ID: 960797063

View in Genome Browser
Species Human (GRCh38)
Location 3:121498632-121498654
Sequence AGGATTGGACTACTATTGAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960797063_960797067 1 Left 960797063 3:121498632-121498654 CCAATCAATAGTAGTCCAATCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 960797067 3:121498656-121498678 AAACATAGGTGTAACCTAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960797063 Original CRISPR AGGATTGGACTACTATTGAT TGG (reversed) Exonic
910497437 1:87847716-87847738 AGGAATGGACCACTGCTGATGGG + Intergenic
915096067 1:153463459-153463481 AGGATAGGACTATTATTGCTGGG - Intergenic
918702803 1:187626599-187626621 AGGATAGTCCTGCTATTGATAGG - Intergenic
924388437 1:243523654-243523676 AGGATTGGATTAAAATTAATTGG - Intronic
1063606933 10:7530881-7530903 TTGATTGGACAAATATTGATGGG + Intergenic
1066740437 10:38514720-38514742 AGGAATGGACTCGTATTGAATGG + Intergenic
1066743117 10:38578228-38578250 AGGATTGGACTATAATGGAATGG + Intergenic
1066970708 10:42310056-42310078 AGGACTGGACTACAATGGAACGG - Intergenic
1066970934 10:42311774-42311796 AGGATTGGACTCGAATTGAATGG - Intergenic
1077929586 11:6717094-6717116 AGGCTTGGACAACTATTTGTAGG + Intergenic
1080712368 11:34761459-34761481 AGTATTGGACTCTTTTTGATTGG + Intergenic
1095365345 12:41397455-41397477 AGGGTTGGATTATTACTGATTGG - Intronic
1100610002 12:96183999-96184021 AGGAGGTGACTACTATTGAGAGG + Intergenic
1101990712 12:109482297-109482319 AGGATTGAACAATTATTTATTGG - Intronic
1111210216 13:85068593-85068615 AGTTTTGGACAACTATTGGTTGG + Intergenic
1117080224 14:52144059-52144081 AGGATTGAAAAACTATTTATTGG - Intergenic
1126527485 15:49672883-49672905 AGGATTTAACAAATATTGATTGG + Intergenic
1143395192 17:6589076-6589098 AGTATTGTACTTCTATTGTTAGG + Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1203180366 17_KI270729v1_random:51914-51936 AGGAATGGAATAGTATTGAATGG + Intergenic
1153120218 18:1715206-1715228 ACAAATGGGCTACTATTGATGGG - Intergenic
1158355259 18:56611558-56611580 AGGATAGGACTACTAATTATAGG + Intronic
1165960648 19:39531722-39531744 AGGATTGGAAGGCTATTGAGAGG - Exonic
926484465 2:13437775-13437797 AGGAGTGGACTAATATGGTTTGG - Intergenic
928839420 2:35587287-35587309 AGGTTAGCACTAGTATTGATGGG + Intergenic
931010655 2:57908933-57908955 AGGTTTTGGCTACTTTTGATTGG - Intronic
933572172 2:84026521-84026543 AGACTTGGAATAGTATTGATGGG + Intergenic
939317492 2:140570163-140570185 AGGATAGAAATACTATAGATTGG + Intronic
940549998 2:155141752-155141774 AGGATGGGGCTACTGTTGGTAGG - Intergenic
942028692 2:171936579-171936601 AGAATTGGACTGCTGTTAATGGG + Intronic
943966376 2:194339099-194339121 AGGATTTGGCTGCTATGGATAGG + Intergenic
1171925227 20:31183682-31183704 AGGAATGGACTCCAAATGATTGG + Intergenic
1171930656 20:31225987-31226009 AGGATTGTACTACAATGGAATGG + Intergenic
1179821248 21:43938631-43938653 AGTATTGGATGACTATTTATAGG - Intronic
950249799 3:11454886-11454908 AGGATAGCACTACTATAGAGAGG + Intronic
954741407 3:52753836-52753858 TGGTTTGGACTAATATTCATAGG + Intronic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
966475228 3:180336846-180336868 ATTATTTGACTACTATTGAATGG - Intergenic
975695597 4:77009701-77009723 ATATTTGGACTACTATTGAGAGG + Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979629542 4:122884758-122884780 AGGAGTGGACTAGTATTGTGAGG + Intronic
983033601 4:162835275-162835297 AGGATGGGGCTATGATTGATAGG - Intergenic
983296848 4:165876960-165876982 AGGAATGGATTACTACTGTTAGG + Intronic
987655576 5:20801099-20801121 AGGGTTGGAATACTATAGTTTGG + Intergenic
988433613 5:31148411-31148433 AGGATTGTAATACTAATAATCGG - Intergenic
994847561 5:105009338-105009360 AGGATAGCAATACTATTGCTTGG + Intergenic
995725551 5:115178278-115178300 ATAAATGGACTACTCTTGATAGG - Intronic
996421406 5:123267018-123267040 AGGCCTGGACAAGTATTGATGGG + Intergenic
998991715 5:147824311-147824333 AGGACTGGACTACTATTTTAAGG - Intergenic
1005027541 6:21477887-21477909 ACAATTGGACTACAAGTGATTGG - Intergenic
1020493697 7:8821574-8821596 AGGAGTGGAATACTATGGTTTGG - Intergenic
1020634522 7:10680336-10680358 AGCATTGGAATACTGATGATAGG - Intergenic
1033602925 7:142901691-142901713 CGGCTTGGACGCCTATTGATTGG - Intergenic
1041860471 8:62507416-62507438 AGAATTGAACAACTATTGATGGG - Intronic
1048760778 8:137792685-137792707 AGGCTTGGACTGCTAATGACTGG - Intergenic
1050660898 9:7881372-7881394 AGTATGGGCCTACGATTGATTGG + Intronic
1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG + Intronic
1051924656 9:22309301-22309323 TGGATTAGCTTACTATTGATAGG + Intergenic
1053125588 9:35578137-35578159 AGGTTAGCTCTACTATTGATAGG - Intergenic
1059617754 9:115969074-115969096 AGTATTGGACTAATATACATAGG - Intergenic
1203726985 Un_GL000216v2:57900-57922 TGGATTGGACTACAATGGAACGG - Intergenic
1203343635 Un_KI270442v1:15960-15982 AGGAATGGAATGCAATTGATTGG + Intergenic
1189099844 X:38177413-38177435 AGGACTGGACAACTTTTGACTGG - Intronic
1192250694 X:69411170-69411192 AGGCTTGGGATACAATTGATTGG - Intergenic
1192742145 X:73903912-73903934 AGGATTGGACTCCTGATCATAGG + Intergenic
1197478935 X:126959123-126959145 ATGATTGAAATACTATTGAATGG + Intergenic
1201137254 Y:10999383-10999405 TGGAATGGAATACAATTGATTGG - Intergenic
1201216140 Y:11724202-11724224 AGGAATGGACTAAAATTGAGTGG + Intergenic