTCATGG - Intergenic
906079135 1:43072166-43072188 ACATTTTTGCACATGTTTCTAGG - Intergenic
906727024 1:48051593-48051615 ACATCATTACAGATGTCTCTTGG - Intergenic
908567007 1:65367603-65367625 AGATTATCACAGATCTTTCAAGG - Intronic
908781809 1:67697871-67697893 AAATGTTGACAGATGTTGCATGG + Intergenic
909124509 1:71649083-71649105 ACATTTTTACACATGCTTCTTGG - Intronic
909234815 1:73139251-73139273 ACATTTTTTCATATGTTTGTTGG + Intergenic
909308860 1:74119860-74119882 ATATTTCTTCAGATGTTTCTTGG + Intronic
909434151 1:75620590-75620612 GCATTTTTTCATATGTTTCCTGG + Intergenic
909503830 1:76364711-76364733 GCATTTTTTCATATGTTTCTTGG - Intronic
909679161 1:78272039-78272061 ACATTTTTTCATATGTTTGTTGG + Intergenic
910752075 1:90642334-90642356 ACATTTTTTGAGATTTTCCATGG - Intergenic
910846355 1:91608187-91608209 ACATTTTTTCATATGTTTGTTGG + Intergenic
910897490 1:92083981-92084003 ACATATTTCCAGTTGTTTCCTGG - Intronic
911318740 1:96386676-96386698 CTATTTTTAGAGAAGTTTCAGGG - Intergenic
911398058 1:97336901-97336923 ACAATGTTAAAGAGGTTTCAAGG + Intronic
911456907 1:98136512-98136534 CAGTGTTTACAGATGTTTCATGG + Intergenic
911479203 1:98415950-98415972 ATATTTATACAGATTTTTAATGG - Intergenic
911526946 1:98999512-98999534 ACATTTTGACTGAGGTTACATGG + Intronic
911846772 1:102762892-102762914 ACATTTTTACATGTTTCTCAGGG - Intergenic
911945023 1:104096192-104096214 ACATATTTAGAGATTTTTCAGGG + Intergenic
912022132 1:105118595-105118617 ACATTTTTTCATATGTTTGTTGG - Intergenic
912035287 1:105304840-105304862 AGATTTTTACATCTGTTGCAGGG - Intergenic
912057063 1:105615600-105615622 GCATTTTTCCATATGTTTCTTGG - Intergenic
912066088 1:105745300-105745322 ACATTTTTTCATATGTTTGTTGG - Intergenic
912084748 1:105985254-105985276 ACATTTTTTCATATGTTTGTTGG - Intergenic
912237766 1:107870397-107870419 ACATTTTTTCATATGTTTGTTGG + Intronic
912283906 1:108347831-108347853 GCATTTTTTCATATGTTTCCTGG + Intergenic
912684377 1:111750322-111750344 CCATTTTTACATGTGTCTCATGG - Intronic
913573799 1:120148662-120148684 ACATTTTTTCATATGCTTCTTGG + Intergenic
914207873 1:145550111-145550133 GCATTTTTTCATATGTTTCTTGG + Intergenic
914295062 1:146313464-146313486 ACATTTTTTCATATGCTTCTTGG + Intergenic
914556103 1:148764247-148764269 ACATTTTTTCATATGCTTCTTGG + Intergenic
914616731 1:149365984-149366006 ACATTTTTTCATATGCTTCTTGG - Intergenic
916089630 1:161297723-161297745 ACAATTTCTCAGATGTTTTAAGG + Intergenic
916238155 1:162611521-162611543 ACATTTTAATAGATGTGTCAGGG - Intergenic
916457077 1:164982022-164982044 GCATTTTTATAGATGTCACAGGG + Intergenic
916599483 1:166277718-166277740 ACTTTTTTTCATATGTTTCTTGG + Intergenic
916970943 1:170015168-170015190 ACATTTTATCATATGTTACAAGG + Intronic
917030732 1:170687781-170687803 AGATGTTTACAAATATTTCAAGG - Intronic
917053759 1:170955580-170955602 ACATTTTTTCATATGTTTGTTGG + Intronic
917079965 1:171247579-171247601 ACAGTTTTTCAGCTGTCTCATGG + Intergenic
917101609 1:171451905-171451927 ACATTTTTTCATATGTTTGTTGG + Intergenic
917168805 1:172145522-172145544 ACATTTCTCCAGACTTTTCATGG - Intronic
917421920 1:174872938-174872960 ACATTCTTCCAGATGTTCCTAGG - Intronic
917430973 1:174968568-174968590 ACTTTGTTTCAGATTTTTCAAGG + Intronic
917504132 1:175612994-175613016 ACATTTTTTAAGGTCTTTCAAGG - Intronic
917906844 1:179593066-179593088 ACATTTTTACATATGATTTCAGG + Intronic
918667408 1:187168737-187168759 ACATTTTTAGAGCTTCTTCAGGG - Intergenic
919072990 1:192779416-192779438 GCATTTTTTCATATGTTTCTTGG + Intergenic
919086253 1:192924183-192924205 ACATTTTTTCATATGTTTATTGG - Intergenic
919137791 1:193532397-193532419 ACATTTTTTCATATGCTTCTTGG - Intergenic
920042068 1:203105177-203105199 ACATTTTTTCAGATGTTTACTGG + Intronic
920596848 1:207280302-207280324 ACATTTTTTCATATGCTTCCTGG - Intergenic
921437485 1:215142330-215142352 AAATATTTACAGAGTTTTCATGG + Intronic
921749976 1:218780920-218780942 ATATTTTGAAAGAAGTTTCATGG + Intergenic
922278910 1:224103924-224103946 ACATTTTTTCATATGTTTCTTGG - Intergenic
923080620 1:230650464-230650486 ACATTTTTTCATATGTTTGTTGG + Intronic
923270434 1:232350532-232350554 ACATTTTTACATATGGTGTATGG - Intergenic
923301718 1:232647390-232647412 GCATGTTTACAGAAATTTCAGGG - Intergenic
924044794 1:240016962-240016984 ACATTTTTAAAAATTTTTTATGG + Intronic
924302548 1:242654161-242654183 GCATTTTTTCATATGTTTGATGG - Intergenic
924631715 1:245747078-245747100 ACATTTTTTCATATGTTTGTTGG - Intergenic
924686639 1:246299045-246299067 ACATTTTTATATATGTTGCCAGG - Intronic
1062964596 10:1597497-1597519 GCATTTTTTCATATGTTTCTTGG - Intronic
1063498415 10:6531098-6531120 GCATTTTTAAAGAGGTCTCAGGG - Intronic
1063758636 10:9045554-9045576 ACATTTTTTCATATGTTTGTTGG + Intergenic
1063768275 10:9168288-9168310 AGATTTTTACTGATAGTTCAAGG + Intergenic
1064241843 10:13637437-13637459 ACCTTTTTTCATATGTTTAATGG + Intronic
1064476759 10:15698672-15698694 ACATTTTTACCTATGCTTCTTGG + Intronic
1064511131 10:16093120-16093142 AAATTTTTGCTAATGTTTCATGG - Intergenic
1064649906 10:17498829-17498851 ACATTTTAGCAGGTATTTCATGG - Intergenic
1065158840 10:22897910-22897932 ACATTTTTTCATATGTTTGTTGG - Intergenic
1065333422 10:24628439-24628461 ACATGTTTACAGATTATTTATGG + Intronic
1065987051 10:30965166-30965188 ACATTTTTTCATATGTTTGTTGG - Intronic
1066029242 10:31401257-31401279 ACAGTTTTACATATGTTAAATGG + Intronic
1066165053 10:32777953-32777975 GCATTTTTTCATATGTTTCTTGG + Intronic
1066348658 10:34615821-34615843 ACATATTTTCATATGTTTCTTGG - Intronic
1066763365 10:38779832-38779854 ACATTTTTACATATATTTGTTGG - Intergenic
1067355140 10:45517217-45517239 ACAATTCTACCGATGTTTTAGGG + Intronic
1068390573 10:56391129-56391151 ACATTTTTTCATATGTTTGTTGG - Intergenic
1068654162 10:59557488-59557510 ACATTTTCCCAAATGTTTAAAGG + Intergenic
1068895302 10:62192379-62192401 ACATCTTATCAGATTTTTCAAGG - Intronic
1068977196 10:63022730-63022752 ACATTTTTATGGTTGTTTCTTGG - Intergenic
1069226165 10:65947622-65947644 ACATTTTTACACATGGACCAGGG - Intronic
1069321635 10:67178833-67178855 ATATTCTTAAAGATTTTTCAAGG - Intronic
1070184480 10:74047712-74047734 ATATATTTAAAGATTTTTCAGGG + Intronic
1070872673 10:79771171-79771193 ACATCTTTTCATATGTTTAATGG - Intergenic
1071193206 10:83126623-83126645 ACATTTTTTCATATGTTTGTTGG - Intergenic
1071222269 10:83482746-83482768 ACATCTTTTCATATGTTTCTTGG + Intergenic
1071230072 10:83576272-83576294 GCATTTTTTCATATGTTTCTTGG + Intergenic
1071552409 10:86576977-86576999 ACATTTTTTCACAGGTTTAAGGG - Intergenic
1071639596 10:87293320-87293342 ACATCTTTTCATATGTTTAATGG - Intergenic
1071655639 10:87444632-87444654 ACATCTTTTCATATGTTTAATGG + Intergenic
1071911050 10:90234208-90234230 GCATTTTTTCATATGTTTGATGG - Intergenic
1072254315 10:93606507-93606529 ACATTTTTTCATATGTTTGTTGG - Intergenic
1072367807 10:94732201-94732223 ACATTTTTTCATATGTTTATTGG - Intronic
1072376585 10:94822839-94822861 ACATTTTTTCATATGTTTGTTGG + Intronic
1072773190 10:98161287-98161309 ACATCTTTTCATATGTTTAAGGG + Intronic
1073952220 10:108822881-108822903 CCCTTTTTACAGATCTTTAAAGG - Intergenic
1075135465 10:119781459-119781481 ACATCTTTTCACATGTTTAAGGG + Intronic
1075423260 10:122321618-122321640 ACATTTTTGCATATGTTTGTTGG + Intronic
1076249414 10:128973482-128973504 ACATTTGTTGAAATGTTTCATGG + Intergenic
1076457493 10:130610696-130610718 TTATTTTTAAAGATGTTTCTGGG - Intergenic
1076579584 10:131498159-131498181 TCATTTTTTCAGATCTTGCAAGG - Intergenic
1078991116 11:16647657-16647679 ACAGTTTTCCACCTGTTTCATGG - Intronic
1079215948 11:18511980-18512002 ACATTCTTACAGTTTTGTCAAGG + Intronic
1079762771 11:24351953-24351975 ACATTTTTTCATATGTTTGTTGG + Intergenic
1079905875 11:26246498-26246520 ACATCTTATCATATGTTTCAAGG + Intergenic
1079940719 11:26677160-26677182 AAATTTTTCCAAATGTTTGAAGG + Intronic
1080585452 11:33677594-33677616 GCATTTTTTCATATGTTTGATGG + Intergenic
1080672086 11:34389773-34389795 ACATTTTTTCATATGTTTGTTGG + Intergenic
1080817235 11:35770654-35770676 ACATTTTTCCATATGTTTGTTGG + Intronic
1081514798 11:43817104-43817126 ACATTTTTTCATATGTTTGTTGG + Intronic
1081945575 11:46990405-46990427 GCATTTTTTCATATGTTTCTTGG + Intronic
1082213916 11:49543458-49543480 AGATTTTTAAAAATTTTTCAGGG - Intergenic
1082935140 11:58647994-58648016 ACAATTTTTCAGCTGTCTCATGG + Intronic
1084754489 11:71227131-71227153 ACATTTTTAAACATTTTTTAGGG - Intronic
1084908344 11:72366633-72366655 ACATTTTTTCATATGTTTGTTGG - Intronic
1085242451 11:75069871-75069893 ACATTTAGACATAAGTTTCAAGG + Intergenic
1085903676 11:80733565-80733587 ACATTTTTAAACAGATTTCATGG + Intergenic
1085967898 11:81551099-81551121 ACATTTTTTCACATGTTTGTTGG - Intergenic
1086104711 11:83134728-83134750 AAATTTTTTCAGAAGTCTCATGG - Intergenic
1086138402 11:83466457-83466479 ACATTATTGAAGATGTTTTAAGG + Intronic
1086227549 11:84530505-84530527 ACATTTTTTCATATGCTTCTTGG - Intronic
1086283485 11:85218445-85218467 GCATTTTTTCAGATGTTTTTTGG - Intronic
1086530961 11:87784618-87784640 ACATTTTTTCATATGTTTGTTGG - Intergenic
1086635687 11:89081032-89081054 AGATTTTTAAAAATTTTTCAGGG + Intergenic
1086743023 11:90391463-90391485 TCATTTTTTCAGCTGTGTCATGG - Intergenic
1086789377 11:91016434-91016456 ACATTTTTTCATATGTTTGTTGG + Intergenic
1086800492 11:91168843-91168865 ACATTGTTGCAGATCTTTCCAGG + Intergenic
1086864073 11:91959180-91959202 ACAGTTTTGCAGTTGTCTCATGG - Intergenic
1087302548 11:96452728-96452750 ACATTATTAAAGATCTCTCAAGG + Intronic
1087390753 11:97529933-97529955 AAATTTTTACATCTGTTTCAAGG - Intergenic
1087435460 11:98111908-98111930 ACTTTTTTTCATATGTTTCTTGG - Intergenic
1087437124 11:98135584-98135606 ACATATTTACAAAGATTTCAAGG - Intergenic
1087703135 11:101459601-101459623 ACATTTTTAGAGAAGCTACAGGG + Intronic
1088079707 11:105896188-105896210 ACATTTTTTCACATGTTTGCTGG + Intronic
1088552970 11:111033174-111033196 ACATTTTTTCACATGTTTGTTGG - Intergenic
1088569641 11:111210561-111210583 ACATTTAAACAGTTATTTCATGG - Intergenic
1088826608 11:113500458-113500480 ACATTCTTATGGATGTTTCCTGG - Intergenic
1089300663 11:117496891-117496913 ACGTTTGTACAAAAGTTTCAAGG - Intronic
1089883023 11:121793165-121793187 ACAATTTTACACATTTTTTAGGG + Intergenic
1090524600 11:127519075-127519097 ACATTTCTCCAGTTTTTTCATGG + Intergenic
1090531282 11:127593401-127593423 ACATGTGTTCAAATGTTTCATGG + Intergenic
1090682505 11:129076907-129076929 ACAGTTTTTCAGCTGTCTCATGG - Intronic
1090895224 11:130965996-130966018 ACATTTTTTCATATGTTTGTTGG + Intergenic
1090969511 11:131628231-131628253 ACTTATTCACAGATCTTTCACGG + Intronic
1092047073 12:5439245-5439267 GCATTTTTACAGCTATTACATGG + Intronic
1092102355 12:5895514-5895536 ACATTTTTTCATATGTTTGTTGG - Intronic
1092108551 12:5942840-5942862 ACATTTTTTCATATGTTTGTTGG - Intronic
1092303412 12:7274515-7274537 GCATTTTTTCATATGTTTCTTGG + Intergenic
1092805986 12:12223102-12223124 ACAATTATAAAGATGTTCCAAGG + Intronic
1092830496 12:12439953-12439975 ATATTATTCCAGATGTTTCCTGG + Intronic
1093067224 12:14670796-14670818 AATTTTTTTCAGAGGTTTCATGG - Intronic
1093219088 12:16397663-16397685 GCATTTTTTCAGATGTTTGTTGG - Intronic
1093497492 12:19775168-19775190 GCATTTTTACATATGTTTGTTGG + Intergenic
1093632741 12:21429706-21429728 ACATTAGTACTTATGTTTCATGG - Intergenic
1093810537 12:23487037-23487059 ACATCTTTTCAGATGTTTGCTGG + Intergenic
1094254805 12:28411204-28411226 ACATTGTTACAGATTTTTTAAGG + Intronic
1094414049 12:30199771-30199793 ACATTTTTACAGAAGTTTTGTGG - Intergenic
1095323695 12:40861429-40861451 ACATTTTTAAAGTTTTTTAATGG + Intronic
1095787523 12:46126330-46126352 ACATTTTTACAGCTGTCTTATGG - Intergenic
1095932517 12:47642085-47642107 GCATTTTTTCATATGTTTCTTGG - Intergenic
1095936986 12:47695024-47695046 ACATTTTTGTACATGTTTCTTGG - Intronic
1096325261 12:50654754-50654776 ACATTTTTACAGAGGACTTAAGG - Intronic
1096346793 12:50855436-50855458 GCATTTTTTCATATGTTTCTTGG - Intronic
1096858372 12:54503060-54503082 ACATTTCTCCAGTTGTCTCAAGG + Intronic
1096918815 12:55061779-55061801 ACGTTTTTACTAATTTTTCAAGG + Intergenic
1096964026 12:55610555-55610577 AGATTTTTACAGATTTCTCCAGG + Intergenic
1097257305 12:57688687-57688709 GCATTTTTTCATATGTTTCTTGG - Intergenic
1097792221 12:63827262-63827284 ACATGTTTACATATGTTTATTGG - Intergenic
1098386100 12:69920461-69920483 ATATTCTTACAGGTGGTTCATGG - Intronic
1098565691 12:71933083-71933105 CCATTTTTCCAGGTGTTTTAAGG + Intergenic
1098583286 12:72127075-72127097 ACATTTTTTCATATGTTTGTTGG - Intronic
1098689240 12:73465744-73465766 GCATTTTTTCAGATGTTTGTTGG + Intergenic
1098738376 12:74137324-74137346 ACATTTTTACATATGTCTGTTGG + Intergenic
1098741070 12:74174220-74174242 AAATGTTTTCACATGTTTCAAGG - Intergenic
1098787051 12:74772906-74772928 ACATTGTTTCAGATGTTTCTTGG + Intergenic
1099201543 12:79683673-79683695 AAACTTTTACATATCTTTCATGG - Intronic
1099840317 12:87956273-87956295 ACATTTTTTCATATGTTTTTTGG + Intergenic
1100054824 12:90496436-90496458 ACATTTTTCTATATGTTTCTTGG + Intergenic
1100091694 12:90980134-90980156 AAATTGAGACAGATGTTTCATGG + Intronic
1100511333 12:95277369-95277391 AAGTTTTTACAGAATTTTCACGG - Intronic
1100522103 12:95385089-95385111 ACATTTTTATAGAACTTACAAGG - Intergenic
1100629878 12:96377477-96377499 ACATTTTTTCATATGTTTAAGGG - Intronic
1100648197 12:96553610-96553632 ATATTTTTCCAGATTTTTTAAGG - Intronic
1100845965 12:98658268-98658290 ACATATTTCAAGATGTTTTATGG + Intronic
1101640471 12:106582991-106583013 AAATGTTTGCGGATGTTTCATGG - Intronic
1102301042 12:111771674-111771696 ACATTCTTACACATTTTTTATGG - Intronic
1102698767 12:114820795-114820817 ACAATTTTACACATGTTAAATGG + Intergenic
1103031612 12:117618924-117618946 ATATTTTTAAAAATGTTTGAAGG - Intronic
1103316837 12:120062948-120062970 AGATTTTTTCACAAGTTTCAGGG + Intronic
1104231675 12:126891030-126891052 ACATTATCACAAATGTTACAGGG + Intergenic
1104534249 12:129603549-129603571 ACTTTTTTTCATATGTTTCTTGG - Intronic
1105002550 12:132700440-132700462 ACATTTTTTCATATGTTTCTTGG + Intronic
1105886232 13:24644531-24644553 CCATTTTTACAGTTATTTCTTGG - Intergenic
1106141153 13:27013185-27013207 ACAGTTTTGCACATGTTACATGG + Intergenic
1106377847 13:29206171-29206193 ACATTTTTGCATATGTTTGTTGG + Intronic
1106747879 13:32722663-32722685 AAATTAATACAGATGTTTAAAGG + Intronic
1106894546 13:34284990-34285012 ACATTTTTTCATATGTTTGTTGG - Intergenic
1107293290 13:38881708-38881730 ACATTGTTACAGATGGTGAAGGG + Exonic
1107640329 13:42436064-42436086 ACATCTTTTCATATGTTTCTTGG + Intergenic
1107768537 13:43764239-43764261 ATGTTTTTGTAGATGTTTCAGGG - Intronic
1108023918 13:46158641-46158663 ATATTTTTGCAGATTTTCCATGG - Exonic
1108749039 13:53427534-53427556 ACATTTTTTCATATGTTTATTGG + Intergenic
1108893202 13:55289443-55289465 TCATTTTAACAGATCTTTAAAGG - Intergenic
1108968725 13:56344367-56344389 ACATTTTTTCATATGTTTGTTGG - Intergenic
1109013635 13:56980783-56980805 ATATTTTTAGGGATGTTTAATGG + Intergenic
1109113842 13:58356209-58356231 ACTTTTTTTCAGATGTTTGTTGG - Intergenic
1109166029 13:59036647-59036669 GCATTTTTTCATATGTTTCTTGG - Intergenic
1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG + Intergenic
1109500221 13:63226358-63226380 AAATTTTGACATATATTTCAAGG - Intergenic
1109629024 13:65019421-65019443 ACATTTTTTCATATGTTTGTTGG - Intergenic
1109824626 13:67702026-67702048 GCATTTTTCCATATGTTTTACGG - Intergenic
1109924862 13:69123521-69123543 GCATTTTTTCATATGTTTCTTGG - Intergenic
1110221114 13:73074975-73074997 CAGTTTTTACAGTTGTTTCATGG + Intronic
1110470082 13:75849807-75849829 ACATTTTAAAAGATGTATCTTGG + Intronic
1110499275 13:76207759-76207781 ACATTTTTTCACATGTCTCTTGG - Intergenic
1110594636 13:77306682-77306704 ACAGTTTTACAATTGCTTCAAGG - Intronic
1110793223 13:79608044-79608066 ACATTTTTTCATATGTTTGTTGG + Intergenic
1110881940 13:80582686-80582708 GCATTTTTTCATATGTTTCTTGG - Intergenic
1111232902 13:85367252-85367274 ACATTTTTAAACATGTATAATGG + Intergenic
1111348876 13:86999909-86999931 ACATTTTTTCATATGTTTGTTGG - Intergenic
1111589249 13:90322659-90322681 ACATTTTTATAGCTGTCTCCAGG + Intergenic
1111689491 13:91544471-91544493 ACAATTTTATAAATGTTTCATGG + Intronic
1112082751 13:95992656-95992678 GCATTTTTTCATATGTTTCTTGG - Intronic
1112279818 13:98053008-98053030 ACATTTTTTCATATGTTTCAGGG + Intergenic
1112831578 13:103459096-103459118 ACATTTTTTCATATGTTTGTTGG + Intergenic
1112852348 13:103722090-103722112 ACAATTTTCCAATTGTTTCAAGG + Intergenic
1113088101 13:106588746-106588768 GCATTTTTTCATATGTTTAAGGG + Intergenic
1113166324 13:107447581-107447603 TCCTTTTTACAGCTCTTTCAGGG + Intronic
1113196863 13:107818354-107818376 ACATGTTTACAGGAGTTTCTGGG + Intronic
1113287071 13:108861935-108861957 ACAATTTTACAGATTCTTTAGGG + Intronic
1113636429 13:111921929-111921951 ACAGTTTTACAGAAGTATTAGGG - Intergenic
1114132638 14:19810220-19810242 ACATTTTTTCATATGCTTCTTGG - Intronic
1114385455 14:22249682-22249704 AGATTTTTCCATGTGTTTCATGG + Intergenic
1114760599 14:25309539-25309561 ACATTTTTTCATATGTTTATTGG - Intergenic
1115228088 14:31126134-31126156 ATATTTTCACATATGTTGCATGG - Intronic
1115303193 14:31907556-31907578 ACATTTTTTCATATGTTTGTTGG + Intergenic
1115828805 14:37310857-37310879 ATATTTTTTCAGAGGTTTGAGGG + Intronic
1115937337 14:38567764-38567786 GCATTTTTAAAAATGTTTCTTGG - Intergenic
1116117798 14:40679322-40679344 ACATTTTTTCATATGTTTCTTGG + Intergenic
1116148618 14:41107805-41107827 ACATTTTTCCATATGTTTATTGG - Intergenic
1116380899 14:44266644-44266666 GCATTTTTACATATGTTTGTTGG - Intergenic
1116832192 14:49732053-49732075 AACTTTTTACTGTTGTTTCATGG - Intronic
1117022536 14:51586344-51586366 ACATTTTTTCATATGTTTGTTGG + Intronic
1117295450 14:54374975-54374997 ATATTTTAAAAAATGTTTCAAGG - Intergenic
1117333353 14:54735943-54735965 GCATTTTTAAACATTTTTCAGGG - Intronic
1117640572 14:57794424-57794446 ACATTTTTTCATATGTTTGTTGG - Intronic
1117646162 14:57855419-57855441 GCATTTTTTCATATGTTTCTTGG - Intronic
1117650609 14:57900899-57900921 ACATTTTTTCATATGTTTGTTGG - Intronic
1118539740 14:66809117-66809139 ACATTTTCAGATTTGTTTCAGGG + Intronic
1118548485 14:66921357-66921379 ACATTTTTTCATATGTTTGTTGG + Intronic
1119169568 14:72524047-72524069 ACTTTTTCAAAGATTTTTCAGGG - Intronic
1120776327 14:88441609-88441631 ACATTTTTTCATATGTTTATTGG + Intronic
1120817559 14:88879499-88879521 CCTTTTTTACAAATGTGTCATGG + Intronic
1120966592 14:90173094-90173116 ACATCTTTTCATAGGTTTCACGG - Intronic
1121209431 14:92196725-92196747 GCATTTTTTCATATGTTTCTTGG + Intergenic
1121230445 14:92353822-92353844 ACAGGTTTACAGCTGCTTCAGGG - Intronic
1121471654 14:94160009-94160031 GCATTTTTTCATATGTTTCTTGG + Intronic
1121725945 14:96149758-96149780 ACAGTTTTTCACCTGTTTCATGG + Intergenic
1123928873 15:25147736-25147758 AAATTTTTACAAATATTTAAGGG + Intergenic
1124234175 15:27972615-27972637 GCATTTTTTCATATGTTTCTTGG + Intronic
1124387151 15:29219192-29219214 GCATTTTTTCATATGTTTCTTGG - Intronic
1124835227 15:33190481-33190503 ATATTTTTCCTTATGTTTCACGG + Intronic
1125023717 15:35009767-35009789 ACACTTTTACATATTTTTCAGGG + Intergenic
1125213551 15:37242431-37242453 ACATGTTTTCATATGTTTTATGG - Intergenic
1125238589 15:37547140-37547162 GCATTTTTTCATATGTTTCTCGG - Intergenic
1125291764 15:38156985-38157007 ACATTTTTTCATATGTTTGTTGG - Intergenic
1125632225 15:41156602-41156624 TAGTTTTTACAGATGTATCATGG + Intergenic
1125709412 15:41772850-41772872 ACATTTTTACTCTAGTTTCATGG + Intronic
1126486979 15:49192789-49192811 ACATCTTTTCATATGTTTAAGGG + Intronic
1126721690 15:51587929-51587951 GCATTTTTTCAGATGTTTTTTGG + Intronic
1126908426 15:53392435-53392457 GCATTTTCAGAGAGGTTTCATGG - Intergenic
1126951661 15:53888314-53888336 ACATTTTTTCATATGTTTGTTGG + Intergenic
1127089858 15:55456662-55456684 ACGGTTTTTCAGCTGTTTCATGG - Intronic
1127564395 15:60172538-60172560 ATATTTTTACATATGTTAAAAGG + Intergenic
1127684698 15:61331579-61331601 ACATGTTTTGAGATGTTACATGG + Intergenic
1127705655 15:61545087-61545109 ACATTTTGGCAGATATTTTAAGG + Intergenic
1127743900 15:61944019-61944041 ACATTTTTTCATATGTTTGTTGG - Intronic
1128252904 15:66176045-66176067 ACATTTTTATATATGTTTATTGG - Intronic
1128662245 15:69510513-69510535 ACACTTTTTCATATGCTTCAGGG - Intergenic
1128872536 15:71173122-71173144 ATCTTTTTACAGATATTTTAGGG - Intronic
1129068249 15:72928389-72928411 GCATTTTTTCATATGTTTCCTGG + Intergenic
1129556006 15:76510475-76510497 ACATTTTTTCATATGTTTATTGG - Intronic
1129762700 15:78140002-78140024 ACATCTTTAAAGATGTTATAAGG + Intronic
1129951652 15:79597181-79597203 ACATTCTTACATAGATTTCATGG + Intergenic
1131238977 15:90721961-90721983 ATATTTTTACAAATGTATCTTGG - Intronic
1131302713 15:91213593-91213615 AAATTTTTACAGATGAATTATGG - Intronic
1131475027 15:92730905-92730927 ACATTTTTTCATACGTTTCTTGG - Intronic
1131618365 15:94040593-94040615 ACATTTTTTCATATGTTTGTTGG - Intergenic
1131877368 15:96824710-96824732 ACATATTTACTGCTCTTTCAAGG + Intergenic
1131913454 15:97234769-97234791 AAATTTTTAAAGAGATTTCAGGG + Intergenic
1131980802 15:97992676-97992698 CCATTTTTATAGATTTCTCAAGG - Intergenic
1133505274 16:6405773-6405795 CTATTTTTACATTTGTTTCAAGG + Intronic
1134333917 16:13276677-13276699 ACATTTTTTCATATGTTTGTTGG + Intergenic
1134767130 16:16769760-16769782 GCATTTTTTCATATGTTTCTTGG + Intergenic
1135598698 16:23763348-23763370 ACATTATGACAGATGCTTCGTGG + Intergenic
1135634837 16:24066542-24066564 TCATTTTGACGGATGTGTCATGG - Intronic
1135948121 16:26883710-26883732 TGATTTTTGTAGATGTTTCAAGG - Intergenic
1137359612 16:47801736-47801758 ACCTTTTTTCATATGTTTCTTGG - Intergenic
1137507732 16:49069038-49069060 ACATTTTTATAAATGTGTCTGGG + Intergenic
1137740085 16:50761050-50761072 ACATTTTTGCATATGATTAAGGG + Intronic
1138781952 16:59799079-59799101 ACATTTTTTCATATGTTTCTTGG + Intergenic
1138892894 16:61166427-61166449 CAATTTTTACAGAGGTTTCTTGG - Intergenic
1138902079 16:61285024-61285046 ATATTTGTACTGATGGTTCAAGG - Intergenic
1141260290 16:82447250-82447272 ACATTTTTATACATGTTTATTGG + Intergenic
1141276686 16:82594793-82594815 ACAGTTTTACCAATGTTTGATGG - Intergenic
1141368091 16:83462811-83462833 ATAGTATTAGAGATGTTTCAGGG - Intronic
1144121874 17:12162718-12162740 ACATTTTTTCATATGTTTGTTGG + Intergenic
1144184283 17:12781879-12781901 ACATTTTCCCGCATGTTTCATGG - Intergenic
1145188703 17:20819854-20819876 ACATTTTTTCATATGTTTGTTGG - Intergenic
1146245096 17:31273981-31274003 ACATATGTACAGATGTTCTAAGG - Intronic
1146427219 17:32752650-32752672 ACATTTTTTCAAATGTTTGTTGG - Intronic
1147849388 17:43429952-43429974 AAATTTTCATAAATGTTTCATGG + Intergenic
1148120162 17:45204278-45204300 ACATTTTTTCATATGTTTGTCGG + Intergenic
1148283619 17:46368884-46368906 ACATTTTAAGTGATGTTTAATGG + Intergenic
1148305837 17:46586801-46586823 ACATTTTAAGTGATGTTTAATGG + Intergenic
1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG + Intronic
1149198903 17:54159410-54159432 ACATTTTAATAGATGTTTAGTGG - Intergenic
1150028387 17:61703406-61703428 ACATTTTTTCATATGCTTCTTGG + Intronic
1150198650 17:63329358-63329380 ACATGTTTCAAAATGTTTCAAGG - Intronic
1151798171 17:76360777-76360799 TCATTTTTACTGATGGGTCAGGG + Intronic
1153692653 18:7608920-7608942 AGAGTTTTCCAGATGTTTCTGGG - Intronic
1153724208 18:7938490-7938512 ACATTTTTTCATATATTTAAAGG - Intronic
1153829226 18:8906339-8906361 ACATTTTTTCATATGTTTGTTGG - Intergenic
1153866727 18:9276880-9276902 TCATATTTAAAGATGTTTAAAGG + Intronic
1153983885 18:10335893-10335915 ACATTGAAACAGATGGTTCAAGG - Intergenic
1155067176 18:22277972-22277994 AGAATTTTAGAGATGTTTCAGGG + Intergenic
1155180054 18:23337128-23337150 ACATTTGTAGGGAAGTTTCAAGG - Intronic
1155562927 18:27099592-27099614 ACATTTTCTCACATGTTTCTTGG - Intronic
1155632964 18:27916842-27916864 ACATTTTTCCATATGTTTCAGGG - Intergenic
1156066713 18:33150603-33150625 ACATTTTTTCATATGTTTGTTGG - Intronic
1156081148 18:33338132-33338154 ACATTTTTCCATATGTTTGTTGG - Intronic
1156178747 18:34578235-34578257 GCATTTTTACATATGTTTGTTGG + Intronic
1156380376 18:36553867-36553889 GCATTTTTTCATATGTTTCTTGG - Intronic
1156438154 18:37155919-37155941 ACATTTTTCCTTATCTTTCAAGG + Intronic
1156607707 18:38687810-38687832 ACCTTTTTGAAGATCTTTCATGG - Intergenic
1156614229 18:38764532-38764554 GCATTTTTTCATATGTTTCTTGG - Intergenic
1156770602 18:40717206-40717228 ATAATTGTATAGATGTTTCAGGG - Intergenic
1156951242 18:42900995-42901017 GCATTTTTACTGATGGTGCAAGG + Intronic
1158078373 18:53559445-53559467 GCATTTTTTCATATGTTTCTTGG - Intergenic
1158237901 18:55339885-55339907 ATATTTGTACAGATGTTTTAAGG - Intronic
1158315250 18:56205056-56205078 ACATTATTCCAGATCTTTCAGGG - Intergenic
1158569764 18:58588194-58588216 CCATTTTTACTGATGCATCAAGG + Intronic
1158991190 18:62870564-62870586 ACGTTTTTACCTAAGTTTCAAGG + Intronic
1159087869 18:63814505-63814527 ACATTTTTTCATATGTTTTTTGG + Intergenic
1159291217 18:66423675-66423697 TCATTTTTACCCATGTTTTATGG - Intergenic
1159372161 18:67542191-67542213 ACATTTTTTCATAGGTTTCTTGG + Intergenic
1159429238 18:68329975-68329997 TCATTTTAATAGATGTTTAATGG + Intergenic
1159547488 18:69858254-69858276 ACCCTTTTATAAATGTTTCAAGG - Exonic
1159547800 18:69862226-69862248 ACATTTTTACAGTTGTAGTATGG - Exonic
1159583139 18:70255932-70255954 ACAGTTTTACACATGTTAAATGG + Intergenic
1159600592 18:70425208-70425230 ACATTTTAACAACTGTATCAGGG + Intergenic
1159922553 18:74238871-74238893 ACATTTTTTCATATGTTTGTTGG - Intergenic
1160062114 18:75540419-75540441 ATATTTTTACAAATCTTTCTTGG - Intergenic
1160276286 18:77440177-77440199 ACATTTTTTCATATGTTTGTTGG + Intergenic
1162668382 19:12234701-12234723 ACATCTCTACAGATTCTTCACGG + Intronic
1163063886 19:14779018-14779040 ACATCATTGCAGATGTTTTAAGG - Intergenic
1163192673 19:15689340-15689362 GCATTTTTTCATATGTTTCGTGG - Intronic
1164030968 19:21404120-21404142 ACTTTTTTTCAGAACTTTCAGGG - Intronic
1164032586 19:21421181-21421203 TCATTTTTCAAGATTTTTCAGGG + Intronic
1164044371 19:21522992-21523014 AGATTTGTACAAATGTTACAGGG + Intronic
1164174986 19:22764712-22764734 GCATTTTTTCATATGTTTCTTGG - Intronic
1164438758 19:28255182-28255204 ACATTTTTACAAATGCATAAAGG - Intergenic
1165156775 19:33793525-33793547 TCAGGTTTCCAGATGTTTCAAGG - Intergenic
1165661785 19:37587128-37587150 ACATTTTGACAGACATATCAGGG + Intronic
1167397165 19:49237950-49237972 GCATTTTTTCATATGTTTCTTGG + Intergenic
1167981398 19:53279362-53279384 CAATTTTTCCAGATGTTTGATGG + Intergenic
925005249 2:438377-438399 ATATTTGTACAAATATTTCAGGG - Intergenic
925017313 2:540797-540819 ACATTTTTTCATATGTTTGTTGG - Intergenic
925505890 2:4563522-4563544 ACATTTTTTCATATGTTTGTTGG - Intergenic
925753158 2:7108194-7108216 ACATTTATACATTTATTTCATGG + Intergenic
926066645 2:9845632-9845654 ACATTTTTTTAAATGTGTCATGG + Intronic
926899331 2:17732854-17732876 AAAGTTTTAAAGATGTTTTAGGG + Intronic
927068606 2:19500462-19500484 ATATTTTTAAAGATGTTATATGG - Intergenic
927078749 2:19607109-19607131 GCATTCTTACAAATTTTTCAAGG + Intergenic
927273847 2:21244176-21244198 ACATTTTTTCAGTTGTTTATTGG - Intergenic
927332360 2:21880528-21880550 ACATTTTTATAGATATTTCTGGG - Intergenic
927363063 2:22259884-22259906 ACATTTTTTCATATGTTTGTCGG + Intergenic
927624369 2:24698887-24698909 ATATTTATATAGATGTTTCCTGG - Intronic
928222963 2:29420328-29420350 AAACTTTTACAGATATTTGAAGG + Intronic
928232563 2:29511865-29511887 GCATCTTTTCATATGTTTCATGG + Intronic
928315226 2:30239503-30239525 ACATTGTGAAAGATGTTTCCTGG - Intronic
928587678 2:32777644-32777666 ATATTATTGCATATGTTTCACGG - Intronic
928711907 2:34016691-34016713 ACATTTTTAAATATGTTTATTGG - Intergenic
929651825 2:43687748-43687770 GCATTTTTTCATATGTTTCTTGG + Intronic
930212661 2:48657865-48657887 ACATTTTTTCATATGTTTGTTGG + Intronic
930542827 2:52728831-52728853 GCATTTTTTCAGATGTTTGTTGG + Intergenic
930941574 2:57020785-57020807 ACATTTTTCCATATGTTTCTTGG + Intergenic
930981493 2:57531387-57531409 GCATTTTTTCATATGTTTCTTGG - Intergenic
931391115 2:61845013-61845035 ACATTTATCCACATGTTTCCTGG - Intronic
931632813 2:64316530-64316552 TCATGATTCCAGATGTTTCACGG + Intergenic
931907583 2:66859035-66859057 ACATGTTTACACATGCTACATGG + Intergenic
932992411 2:76803809-76803831 TTGTTTGTACAGATGTTTCAGGG - Intronic
932995563 2:76847135-76847157 TCATTTTTACAACTGTTTCAGGG + Intronic
933181079 2:79228513-79228535 GCATTTTTTCATATGTTTCTTGG + Intronic
933201766 2:79458760-79458782 ACATTTTTATATTTGTTGCATGG - Intronic
933340587 2:81020706-81020728 ACATTTTTTCATATGTTTGTTGG + Intergenic
933439719 2:82297280-82297302 ACATTTTTTCGTATGTTTTACGG - Intergenic
934634162 2:95967368-95967390 GCTTTTTTTCAGATGTTTCTTGG - Intronic
935000506 2:99010389-99010411 ACAGTTTTTCACCTGTTTCATGG - Intronic
935861212 2:107332026-107332048 ACCTTTTTTCATATGTTTCTTGG - Intergenic
935972912 2:108547978-108548000 CCATGTTTACAAAGGTTTCACGG - Intronic
936614694 2:114036336-114036358 GCATTTTTTCATATGTTTGATGG + Intergenic
936735232 2:115433186-115433208 CAATTTTTATAAATGTTTCATGG + Intronic
936955934 2:118022192-118022214 ACAATTTGACATAAGTTTCAGGG - Intergenic
937529768 2:122814030-122814052 ACATTTTTTCATATGTTTGTTGG - Intergenic
938599301 2:132821179-132821201 ACAGTTTTTCACCTGTTTCATGG - Intronic
938818314 2:134927772-134927794 ACATATTTACACATGTTCTAGGG + Intronic
938900039 2:135792041-135792063 ACAGTTTTGCAGCTGTCTCATGG - Intronic
939032089 2:137088851-137088873 ACATTTTTTCAAATGTTTGTTGG - Intronic
939336739 2:140838928-140838950 ATATTTTCAAAGATGTTTCTTGG + Intronic
939339231 2:140871902-140871924 ACATTTTAAAAGATTTTTTAAGG + Intronic
939344475 2:140946086-140946108 GCATTTTTTCATATGTTTCCTGG - Intronic
939369303 2:141277400-141277422 ACATTTTTTCATATGTTTGTTGG + Intronic
940125857 2:150323396-150323418 GCATTTTTTCATATGTTTCTTGG + Intergenic
940214173 2:151287717-151287739 ACATGTTTACTGATGTGTCACGG - Intronic
940250475 2:151670188-151670210 ACATTATCACAGATGTCTAAGGG - Intronic
940544368 2:155064354-155064376 ACATTTTTTCATATGTTTGTTGG + Intergenic
940630718 2:156235108-156235130 ACATTTTTTCATATGTTTATTGG - Intergenic
941127217 2:161598755-161598777 ACATTTTTTCATATGTTTGTTGG - Intronic
941193043 2:162410829-162410851 ACATTTTTTCATATGTTTCTTGG - Intronic
941295367 2:163732691-163732713 AGATTTTTAAAAATGTTTCCTGG - Intronic
941406583 2:165097202-165097224 AAAGTTTTCAAGATGTTTCAAGG - Intronic
941520720 2:166538615-166538637 ACATTTTTTCATATGTTTGTTGG + Intergenic
941589302 2:167399065-167399087 ACATTTTTACAGCCATTACAGGG + Intergenic
941687920 2:168466629-168466651 ACATTCTTACAGATGAATTACGG - Intronic
942399749 2:175589311-175589333 ACATTTTTACATGTGTTTTTTGG + Intergenic
942735362 2:179104789-179104811 ACATTTTTAAAGATTTTTTTTGG - Exonic
942760860 2:179395632-179395654 TTATTTTTACAGAGGTTTCTGGG + Intergenic
942886387 2:180929375-180929397 ACATGTTTAAAGATCTTTGAAGG - Intergenic
943403368 2:187446691-187446713 CCATTTCTACACATGTGTCAGGG + Intronic
943423937 2:187705836-187705858 ACATTTTTTCATATGTTTGTTGG - Intergenic
943877665 2:193093236-193093258 ATATATTTACATATGTTTCAAGG - Intergenic
943987886 2:194646084-194646106 GCATTTTTTCAAATGTTTCTTGG + Intergenic
944072765 2:195691626-195691648 TCATTTTTCCATATGTTTCTTGG + Intronic
944370623 2:198978739-198978761 ACATTTTTTCATACGTTTGATGG - Intergenic
944960316 2:204865005-204865027 GCATTTTTCCATATGTTTCTTGG - Intronic
945356843 2:208850383-208850405 ACATTTTTTCATATGTTTGTTGG + Intronic
945523928 2:210864846-210864868 ACTTGTTTAAAGATCTTTCAGGG + Intergenic
945662665 2:212705812-212705834 ACAATGTTACTGGTGTTTCACGG + Intergenic
945727486 2:213490342-213490364 TCATTTTTAGAGAAGTTTCTAGG + Intronic
945739401 2:213642170-213642192 ACAATGTTTCAGCTGTTTCATGG + Intronic
946075138 2:217067542-217067564 ACATTTTTCCATATGTTTGTTGG - Intergenic
946891208 2:224279071-224279093 ACATTTTTAAAAATAATTCAGGG + Intergenic
947123501 2:226842057-226842079 GCTTTTTTTCATATGTTTCATGG + Intronic
947125753 2:226866587-226866609 TCCTTTTTACAGATATTTCATGG + Intronic
947448933 2:230187263-230187285 GCATTTTTTCAGATGTTTCTTGG + Intronic
947997529 2:234541459-234541481 AGATGTTTAGCGATGTTTCAGGG + Intergenic
948303764 2:236931257-236931279 ACATGTTTCCAGTTGTTTCCAGG + Intergenic
1169296080 20:4400767-4400789 ACATTTTTTCATAATTTTCATGG - Intergenic
1169538382 20:6572166-6572188 ATAGTTTTACAGATGTTGAAAGG - Intergenic
1169619956 20:7494728-7494750 ACATTTTTAAACATGTTTCTTGG - Intergenic
1169955192 20:11094581-11094603 CCATTTTAACAAATGCTTCATGG + Intergenic
1169956040 20:11103964-11103986 ACATTTTTTCATATGTTTGTTGG - Intergenic
1170268565 20:14498550-14498572 ACATTCTTTCAGATGTTCCAAGG + Intronic
1170449621 20:16468942-16468964 ACATTTGTTAAGATGTTTTATGG - Intronic
1171062087 20:21974988-21975010 GCATTTTTTCATATGTTCCATGG + Intergenic
1172923164 20:38504806-38504828 GCATTTTTTCATATGTTTCTTGG - Intronic
1175265105 20:57697993-57698015 ACATTTAAACATTTGTTTCATGG + Intronic
1175346451 20:58280633-58280655 ACATTTTTATGGATTTTTCTAGG - Intergenic
1176590705 21:8647520-8647542 CCATTTTTCCAAATGTTTCCAGG + Intergenic
1177071524 21:16514630-16514652 ACATTTTTTCATATATTTCTTGG + Intergenic
1177185951 21:17796509-17796531 ACATTTGTATAGATGTGTAATGG - Intronic
1177234386 21:18368135-18368157 AGGTTTTTACAGATGCTTAAAGG - Intronic
1177270501 21:18842444-18842466 GCATTTTTTCAGATATATCAAGG + Intergenic
1177539690 21:22476557-22476579 ATTTTTTTAAAAATGTTTCAAGG + Intergenic
1177572224 21:22901751-22901773 ACATTTTTACAGAATTGTCAAGG - Intergenic
1177718508 21:24872731-24872753 ACATTTTTTCATATGTTTACTGG + Intergenic
1177870874 21:26571833-26571855 ACCATTTTAAAGATGTTTTATGG - Intronic
1177874478 21:26614298-26614320 ACATTTTTACATTTATTTTATGG + Intergenic
1178111148 21:29371484-29371506 ACATTTTCACAGCTGTTACTGGG - Intronic
1178300314 21:31447655-31447677 ACATTCCTGCAGATGCTTCAGGG - Intronic
1178959571 21:37052454-37052476 ACATTTTTTCATATGTTTGTTGG - Intergenic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1179229958 21:39492883-39492905 GCATTTTTGCATATGTTTCTTGG + Intronic
1179374653 21:40839383-40839405 CCTTTCTTAAAGATGTTTCACGG - Intronic
1179378046 21:40869445-40869467 GCATTTTTTCACATGTTTGATGG - Intergenic
1180273534 22:10624554-10624576 CCATTTTTCCAAATGTTTCCAGG + Intergenic
1181377044 22:22467572-22467594 GCATTTTTTCATATGTTTCTTGG - Intergenic
1182940846 22:34275712-34275734 AAATTTGTAAAGAAGTTTCATGG + Intergenic
1184338541 22:43871180-43871202 ACATTTTTTCATATGTTTGTTGG + Intergenic
949598655 3:5575046-5575068 ACATGGTTACAGATGCTTAAGGG - Intergenic
949633425 3:5954986-5955008 ACATTTTTTCATATGCTTCTTGG + Intergenic
950373770 3:12553082-12553104 AAATTCTTCCAGATGTTTAAGGG + Intronic
950941253 3:16894711-16894733 ACATCTTTTCATATGTTTCTTGG + Intronic
951036641 3:17939748-17939770 ACATTTTTAAACATGTTTCAAGG + Intronic
951307435 3:21082546-21082568 ACATTTTTTCATATGTTTGTTGG + Intergenic
951361294 3:21727549-21727571 GCATTTTTTCATATGTTTCTTGG - Intronic
951467636 3:23019790-23019812 ACAGTTTTTCAGCTGTCTCATGG - Intergenic
951514546 3:23544430-23544452 GCAGTTTTACATATGTTTCTTGG - Intronic
951913272 3:27773453-27773475 ACTTTTTTACTGGTGTTTCTCGG + Intergenic
952134826 3:30406651-30406673 ACATTTTTACAAATTTATCAGGG - Intergenic
952243255 3:31556657-31556679 ACATTTTTTCATATGCTTCTTGG + Intronic
952454070 3:33456608-33456630 ACATCTTAACATATGTTTCTGGG + Intergenic
952476054 3:33711755-33711777 ACATTTTTTCATATGTTTGTTGG - Intronic
952581796 3:34842383-34842405 ATATTTTTACAACTATTTCATGG + Intergenic
952714445 3:36465222-36465244 ACATTTTTTCATATGTTTGTTGG + Intronic
953715540 3:45314012-45314034 ACCTTTTGACAGCTGTTTCTCGG - Intergenic
953948800 3:47171821-47171843 ACATTTGAAAAGCTGTTTCAGGG + Intergenic
954065777 3:48104733-48104755 GCATTTTTTCATATGTTTCTTGG + Intergenic
954521652 3:51232636-51232658 ACATTTTTTCATATGTTTGTTGG + Intronic
954934573 3:54314668-54314690 GCATTTTTTCATATGTTTCTTGG + Intronic
955086294 3:55706089-55706111 ACAGATTTAGAGTTGTTTCAGGG - Intronic
955604606 3:60687728-60687750 ACACTTTTATTGATCTTTCATGG - Intronic
955686145 3:61550362-61550384 GCATTTTTTCACATGTTTCTTGG + Intergenic
956348592 3:68309150-68309172 TCACTTTTACAGAGCTTTCAGGG - Intronic
956864921 3:73359966-73359988 GCATTTTTTCATATGTTTGATGG - Intergenic
957596133 3:82269152-82269174 ACTTTTTTTCAGATGTTTTTTGG + Intergenic
958014235 3:87919599-87919621 ACATTTTTTCATATGTTTGTTGG - Intergenic
958064912 3:88531309-88531331 TAATTTTTTCATATGTTTCAAGG + Intergenic
958204295 3:90370140-90370162 ACATTTTTTCATATGTTTTTTGG + Intergenic
958204816 3:90376195-90376217 ACATTTTTTCATATGTTTTTTGG - Intergenic
958260784 3:91378493-91378515 GCATTTTTTCATATGTTTCTTGG + Intergenic
958621008 3:96559893-96559915 ACATTTTAATAAATGGTTCAGGG + Intergenic
958740790 3:98068543-98068565 AAAGTTTTACAGATTGTTCAAGG - Intergenic
958787544 3:98613751-98613773 ACAGTTTTTCAGCTGTCTCACGG + Intergenic
958969483 3:100595720-100595742 ACATTTTTTCATATGTTTGTTGG + Intergenic
959249877 3:103928054-103928076 ACATTTTCCAAGATCTTTCATGG + Intergenic
959274887 3:104266017-104266039 GCATTTTTTCATATGTTTGATGG + Intergenic
959715261 3:109425838-109425860 GCATTTTTTCATATGTTTCTTGG + Intergenic
959870757 3:111324789-111324811 ACATCCTGACTGATGTTTCATGG + Intronic
959904663 3:111698062-111698084 AAATATTTACTGAGGTTTCATGG + Intronic
960222177 3:115126388-115126410 ACATTCTTGCACATGTTTCTTGG - Intronic
960512383 3:118566468-118566490 GCATTTTTTCATATGTTTCTTGG + Intergenic
960781645 3:121325600-121325622 ATATTTTTTCTGATGTTTCATGG - Intronic
960794652 3:121472815-121472837 ACATTTTTACAGATGTTTCAGGG - Intronic
960804576 3:121571320-121571342 ACAGTTTTACATATTTTTAAAGG - Intronic
961407155 3:126688027-126688049 GCATTTTTTCATATGTTTCTTGG + Intergenic
961982755 3:131098505-131098527 GCATTTTTTCATATGTTTCTTGG + Intronic
962224483 3:133594283-133594305 ACCATTTTACAGAGGTTTCTTGG - Intergenic
962659048 3:137582078-137582100 CCACTTTTGCAGACGTTTCATGG - Intergenic
962862317 3:139415244-139415266 ACAGTTTTTCACCTGTTTCATGG + Intergenic
962948955 3:140200316-140200338 AGAATTTTACATAAGTTTCAGGG + Intronic
963382163 3:144544415-144544437 TCATTTTTAAAAATATTTCATGG + Intergenic
963499584 3:146108531-146108553 ACATATTTACAGTTATTTAAGGG - Intronic
963986482 3:151600865-151600887 ACATTGTTTCATATGTTTAAAGG + Intergenic
964046353 3:152331990-152332012 TCATTTTTAAAGAGGTATCAAGG - Intronic
964114556 3:153121975-153121997 ACATTTTTTCAGATGTTTGTTGG + Intergenic
964459770 3:156911096-156911118 ACATTTTTTCATATGTTTGTTGG + Intronic
964537760 3:157743359-157743381 ACATTTTTTCATATATTTCTTGG + Intergenic
964540995 3:157779863-157779885 ACATTTTTTCATATGTTTGTTGG - Intergenic
964777694 3:160296126-160296148 CCTTTTTAACAGATTTTTCAGGG - Intronic
964832471 3:160899794-160899816 TGATTTTTATAAATGTTTCATGG + Intronic
964919537 3:161879589-161879611 ACATTTTTTCATATGTTTCTTGG - Intergenic
964929806 3:162003264-162003286 ACATTTTTTCATATGTTTTTTGG + Intergenic
965126105 3:164631872-164631894 AATTGTTTTCAGATGTTTCAGGG - Intergenic
965156257 3:165060899-165060921 AACTTTTTACATATGTATCATGG - Intronic
965434423 3:168631221-168631243 ACATTTTTTCATATGTTTGTTGG + Intergenic
965638107 3:170805041-170805063 ACATTTTTTCATATGTTTGTTGG - Intronic
965711902 3:171563833-171563855 GCATTTTAAAAGATGTTTTATGG + Intergenic
965725977 3:171716501-171716523 GCATTTTTTCAAATGTTTCTTGG + Intronic
965830087 3:172776356-172776378 TGAGTTTTACAAATGTTTCACGG - Intronic
966093180 3:176165088-176165110 ACATTTTTTCATATGTTTGTTGG - Intergenic
966276822 3:178182750-178182772 ATATTTTTACAGATGCTACAGGG - Intergenic
966304531 3:178515662-178515684 ACATTTTTTCATATGTTTGTTGG + Intronic
966319265 3:178682745-178682767 ACATTTTTTCATATGTTTGTTGG - Intronic
966488439 3:180498512-180498534 GCATTTTTTCATATGTTTCTTGG + Intergenic
966628712 3:182048307-182048329 ACATTTTTTCAAATGTTTATTGG + Intergenic
967255555 3:187588265-187588287 ACTTTTTTTCATATGTTTCTTGG + Intergenic
967675637 3:192295746-192295768 TGATTTTGACAGATATTTCAGGG - Intronic
969801608 4:9570862-9570884 ACATTTTTTCATATGTTTGTCGG - Intergenic
970525722 4:16929917-16929939 ACATTCTTACAGGTGTTTGTTGG + Intergenic
970731273 4:19106656-19106678 ACATTATTTCAGACATTTCAGGG + Intergenic
970895748 4:21101909-21101931 CCTTTTTTTGAGATGTTTCATGG + Intronic
970911986 4:21287525-21287547 AGATAATTACATATGTTTCAGGG - Intronic
971189211 4:24411362-24411384 ATAATTTTAGAGATGTTTTAGGG + Intergenic
971523452 4:27585288-27585310 ACATTTTGACAGCTTTCTCAAGG - Intergenic
971938143 4:33180322-33180344 ACATTTTTTCATATGTTTGTTGG + Intergenic
972188645 4:36563698-36563720 ACATTTTTTCATATGTTTGTTGG + Intergenic
972753434 4:42017190-42017212 ACATTTTTTCAAATGTTTATTGG + Intronic
974165286 4:58193484-58193506 ACATTTTTTCATATGTTTGTTGG - Intergenic
974472402 4:62335876-62335898 GCATTTTTTCATATGTTTGATGG - Intergenic
974773493 4:66447758-66447780 ACATTTAGACACATGTTTCTGGG + Intergenic
974821255 4:67069252-67069274 ACATTTTTAAAGATATTTGGAGG + Intergenic
975090175 4:70392475-70392497 ACATTTTTTCATATGTTTTTTGG - Intergenic
975340714 4:73236527-73236549 ACATTTTGCCAGTTGTTTCTGGG - Intronic
975354617 4:73386820-73386842 ACATTTTTTCATATGTTTGTTGG + Intergenic
975834983 4:78413329-78413351 ACAGTATTCCAGATGTTCCAGGG + Intronic
976019891 4:80609428-80609450 ATATTTTTTGAAATGTTTCAAGG + Intronic
976063018 4:81152951-81152973 AGATTTTTACATATGTTATATGG - Intronic
976103356 4:81589522-81589544 TCATGTGTACAGATTTTTCAAGG - Intronic
976800341 4:88983428-88983450 ACATTTTTACTTGTGTTTAAGGG - Intronic
977014260 4:91672654-91672676 ACATTTTTACTAAATTTTCAAGG + Intergenic
977026953 4:91832044-91832066 ACATTTTTAGCAATATTTCAAGG + Intergenic
977139225 4:93346312-93346334 ACATTTTTAGAAATGCCTCATGG + Intronic
977182335 4:93891908-93891930 ACAGTTGTACAGATTTTTTACGG + Intergenic
977186816 4:93949315-93949337 ACATTTTTTCATATGTTTTTTGG - Intergenic
977190655 4:93996481-93996503 ACATGTTGACAGATATATCAAGG + Intergenic
977229657 4:94436914-94436936 ACATTTTTAAATATGTTTGTTGG - Intergenic
977429039 4:96908423-96908445 TCATTTTTACATATGGTTCCAGG - Intergenic
977448604 4:97164403-97164425 ATTTTTTTTCAGATGTTTGATGG + Intergenic
977829144 4:101569842-101569864 ACATTTTTTCATATGTTTGTTGG - Intronic
977859324 4:101937470-101937492 ACATTTTTTCATATGTTTGTTGG - Intronic
978063440 4:104366489-104366511 ACATTTTTTCATATGTTTCTTGG - Intergenic
978100033 4:104827478-104827500 GCATTTTTACAAATCTTTCAGGG + Intergenic
978125173 4:105126531-105126553 AGATTTTTCCATCTGTTTCATGG - Intergenic
978176441 4:105737742-105737764 ATGTTTTTACAGAAGTGTCAAGG - Intronic
978572029 4:110148201-110148223 ACATTTTTTCATATGCTTCTTGG - Intronic
979000320 4:115209079-115209101 ACATTTTTTCATACGTTTCTTGG - Intergenic
979159610 4:117443079-117443101 GCATTTTTTCATATGTTTCTTGG + Intergenic
979554060 4:122024686-122024708 ACATTTTTTCATATGTTTCTTGG - Intergenic
979962888 4:127042258-127042280 ATATTTTTTCATATGTTTCTTGG - Intergenic
979984071 4:127294048-127294070 ACAGTTTTTCAGCTGTCTCATGG - Intergenic
980025243 4:127758245-127758267 ACATTTTTTCATATGTTTGTTGG + Intronic
980454966 4:133027407-133027429 GCATTTTTAAATATGTTTCTTGG - Intergenic
980837230 4:138210625-138210647 ACATTTTTTCATATGTTTGCTGG - Intronic
981266523 4:142790445-142790467 ACATTTTTTCATATGTTTGTTGG - Intronic
981275241 4:142891964-142891986 ACATTTTTTCATATGTTTCTTGG + Intergenic
981665226 4:147216966-147216988 ATATTTAAACATATGTTTCAAGG - Intergenic
982493059 4:156053791-156053813 ACAGTTTTACAGACTTTCCAAGG - Intergenic
982666243 4:158268027-158268049 AAATTTCTACAAATGTTTAATGG + Intergenic
983052043 4:163059884-163059906 AAATTTTTAAAGAGGTTTAATGG - Intergenic
983092798 4:163524630-163524652 ACATTTTTTAAGATTTTACAAGG - Intronic
983174688 4:164574602-164574624 ACAGTTTTTCATATGTTTCTTGG - Intergenic
983266255 4:165511351-165511373 TCATTTTTCCAGAGGTTTCATGG + Intergenic
983546590 4:168971233-168971255 GCATTTTTTCATATGTTTCTTGG + Intronic
983715628 4:170777774-170777796 ACATTTTTTCATATGTTTGTTGG - Intergenic
983741999 4:171146982-171147004 ACATTTTTAAATATGTTTATGGG - Intergenic
983986187 4:174062735-174062757 ACACATTTACAAAAGTTTCAAGG + Intergenic
984038813 4:174703584-174703606 TCCTTTTTACAGATATTCCATGG + Intronic
984040841 4:174731879-174731901 ACATTTTTTCAGATACTTCTTGG - Intronic
985006559 4:185540316-185540338 ACATGTTTACAGATGATGAAAGG - Intergenic
985143626 4:186869771-186869793 TCATATTTACAGATTTTTCAGGG + Intergenic
985173914 4:187180716-187180738 GCATTTTTACAGATATTGAAAGG + Intergenic
985235898 4:187873609-187873631 ACATTTTTTCATATGTTTGTTGG + Intergenic
985558004 5:567490-567512 TCATCTTTACAGATGTTCCTGGG - Intergenic
986143084 5:5049956-5049978 ACATATTTACTGATATTACAAGG - Intergenic
986909674 5:12539529-12539551 ACATTTTTTCATATGTTTTCTGG - Intergenic
986953573 5:13122112-13122134 ACATTTTGATAGAATTTTCATGG - Intergenic
987328136 5:16831100-16831122 ACATGTTTTCATATGTTTCTTGG - Intronic
987439772 5:17941754-17941776 ACATTATTATGGATGTTTCTGGG + Intergenic
987564785 5:19570083-19570105 TCATTTGTACAGATCTTTTATGG + Intronic
987715419 5:21562777-21562799 TCATTTTTACATGTGGTTCAAGG - Intergenic
988134682 5:27155626-27155648 ACATTTTTTCATATGTTTGTTGG + Intergenic
988232256 5:28494412-28494434 ACATTTTCACAAATGTGTCAAGG - Intergenic
988326908 5:29780607-29780629 AAATTCTCACAGATGTTGCATGG - Intergenic
989373114 5:40730703-40730725 GGATTTTTACATATATTTCATGG - Intronic
989589574 5:43100875-43100897 AAATTATTAGAGAAGTTTCAGGG + Intronic
989778341 5:45235262-45235284 ACATTTTTTCATATGCTTCCTGG + Intergenic
990131664 5:52594135-52594157 ACATTTTTACAGCTTTTTTATGG - Intergenic
990232742 5:53731913-53731935 ACATCTTTACCTATGTTTAAGGG - Intergenic
991112042 5:62911430-62911452 ACATTTTTTCATATGTTTATTGG + Intergenic
991319028 5:65347903-65347925 ACATTCTTTCATATGTTTCTTGG - Intronic
992322133 5:75623803-75623825 ACATTTTTCCAAATGTTTCCTGG + Intronic
992339641 5:75809550-75809572 GCATTTTTGCAGATGTTTGCTGG + Intergenic
992340839 5:75821996-75822018 GCATTTTTTCATATGTTTCTTGG - Intergenic
992471215 5:77056617-77056639 TCATTTTTATAGATGGTTCAAGG - Intronic
992956957 5:81919988-81920010 ACATTTTTTCACATGTTTGTTGG + Intergenic
993002025 5:82390410-82390432 ACATTTCTATAGATTTTTCTAGG - Intergenic
993298818 5:86181325-86181347 ACATTTTTTCATATGTTTGTTGG - Intergenic
993905870 5:93621820-93621842 ACATTTTTACAGATTTTAAGGGG + Intronic
993908601 5:93652553-93652575 ACAATTTTACATATAGTTCATGG + Intronic
994116670 5:96068899-96068921 ACATTTTTACATATGGCTCTTGG + Intergenic
994293467 5:98059415-98059437 ACAATTTTATTGATCTTTCAAGG - Intergenic
994922211 5:106061269-106061291 ACATCTTTATTGCTGTTTCATGG + Intergenic
995781559 5:115781418-115781440 AAATTTTTCCAGATATTGCAGGG - Intergenic
995923077 5:117337375-117337397 AAATTTTTGTAGATTTTTCATGG + Intergenic
996128680 5:119754711-119754733 ACATTTTTTCATATGTTTGTTGG - Intergenic
996279852 5:121716075-121716097 ACTTTTTTATATATGTTTCTTGG - Intergenic
997032908 5:130152762-130152784 GCCATTTTACAGATGTTCCAAGG - Intronic
997108476 5:131047932-131047954 ACCTTTTTTCATATGTTTCTTGG - Intergenic
997223602 5:132191783-132191805 ACATTTTTATACATGATTCCTGG - Intergenic
997455125 5:134011088-134011110 ACATTTTTTAATATGTTTCTTGG + Intergenic
998609792 5:143675417-143675439 TCATTTTTCCAGCTGTTTCTAGG + Intergenic
999871824 5:155759533-155759555 GCATGTTTAAAGATGTTTCTGGG - Intergenic
1000111657 5:158113812-158113834 ACATTTTACCAGCTGCTTCATGG + Intergenic
1000530878 5:162418238-162418260 ACATTTTTTCATATGTTTCTTGG + Intergenic
1000602935 5:163296677-163296699 ACTTTTTTACATATGTTTGTTGG - Intergenic
1001166222 5:169371176-169371198 GCATTTTTTCATATGTTTCTTGG - Intergenic
1001219505 5:169887989-169888011 ACATTTTTTCACATGTTTATTGG + Intronic
1001291173 5:170462359-170462381 ACATTTTTTCATATTTTTCTTGG - Intronic
1001767865 5:174267911-174267933 ACATTTTTTCATATGTTTGTTGG - Intergenic
1003451276 6:6235112-6235134 TCATTTTTACATATGGTGCAAGG - Intronic
1003828877 6:9983304-9983326 ACATTTTTGCAAATGTCTCCTGG + Intronic
1004688298 6:17969210-17969232 CCATTTGTACAGATTCTTCACGG + Intronic
1004943750 6:20588468-20588490 AGATTTTTAAAGCTGTTCCATGG - Intronic
1005030826 6:21507390-21507412 TCATTTATACAGAAGTTTTATGG - Intergenic
1005653494 6:27907769-27907791 ACATTTTTTCATATGTTTGTTGG - Intergenic
1005701124 6:28401258-28401280 ACATATTTACAGATGTTTGAGGG - Intergenic
1005701978 6:28410934-28410956 ACATTTTTTCATATGTTTGTTGG + Intergenic
1006251304 6:32788523-32788545 GCTTTTTTTCATATGTTTCATGG - Intergenic
1006268155 6:32942700-32942722 ACATTTTTTCATATGCTTCTTGG + Intronic
1007024822 6:38560292-38560314 ACATTTTTTCATATGTTTTTTGG - Intronic
1007043860 6:38751892-38751914 GCATTTTTAAAGATGTTCCCAGG + Intronic
1007310582 6:40942872-40942894 CCATTTTTTCATATGTTTCTTGG - Intergenic
1007758644 6:44118062-44118084 ACATTTTGGCTGATGCTTCATGG - Intronic
1008484502 6:52020762-52020784 GTATTTTTAAAGATTTTTCAGGG - Intronic
1008528189 6:52428953-52428975 ACATTTTTTCATATGTTTGTTGG + Intronic
1008600624 6:53090604-53090626 ACATTTTAACATAAGTTTGAGGG + Intronic
1009001306 6:57719269-57719291 TCATTTTTACATGTGGTTCAAGG + Intergenic
1009037595 6:58136520-58136542 ACATTTTTTCATATGTTTGTTGG - Intergenic
1009213383 6:60890147-60890169 ACATTTTTTCATATGTTTGTTGG - Intergenic
1009267617 6:61575344-61575366 GCATTTTTTCATATGTTTCTTGG - Intergenic
1009443946 6:63716949-63716971 ACATATTTACAGGTGTTCCAAGG + Intronic
1009453514 6:63828687-63828709 GCATTTTTTCAGATGTTTGTTGG - Intronic
1009495444 6:64340944-64340966 GCATTTTTTCAGATGTTTGTTGG - Intronic
1009768581 6:68115613-68115635 AGATATTTCCAGATGTTTCATGG - Intergenic
1009816061 6:68737350-68737372 ACATTTTTTCACATGTTTAAGGG + Intronic
1010045779 6:71441723-71441745 GCATTTTTTCATATGTTTCTTGG - Intergenic
1010305563 6:74317620-74317642 ATATTTTTTCATATGTTTGATGG + Intergenic
1010457895 6:76080239-76080261 GCATTTTTTCATATGTTTCTTGG - Intergenic
1010801992 6:80186950-80186972 ACAGTTTTTCAGCTGTCTCATGG + Intronic
1010923697 6:81717074-81717096 ACATTTTTATAAATTTTTGAAGG - Intronic
1011196722 6:84788199-84788221 ACATTTTTGCAGTTGTGACAAGG - Intergenic
1011225093 6:85096625-85096647 ACAGTTTTTCAGCTGTCTCATGG - Intergenic
1011578704 6:88832805-88832827 GCATTTTTTCATATGTTTCTTGG - Intronic
1011781262 6:90791984-90792006 ACATTTTGACACATGGTACAAGG - Intergenic
1011843846 6:91536682-91536704 TCATTTTTAGAAATGTTTCTAGG - Intergenic
1012228358 6:96731231-96731253 ACATTTTTTCATATGTTTGTTGG - Intergenic
1012336911 6:98071104-98071126 ACATTTTTTCATATGTTTGTTGG + Intergenic
1012537863 6:100321011-100321033 GCATTTTTACATATGTTTGTTGG + Intergenic
1012547294 6:100434090-100434112 AAATATTTACAGACGTTACATGG - Intronic
1012812049 6:103971444-103971466 ACATTTTTTCATATGTTTTTTGG - Intergenic
1013362366 6:109405889-109405911 ACAGTTTTACATATGTTAAATGG - Intronic
1013574538 6:111468719-111468741 ACATTTTTAAACATCTTACAAGG - Intronic
1013852217 6:114529773-114529795 GCATTTTTTCAGATGTTTGTTGG + Intergenic
1014265496 6:119272033-119272055 AATTTTTTAAAGCTGTTTCATGG - Intronic
1014357374 6:120429765-120429787 ACATTTTGGCAGATGCTTTATGG + Intergenic
1014421517 6:121251953-121251975 ACTTTTTTTCATATGTTTCTTGG - Intronic
1014549096 6:122768097-122768119 ACATATTTTCATATGTTTAATGG - Intergenic
1015349840 6:132204879-132204901 ACATTTTTTCATATGTTTGTTGG + Intergenic
1015446808 6:133315663-133315685 ACATTTTTACTTCTATTTCAAGG - Intronic
1015566000 6:134572241-134572263 GCATTTTTCCATATGTTTCTTGG - Intergenic
1015607700 6:134976136-134976158 GCATTTTTTCATATGTTTCTTGG - Intronic
1015718970 6:136221164-136221186 GCATTTTTTCAAATGTTTCTTGG + Intergenic
1016304365 6:142668093-142668115 AAAGTTTTACAAATGTTTCTAGG - Intergenic
1016586169 6:145689176-145689198 ACATTTTTAAAAGTCTTTCATGG + Intronic
1016855695 6:148668537-148668559 GCATTTTTTCATATGTTTCTTGG + Intergenic
1017351679 6:153450088-153450110 ACATTTTTCCATATGGTTCTTGG - Intergenic
1018049158 6:159993017-159993039 ACATTTTTACATATGCTTGTTGG + Intronic
1018265692 6:162022438-162022460 ACATTTTTAAATATGTTTGTTGG + Intronic
1018439690 6:163799723-163799745 GCATTTTTTCATATGTTTCTTGG - Intergenic
1018492443 6:164307773-164307795 ATATTTATACAGATGCCTCAGGG - Intergenic
1018649597 6:165981720-165981742 GCATTTTTACAGAAGTTTGATGG - Intronic
1019561548 7:1661624-1661646 ACATTGTTTCAGAGGTTCCAAGG + Intergenic
1020389646 7:7644193-7644215 ACATTTTTTCAGATTTTTATTGG + Intronic
1020757322 7:12219000-12219022 TCATTTTTACAGATTATTCTTGG - Intronic
1020757414 7:12220508-12220530 ACATCTTTTCAAATGTTTAAAGG - Intronic
1021293405 7:18873980-18874002 ACATTTTTAAATATTTATCATGG - Intronic
1021624583 7:22580175-22580197 ATATTTAAACAGATGTTTAATGG - Intronic
1021639053 7:22720595-22720617 ACATTTTTTCATATGTATCTAGG - Intergenic
1022432048 7:30333765-30333787 ACATTTTTTCATATGTTTGTTGG + Intronic
1022961853 7:35434607-35434629 ACATTTTTCCATATGTTTGTTGG - Intergenic
1023159147 7:37280579-37280601 GCATTTTTTCATATGTTTCTTGG - Intronic
1023213876 7:37839409-37839431 TCATTTTTAAAAATGTTTTATGG - Intronic
1023383222 7:39629342-39629364 ACATGTTTTCATATGTTTAAGGG + Intronic
1023538154 7:41236010-41236032 TCATTTTTACCGATGTGTAATGG - Intergenic
1023677518 7:42646109-42646131 ACATATTTACAAATGACTCATGG + Intergenic
1023721620 7:43101042-43101064 CCATTTTTATAAATGTTTCTTGG + Intergenic
1023789584 7:43742704-43742726 ACTTTTTTTCATATTTTTCATGG - Intergenic
1024445490 7:49473516-49473538 ACATGTTTGGAAATGTTTCAGGG + Intergenic
1024793727 7:52997373-52997395 AAATTTTTACATATATTTCTAGG + Intergenic
1025711777 7:63917767-63917789 CTATTTTTACTGATGTTTTATGG + Intergenic
1027519279 7:79183311-79183333 ATATTTTTACATATGTTTATGGG - Intronic
1028113861 7:86975496-86975518 ACCTTTTAATAGATGTTTTAAGG - Intronic
1028255822 7:88596616-88596638 ACATTTTTCCATATGTTTTTGGG - Intergenic
1028306977 7:89278110-89278132 GCATTTTTTCATATGTTTCTTGG + Intronic
1028502299 7:91532855-91532877 ACATTTTTCCATATGTTTGTTGG - Intergenic
1028657225 7:93222422-93222444 AAATATTTACAAGTGTTTCATGG + Intronic
1030032042 7:105378459-105378481 ACATCTTTTCATATGTTTCTTGG - Intronic
1030617061 7:111748786-111748808 ACATTTTTGTACATGTTTCCTGG - Intronic
1030676102 7:112387291-112387313 ACATTTTTTCAAATGTTCTATGG - Intergenic
1030786364 7:113668184-113668206 ACATTTTTTCATATGTTTGTTGG - Intergenic
1030947102 7:115737316-115737338 AAATTTTTACAGAAGTGCCAAGG + Intergenic
1031191427 7:118556853-118556875 ACATATTTAGACCTGTTTCATGG - Intergenic
1031611539 7:123833341-123833363 ACATTTTTTCATATGTTTGATGG + Intronic
1031736028 7:125362966-125362988 AAAATTTTACAGATATATCATGG - Intergenic
1031739484 7:125411679-125411701 ATATTCTTTCAGAAGTTTCATGG - Intergenic
1031791365 7:126108918-126108940 ATTTTTTTTCATATGTTTCATGG - Intergenic
1032213450 7:129937407-129937429 ACAGTTTTTCAGATATATCATGG + Intronic
1032365733 7:131297660-131297682 ACATTTTGAAAGTTGTTCCAAGG - Intronic
1033441608 7:141385193-141385215 ACACTGTTCCTGATGTTTCATGG + Intronic
1033812667 7:145034470-145034492 ACATTTTTTCACATGTTTGTTGG + Intergenic
1033939550 7:146635517-146635539 ACACTTTCAGAGATGTTTTATGG - Intronic
1034012416 7:147544131-147544153 AGATTTTTACAGATCTCTGATGG - Intronic
1034848011 7:154465587-154465609 ACTTTTTTTCATATGTTTCTTGG - Intronic
1035069728 7:156134032-156134054 ACATTTTTTCATATGTTTCTTGG - Intergenic
1036730324 8:11257207-11257229 ACACCTTTACAGATATTCCAGGG + Intergenic
1036993214 8:13624210-13624232 ACATTTTTTCATATGTTTATTGG - Intergenic
1037036255 8:14171222-14171244 ACATTTTGACACATGTATCAGGG + Intronic
1037159109 8:15745564-15745586 ACATTTTTTCATATGTTTACTGG + Intronic
1037164603 8:15811409-15811431 ACAGTTTCACAGATGTTTAGGGG + Intergenic
1037984752 8:23282999-23283021 CTATTTTTACATTTGTTTCAAGG + Intronic
1038362830 8:26899774-26899796 GCATTTTTTCATATGTTTCACGG + Intergenic
1038710262 8:29937576-29937598 ACATTTTTCCATATGTTTGTTGG - Intergenic
1038947336 8:32375639-32375661 AGATTTTTCCAGATGTTCAAAGG - Intronic
1039535017 8:38302070-38302092 ATATTTTTTGAAATGTTTCAGGG - Intronic
1039738436 8:40357343-40357365 ACATTTTTTCATATGTTTCTTGG - Intergenic
1040075656 8:43226502-43226524 ACATTTTTTCATATGCTTCATGG + Intergenic
1040631800 8:49222394-49222416 ACATTTGTATAGAAGCTTCAAGG + Intergenic
1040700017 8:50051927-50051949 AAATTTTTAAAAATATTTCATGG + Intronic
1040985311 8:53287387-53287409 ATATTATTACAGTTGTTTCTGGG + Intergenic
1041038083 8:53816258-53816280 ACATGTTCAAAAATGTTTCACGG + Intronic
1041329204 8:56705344-56705366 ACATTTCTATACATGTTTCTTGG + Intergenic
1041488779 8:58409391-58409413 ATATCTGTACAGATGTTTCTCGG + Intergenic
1041498284 8:58511027-58511049 AACTGTTTACAGATTTTTCATGG + Intergenic
1042637141 8:70890182-70890204 ACATTTTTTCATATGTTTGTTGG + Intergenic
1042660506 8:71149509-71149531 ACATGTTTAGAGATGGTACAAGG + Intergenic
1042708171 8:71684493-71684515 ACATTCTTACTGATGTGACATGG + Intergenic
1043196025 8:77292665-77292687 ACATTTATACAGATGTTCAAAGG - Intergenic
1043343556 8:79271539-79271561 ACATTTTTACAGAGTTTAAAAGG + Intergenic
1043518920 8:81023870-81023892 AAATTCTTACAGACTTTTCATGG - Intronic
1043537339 8:81220285-81220307 ACATTTTTTCATATGTTTGTTGG + Intergenic
1043594575 8:81869442-81869464 ACATTTTTTCATATGCTTCTTGG - Intergenic
1043628046 8:82289095-82289117 ACATTTTTTCACATGTTTGTTGG + Intergenic
1043628856 8:82300935-82300957 ACATTTTTTCATATGTTTGTTGG + Intergenic
1043670363 8:82877315-82877337 ACATTTTCACAGGTATGTCATGG + Intergenic
1043816450 8:84807776-84807798 GCATTTTTTCATATGTTTCTTGG + Intronic
1044502172 8:92970562-92970584 ACTTTTTTTCATATGTTTCTTGG + Intronic
1044889611 8:96819508-96819530 GCAATTTTACAAAAGTTTCAAGG - Intronic
1044910567 8:97054153-97054175 ACATTTTTTCATATGTTTGTTGG - Intronic
1044953600 8:97457050-97457072 ACCTTTTTTTAGATGTTTCTTGG - Intergenic
1044955989 8:97481303-97481325 GCATTTTTCCATATGTTTCTTGG - Intergenic
1045121765 8:99045313-99045335 ACATTTTTTCATATGTTTGTTGG + Intronic
1045359874 8:101423147-101423169 ATATTTTTACATATAGTTCAGGG + Intergenic
1045669875 8:104538446-104538468 AAATTTTTAGAGAAATTTCAAGG + Intronic
1045715502 8:105038898-105038920 ACATTTTTTCATATGTTTGTTGG - Intronic
1045745130 8:105409406-105409428 ACATTCTTTCAGATGATTCTGGG - Intronic
1045844603 8:106618769-106618791 ACATTTAAACAAATGTTTAAGGG - Intronic
1046033346 8:108809885-108809907 ACATATTTTCAGATGTCTCAGGG - Intergenic
1046985728 8:120386321-120386343 ACATTTTTTCATATGTTTGTTGG + Intronic
1047540146 8:125756907-125756929 ACATTTTTTCATATGTTTATTGG + Intergenic
1047884470 8:129233677-129233699 ACATTTTTTCATATGTTTGTTGG - Intergenic
1048245537 8:132793342-132793364 AGAGTTTTTCAGATATTTCAAGG - Intronic
1048688113 8:136927144-136927166 ATATTCTTAAAGATGTTTTAAGG - Intergenic
1048893539 8:138968454-138968476 ACATTTTAACATATGTCTCTGGG - Intergenic
1049134942 8:140888709-140888731 AGATTTTAACAGATGTGCCATGG - Intronic
1050070562 9:1808619-1808641 AGATTTTTATTGATTTTTCAAGG + Intergenic
1050212164 9:3272658-3272680 ACACTTTTAGAGATGTCTCTTGG - Intronic
1050752268 9:8953728-8953750 ACATTTTTTCATATGTTTGTGGG - Intronic
1050794305 9:9517892-9517914 AGATTATTACAATTGTTTCAAGG - Intronic
1050822513 9:9898148-9898170 ACAGTTTTAAATATGTTTTAGGG + Intronic
1050894499 9:10870288-10870310 ATATTTTTACAAATCTTTCAAGG + Intergenic
1051294426 9:15580610-15580632 ACATTTTTTCATATGTTTTTTGG - Intronic
1051775358 9:20626280-20626302 ACTTTTTTACAGCTCTTTTAGGG + Intergenic
1051793433 9:20835572-20835594 ACATTGCTACTGATGTTTCAAGG + Intronic
1052595765 9:30556601-30556623 AAATTTTTACAGAAGTGTAAAGG + Intergenic
1052777501 9:32747360-32747382 ACATTTTTACCAATGGCTCATGG + Intergenic
1053341649 9:37341010-37341032 ACATGTTTACATTTCTTTCAGGG + Intronic
1053375693 9:37604474-37604496 ACATATTTCCAGTTCTTTCAGGG - Intronic
1053384741 9:37678053-37678075 ACATTTGTCCAGATGTGTCGTGG + Intronic
1053605382 9:39653154-39653176 ACATTTTTTCATATGTTTGTTGG + Intergenic
1053863299 9:42409781-42409803 ACATTTTTTCATATGTTTGTTGG + Intergenic
1054248160 9:62689262-62689284 ACATTTTTTCATATGTTTGTTGG - Intergenic
1054562275 9:66723787-66723809 ACATTTTTTCATATGTTTGTTGG - Intergenic
1054752502 9:68922162-68922184 ACATTTTAAAAGATGTAGCAGGG + Intronic
1054821555 9:69526451-69526473 ACATTTTTTCATATGTTTCTTGG - Intronic
1055120334 9:72652613-72652635 TCATTTTTACAGACGTTCCCCGG - Intronic
1055540541 9:77300022-77300044 ACATTGTTACACATGTGGCATGG - Intronic
1056036607 9:82612977-82612999 ATATTTTTAAACATATTTCAAGG - Intergenic
1056175624 9:84032157-84032179 TTATTTTTACAGATGTTTTCAGG + Intergenic
1056437192 9:86586142-86586164 ACATTTTAAGAGAGGATTCAAGG - Intergenic
1058358624 9:104114224-104114246 ACATTTCAACAAATGTTTAAAGG - Intronic
1058388477 9:104466119-104466141 AGCTATTTACAGATTTTTCAGGG + Intergenic
1058784694 9:108375340-108375362 ACAGTTTTTCAGCTGTCTCATGG + Intergenic
1059088565 9:111331984-111332006 ACATTTTTTCATATGTTTTGTGG - Intergenic
1059208993 9:112493821-112493843 ACATTTTTAAAGATAGTTGAGGG - Intronic
1059537183 9:115091986-115092008 GCATTTTTACAGAGGTCTGAGGG + Intronic
1059581415 9:115552781-115552803 TAATTTTTAAAGATGTTTCAGGG - Intergenic
1059706659 9:116830212-116830234 ACATTTTTTCATATGTTTGTGGG - Intronic
1059861090 9:118462822-118462844 GGATTTTAACAGATGTTTGAAGG + Intergenic
1059937551 9:119326326-119326348 ACATTTTTACAGTTGATTTGTGG - Intronic
1186360307 X:8834455-8834477 ACAAGTTTCCAGATGTTGCAGGG + Intergenic
1186683686 X:11901860-11901882 ACATTTTTTCATATGTTTGTTGG + Intergenic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187589274 X:20698522-20698544 GCATTTTTTCATATGTTTGATGG - Intergenic
1187990092 X:24861063-24861085 GCATTGTAATAGATGTTTCAGGG - Intronic
1188234419 X:27709405-27709427 ACTTCTTTACAGTTGATTCAAGG + Intronic
1188735652 X:33711687-33711709 GCATTTTTTCATATGTTTGATGG - Intergenic
1188754366 X:33943048-33943070 TAATTTTGAAAGATGTTTCAAGG + Intergenic
1188889988 X:35598124-35598146 ACATTTTTCCATATGCTTCTTGG - Intergenic
1189195846 X:39151862-39151884 AAATTTTTTCAAATGTTTCAGGG - Intergenic
1189499593 X:41543976-41543998 TCATTTTTTCATATGTTTAATGG + Intronic
1189754624 X:44258507-44258529 ACTTTTTTTCATATGTTTCTTGG - Intronic
1189864285 X:45308492-45308514 ACATTTTTTCATATGTTTATTGG + Intergenic
1190659544 X:52642128-52642150 ACATTTTTCCATAGGTTCCATGG - Intergenic
1191075966 X:56453641-56453663 ACATTTTTTCACGTGTTTTATGG + Intergenic
1191146513 X:57171520-57171542 ACATTTTTTCATATGTTTCTTGG + Intergenic
1191261476 X:58326792-58326814 GCATTTTTTCACATGTTTCTTGG - Intergenic
1191964239 X:66739671-66739693 GCATTTTTTCATATGTTTGATGG + Intergenic
1192073828 X:67969807-67969829 ACATTTTTTCATATGTTTGTTGG - Intergenic
1192264177 X:69527612-69527634 ATATTTTAACAAATGCTTCAGGG + Intronic
1192348741 X:70336619-70336641 GCATTTTTTCATATGTTTAAGGG + Intronic
1192499944 X:71644120-71644142 ACATTTTTTCATATGTTTCTTGG + Intergenic
1192690683 X:73359899-73359921 ACATTTTTTCATATGCTTCTTGG + Intergenic
1192863554 X:75106339-75106361 ACATTTTTTCATATGTTTGTTGG - Intronic
1193429463 X:81383011-81383033 ACATTTTTTCATATGCTTCTTGG + Intergenic
1193878570 X:86894775-86894797 ACATTTTTTCATATGTTTGTTGG + Intergenic
1194039998 X:88929054-88929076 ACATTTTTTCATATGTTTGTTGG - Intergenic
1194068592 X:89292428-89292450 ACTTTTTTTCATATGTTTCCTGG - Intergenic
1194225686 X:91254250-91254272 ACATTTTTTCATATGTTTGTTGG + Intergenic
1194454206 X:94081982-94082004 ACATTTTTTCATATGTTTGTTGG - Intergenic
1194799252 X:98251318-98251340 ACTTTTTTTCATATGTTTGATGG + Intergenic
1194866019 X:99068228-99068250 ACATTTTTACATAAATATCAGGG - Intergenic
1194869378 X:99109325-99109347 ACATTTTTTCACATGTTTGTTGG - Intergenic
1194877735 X:99209859-99209881 ACAGATTTACAGTGGTTTCAGGG + Intergenic
1194885132 X:99305415-99305437 ACATTTTTACAAACATTTCCTGG - Intergenic
1195142228 X:101973317-101973339 ACATTTTTTCAAATGTTTGTTGG + Intergenic
1195247118 X:103004842-103004864 CCAGTCTTACAGATGTTTGAAGG - Intergenic
1195400540 X:104456904-104456926 ACATTTTTTCATATGTTTGTTGG - Intergenic
1196233891 X:113256675-113256697 ACATTTTTTCATATGTTTCTTGG + Intergenic
1196874117 X:120141869-120141891 ACATTTTTTCAAATGTTTGTTGG + Intergenic
1197050949 X:122059042-122059064 AAAGTTTTAAAGATGTTGCATGG + Intergenic
1197102919 X:122677886-122677908 ACATTTTTAAATATGTTTGTCGG - Intergenic
1197109992 X:122761424-122761446 GCATTTTTTCATATGTTTCTTGG - Intergenic
1197261338 X:124321675-124321697 CCATTTTGATAGATGTTTAATGG + Intronic
1197538025 X:127715361-127715383 ACATTTTTAGAAATTTTTAATGG - Intergenic
1197674907 X:129318681-129318703 ACAATTTTACAGATGTGGCATGG - Intergenic
1197687554 X:129457821-129457843 ACAATCTTTCACATGTTTCAAGG + Intronic
1198452117 X:136777322-136777344 GCATTTTTTCATATGTTTCTTGG - Intronic
1198494368 X:137176506-137176528 ACATTTTTTCATATGCTTCTTGG + Intergenic
1198584447 X:138105179-138105201 GCATTTTTTCATATGTTTCCTGG - Intergenic
1198748150 X:139911352-139911374 ACATTTTTGCATATGTTTATGGG - Intronic
1198842348 X:140871650-140871672 ACATTTTTTCATATGTTTGTTGG + Intergenic
1198890187 X:141385819-141385841 ACATTTTTTCATATGTTTATTGG + Intergenic
1199153018 X:144511561-144511583 ACATTTGTACATTTGTTACATGG - Intergenic
1199586717 X:149422938-149422960 ACAGTTTTTCAGCTGTCTCATGG - Intergenic
1199670359 X:150142094-150142116 ACTTTTTTTCATATGTTTCTTGG + Intergenic
1199842551 X:151664841-151664863 ACATTGGTACTGATGTTTCAAGG - Intronic
1200562229 Y:4719137-4719159 ACATTTTTTCATATGTTTGTTGG + Intergenic
1200722737 Y:6626583-6626605 ACTTTTTTTCATATGTTTCCTGG - Intergenic
1200942586 Y:8801092-8801114 ACATTTTTTCATATGTTTCTTGG + Intergenic
1201671966 Y:16532810-16532832 ACATCTGTACAGATGTTATAAGG + Intergenic
1201790127 Y:17830597-17830619 GCATTTTTTCATATGTTTCTTGG - Intergenic
1201811427 Y:18075392-18075414 GCATTTTTTCATATGTTTCTTGG + Intergenic
1201941393 Y:19464121-19464143 ACATTTTTACATATATATGATGG - Intergenic