ID: 960797067

View in Genome Browser
Species Human (GRCh38)
Location 3:121498656-121498678
Sequence AAACATAGGTGTAACCTAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960797063_960797067 1 Left 960797063 3:121498632-121498654 CCAATCAATAGTAGTCCAATCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 960797067 3:121498656-121498678 AAACATAGGTGTAACCTAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 187
960797061_960797067 23 Left 960797061 3:121498610-121498632 CCCATAAACAGAAAAATCGATAC 0: 1
1: 1
2: 1
3: 31
4: 352
Right 960797067 3:121498656-121498678 AAACATAGGTGTAACCTAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 187
960797062_960797067 22 Left 960797062 3:121498611-121498633 CCATAAACAGAAAAATCGATACC 0: 1
1: 0
2: 2
3: 12
4: 253
Right 960797067 3:121498656-121498678 AAACATAGGTGTAACCTAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960797067 Original CRISPR AAACATAGGTGTAACCTAAA AGG Exonic
900153506 1:1192904-1192926 AAAAATAGGTGGAAAGTAAAGGG - Intronic
902227477 1:15005800-15005822 AAAAATTGTTTTAACCTAAAGGG + Intronic
902964059 1:19985256-19985278 CAACATAGGTGTAAACTTAAAGG - Intergenic
902966145 1:20004505-20004527 ACACATAGGTGCAAAATAAAGGG + Intergenic
904109201 1:28112177-28112199 AAACAGAGATGTCAACTAAATGG + Intergenic
906174202 1:43755686-43755708 AAACATAGTTGGAATCAAAAAGG + Intronic
908636128 1:66167179-66167201 AAACATAGGTGTAAACTTGCTGG - Intronic
910004408 1:82378614-82378636 AAGCATAGGTGGAAGGTAAATGG + Intergenic
910573499 1:88732925-88732947 ATTCATAGGTGGAATCTAAAAGG + Intronic
911535542 1:99095529-99095551 AAAAATAGGTGTATACTGAATGG - Intergenic
913009849 1:114671808-114671830 AAGCATAGGTGTAACCCTGATGG - Intergenic
915976376 1:160393115-160393137 AAAAATAGGTTAAAGCTAAAGGG - Intergenic
918585319 1:186180620-186180642 TAACATTGGTTTAACATAAACGG - Intronic
922350290 1:224729666-224729688 AATCAAAGTTGTAAGCTAAAGGG - Intronic
922407577 1:225331911-225331933 AAACATGGGTGGAACCACAAAGG + Intronic
923263862 1:232293664-232293686 AAATATAGGTGTAATCAAAAAGG - Intergenic
1064181692 10:13121989-13122011 AAACTTAGCTGTGTCCTAAAAGG + Intronic
1065173106 10:23051451-23051473 ATACATTGGTTTGACCTAAAAGG - Intergenic
1066171135 10:32847769-32847791 AAATACATGTGTAACATAAATGG + Intronic
1066268513 10:33799202-33799224 AAACTTAGGTGTGATCAAAAGGG + Intergenic
1066751467 10:38661453-38661475 ACACATAGGTTCAACATAAAGGG + Intergenic
1066965569 10:42261639-42261661 ACACATAGGTTCAACATAAAGGG - Intergenic
1069176516 10:65295855-65295877 AAATAAAGTTGAAACCTAAATGG - Intergenic
1071338276 10:84619922-84619944 AAATATATGTGTAACTGAAAGGG - Intergenic
1073013300 10:100378379-100378401 AAAACTAGGTGGAACCTAAGAGG - Intergenic
1074340602 10:112625165-112625187 AAACATAGGCGTAGCCACAAAGG - Intronic
1074995033 10:118749472-118749494 AAACAGAGGTCTCACCTAAGTGG + Intronic
1078034994 11:7794350-7794372 ATACATTGGTTTGACCTAAAAGG - Intergenic
1078515320 11:12017050-12017072 AAACATAGCTCAAACCGAAAGGG - Intergenic
1080917602 11:36675665-36675687 ACACATAGGCTTAAACTAAAGGG + Intergenic
1083166193 11:60889629-60889651 AAACACTGGTGTAAGTTAAATGG + Intergenic
1084920222 11:72463515-72463537 AAACAGAGGTGGAAGATAAAAGG - Intergenic
1086294218 11:85346988-85347010 AATCATAGGTGGGACATAAAAGG + Intronic
1088921727 11:114264227-114264249 AAATATGGGTGGAAGCTAAAGGG - Intronic
1089114247 11:116081320-116081342 AAACATAGGTTTCCCCTCAAAGG + Intergenic
1090680109 11:129046647-129046669 ATACTTTGGTGTAACTTAAAAGG + Intronic
1092266325 12:6983525-6983547 AAGCAAAGGGGTAACCTAGATGG + Exonic
1092398689 12:8152621-8152643 AAACATAGGTTCAAAATAAAGGG - Intronic
1092978567 12:13770243-13770265 AAACAAAGCTGTAACCTTGATGG - Intronic
1093716275 12:22386116-22386138 AAAAATAAATGTAAACTAAAAGG + Intronic
1097143137 12:56920072-56920094 TAACATAGGAGTAACCTCACAGG + Intergenic
1098526775 12:71495457-71495479 AAATATAGGTGGAACCTGACTGG - Intronic
1099552162 12:84060171-84060193 AAACAAAGGTGTAACTTTGAAGG - Intergenic
1102429077 12:112867657-112867679 GAAGATAGGTGTAGCCTAACAGG + Intronic
1107093143 13:36504822-36504844 AAACATAGGTGTGATCTGAGAGG + Intergenic
1107286063 13:38793597-38793619 AGAAATAGGTGACACCTAAAAGG + Intronic
1108818607 13:54318959-54318981 GAACATGGATGTTACCTAAAAGG - Intergenic
1108982170 13:56528777-56528799 AAACATATGTGAAAGATAAAGGG + Intergenic
1109541568 13:63784828-63784850 ACACATAGGTTCAACATAAAGGG + Intergenic
1109673623 13:65642513-65642535 AAACAAAAATGTATCCTAAAAGG + Intergenic
1110811251 13:79812701-79812723 AAACCTAAGTGTAAGATAAATGG + Intergenic
1111401331 13:87739679-87739701 AAACATAGGTGATAACCAAAAGG + Intergenic
1112049011 13:95626798-95626820 AGAAATAAATGTAACCTAAAAGG + Intronic
1114144988 14:19964652-19964674 AAACATATGTTTAACATGAAAGG + Intergenic
1116423016 14:44755261-44755283 AAACATAGTTGTTTCCTAAATGG + Intergenic
1116481435 14:45395626-45395648 ACACATAGATGGAAACTAAAGGG + Intergenic
1120143169 14:80951572-80951594 AAACATATGTTTAAAATAAAAGG + Intronic
1124131265 15:26988501-26988523 AAACATAGGTTAAAAGTAAAAGG - Intronic
1125161938 15:36654185-36654207 AAACCTGCGTGTAACCTAAGGGG + Intronic
1125215616 15:37270079-37270101 AAATATAGGTGTTAACTACATGG - Intergenic
1125427108 15:39559970-39559992 AAACATAGGGAGAAACTAAAAGG - Intergenic
1125779278 15:42250135-42250157 AAACATAGGTTCAAAATAAAGGG - Intronic
1126457937 15:48884913-48884935 AAACAATGGTTTAACCTAAAAGG - Intronic
1129626754 15:77208926-77208948 AAACATAGATGTTATCTAAAGGG + Intronic
1134661503 16:15987918-15987940 AAACAGAGGAGTAAACCAAATGG - Intronic
1139165803 16:64563818-64563840 AAACATAGTTGCAACTCAAATGG + Intergenic
1144119558 17:12137778-12137800 AAACAAAGGTATAAGCTTAAAGG + Intronic
1146892523 17:36515181-36515203 AAACATAGGTGTGATCTGTAGGG - Exonic
1148920604 17:51029185-51029207 AAAAATAGATGTAACACAAATGG + Intronic
1149633465 17:58146116-58146138 AAAAATAGGTTTAAAATAAAAGG + Intergenic
1153859091 18:9181664-9181686 CAACATAGGTGTAGCCTCATAGG + Intronic
1155454932 18:26001507-26001529 AAACATAGGTAAAAGTTAAAGGG + Intergenic
1155832643 18:30537497-30537519 AAACATAGATGTAAACAAAAAGG - Intergenic
1157067068 18:44364857-44364879 AAACATAGGTTCAAAATAAAGGG - Intergenic
1157067748 18:44372057-44372079 ACACATAGGTTTAAAATAAAGGG - Intergenic
1158154020 18:54405088-54405110 AAACGTAGTTGTAATATAAAAGG - Intergenic
1159167678 18:64723634-64723656 AAAACCAGGTGTAACCTAAATGG - Intergenic
1164914467 19:32040080-32040102 AAAAATACGTGTAGCCTTAAAGG - Intergenic
927269046 2:21186257-21186279 AAACAGAAGTGTAACGTAAGAGG - Intergenic
928995096 2:37280916-37280938 AAACAGATAAGTAACCTAAATGG + Intronic
932443231 2:71751537-71751559 AGCCATATTTGTAACCTAAATGG + Intergenic
933982568 2:87564837-87564859 AAACATAGATAAAACTTAAATGG + Intergenic
936311273 2:111385955-111385977 AAACATAGATAAAACTTAAATGG - Intergenic
938478563 2:131637321-131637343 ACACATAGGTTTAAAATAAAGGG - Intergenic
939090830 2:137778421-137778443 AAAGATAGGTGTAGATTAAATGG + Intergenic
939401329 2:141698419-141698441 AAATATCAGTGAAACCTAAAGGG + Intronic
939518121 2:143194741-143194763 AAACATAGGGGAAAGCTAAAGGG + Intronic
940894146 2:159064266-159064288 AAATTTAGGTTTCACCTAAAGGG - Intronic
941500249 2:166265273-166265295 ACACATATGTGGAATCTAAAGGG - Intronic
941562413 2:167064047-167064069 AAAACTAGTTGTAACATAAAAGG - Intronic
944866430 2:203866865-203866887 AAACATAGTTGATACCTTAAGGG - Intergenic
947095348 2:226560892-226560914 AAAAATAGGTTTAACATCAAGGG + Intergenic
947865079 2:233391385-233391407 AAACACAGGTGTAAACCAAAAGG - Intronic
947897825 2:233691965-233691987 AAACTTAGGTGTGATCGAAAGGG - Intronic
948003295 2:234586429-234586451 AAACATAGTTGGAACCCCAAAGG - Intergenic
1172798840 20:37562433-37562455 AAACATAGGTGTTACAGGAAAGG + Intergenic
1176137986 20:63533401-63533423 AAACATAGGTGCAATTGAAAGGG + Intronic
1182839820 22:33379837-33379859 AAACTCAGGTATAACCCAAAGGG + Intronic
1184524646 22:45014717-45014739 AAACTCAGGTGTGACCTCAAGGG - Intergenic
949801344 3:7907503-7907525 AAACGAAGGAGTAACTTAAAAGG + Intergenic
950663561 3:14481720-14481742 AAACATACGTGTACCCCAACTGG + Exonic
950941048 3:16891833-16891855 AAACAGAGGTGTCACCATAAAGG - Intronic
952241941 3:31540050-31540072 AAACATAGGTGCAAAGAAAATGG - Intronic
954256191 3:49408746-49408768 AAACAAAGGAATAAACTAAATGG + Intronic
955711567 3:61784414-61784436 AGACATAGTTTTAACCTAATTGG + Intronic
955950722 3:64239682-64239704 AACCATAGGTATAACCTTGAAGG - Intronic
957966866 3:87333250-87333272 AAACATAAGTGAAACTTAATTGG + Intergenic
958493453 3:94809594-94809616 AGACATAGGTCTAAAGTAAAAGG - Intergenic
960797067 3:121498656-121498678 AAACATAGGTGTAACCTAAAAGG + Exonic
964767803 3:160195728-160195750 AAACACAGAATTAACCTAAATGG + Intergenic
965349084 3:167591583-167591605 AAATATATGTGTACCCAAAACGG - Intronic
970833828 4:20376310-20376332 AAAAATAGTTCTAACCTATAGGG + Intronic
971162724 4:24150291-24150313 ACAAGTAGGTGTAACATAAAAGG + Intergenic
975035989 4:69682550-69682572 ACACATAGGTGTAAAATATATGG + Intergenic
975327599 4:73077750-73077772 AAACCTAAGTACAACCTAAAGGG + Intronic
976022826 4:80651134-80651156 AAAAATATTTGCAACCTAAATGG - Intronic
977579422 4:98708251-98708273 AGAAATAGGTTTAACATAAAAGG - Intergenic
978874636 4:113624594-113624616 AAACACAGTAGTACCCTAAAAGG + Intronic
979454172 4:120907762-120907784 CAACATAGGAGCAACATAAAAGG + Intronic
980623486 4:135341661-135341683 AAATATATGTGTAAAGTAAAAGG - Intergenic
982576967 4:157125145-157125167 ACACAGAAGTGTAACCCAAAAGG + Intronic
983431472 4:167656457-167656479 AAGCATAAGTGTCACTTAAAGGG + Intergenic
984580915 4:181509143-181509165 AAGCAAAGGTGTAAACTGAAAGG + Intergenic
985019989 4:185677813-185677835 AAACATAAGTGCATTCTAAATGG - Intronic
985142711 4:186859143-186859165 AAACAGTGGTGAAACTTAAAGGG - Intergenic
986406824 5:7434250-7434272 AAAAAAAGGAATAACCTAAATGG + Intronic
988000166 5:25337628-25337650 AAAAATATCTGTAATCTAAAAGG - Intergenic
988359489 5:30216767-30216789 ATACATAGGTGTAAGATAAATGG + Intergenic
988660059 5:33256361-33256383 AGACATAGCTTTAACATAAATGG - Intergenic
989343082 5:40398733-40398755 AAGCATATAGGTAACCTAAAAGG - Intergenic
989510767 5:42284861-42284883 AAATCTAGCTGTAACCAAAAAGG + Intergenic
992999448 5:82365926-82365948 AACCATAGGTGAAGCCTGAAAGG + Intronic
993578718 5:89633790-89633812 ACACATAGGCTTAACATAAAGGG - Intergenic
993635802 5:90342226-90342248 CAACATAGGTATAATCAAAAGGG - Intergenic
994050800 5:95359869-95359891 AAACATTTTTGTAACATAAATGG - Intergenic
994607420 5:101986725-101986747 AAACATAGGTATAAAATAAGTGG - Intergenic
994609751 5:102020921-102020943 AAACATAGGTTGAAAATAAAGGG + Intergenic
995475264 5:112541228-112541250 ACACATAGGTTCAACATAAAGGG + Intergenic
997451858 5:133990065-133990087 AAACAAGGGTGTATTCTAAAAGG + Intronic
998916901 5:147023506-147023528 AAACATAGGTAAAAAGTAAAAGG + Intronic
1003503507 6:6722001-6722023 AAACATAGGAGAAACCCAAGAGG - Intergenic
1004397676 6:15260392-15260414 AAACTTAGCTGGAATCTAAAAGG + Intronic
1010640473 6:78320211-78320233 AGACATAGTTGTGACCAAAATGG - Intergenic
1011100394 6:83714000-83714022 AAACATAGGTGGAGGCTATAAGG - Intergenic
1011896387 6:92231695-92231717 AAACATATTTGTGACCTCAAGGG + Intergenic
1012089998 6:94879995-94880017 ATAAATATTTGTAACCTAAATGG - Intergenic
1013390482 6:109681219-109681241 AAACATAGGTGCAAAATAAAGGG + Intronic
1014167434 6:118241278-118241300 AAACAGAGATGTAAACAAAAAGG + Intronic
1014283519 6:119467848-119467870 AAAGATAGATGTAGCCTACATGG + Intergenic
1016044377 6:139466199-139466221 AAAAATAAGTCTACCCTAAAGGG - Intergenic
1016553484 6:145309088-145309110 ACACATTGGTTTGACCTAAAAGG - Intergenic
1019910070 7:4094879-4094901 ACACATTGGTTTTACCTAAAAGG + Intronic
1020422773 7:8027747-8027769 AAACATAGACTTAAACTAAAAGG + Intronic
1020437794 7:8184595-8184617 AAACCTAAGTGTATTCTAAAGGG - Intronic
1020827802 7:13053546-13053568 AAACATAGAATTTACCTAAAAGG - Intergenic
1021039800 7:15847492-15847514 AAATATAATTGTTACCTAAAGGG - Intergenic
1022565533 7:31396629-31396651 AAACATAAGTGAAACTTAACTGG + Intergenic
1025989681 7:66487008-66487030 AAACATTAGTGTAACCTTATTGG + Intergenic
1026039071 7:66851645-66851667 AAACATTAGTGTAACCTTATTGG - Intergenic
1027212241 7:76159459-76159481 AAACATTAGTGTAACCTAATTGG + Intergenic
1027576022 7:79932281-79932303 ACACATAGGTTTAAAATAAAGGG - Intergenic
1029427444 7:100505042-100505064 GAACAGTGGTTTAACCTAAATGG + Intergenic
1029837590 7:103329444-103329466 AAACATAAGTGTTAACAAAACGG - Intronic
1030404481 7:109093767-109093789 AAACATAGGTGTATACAGAATGG - Intergenic
1036110880 8:5900676-5900698 AAACCCAAGTGAAACCTAAAAGG + Intergenic
1037185347 8:16056309-16056331 AAACAGAGGAGAAAACTAAAAGG - Intergenic
1037822813 8:22143296-22143318 ACACATTGGAGTAACCAAAAAGG + Intergenic
1042214715 8:66418564-66418586 TAACATAGGAGTAATCTACATGG + Intergenic
1042571911 8:70174867-70174889 AAACATAAGTGTGAATTAAATGG + Intronic
1042587241 8:70354563-70354585 AAACATAGGCCTAACCCAATGGG + Intronic
1043060131 8:75489676-75489698 ACACACAGGTGCAAACTAAAAGG + Intronic
1045681518 8:104665896-104665918 TAACATAGTTGTCACCAAAAAGG - Intronic
1048605652 8:135965796-135965818 AAACCTAGGTATAACTTCAATGG - Intergenic
1049022221 8:139965253-139965275 AAACACAGGACTATCCTAAATGG - Intronic
1050179669 9:2907035-2907057 AAACATAGGTGTAAAATGCATGG + Intergenic
1051546658 9:18283300-18283322 AAAGATAGGTTTAAAGTAAAAGG - Intergenic
1051558831 9:18416548-18416570 ACACATAGGTTTAAAGTAAAAGG + Intergenic
1051674310 9:19544300-19544322 AAACATAGGCTTAAAATAAAGGG - Intronic
1052179900 9:25512575-25512597 AAACAAATGTATAACATAAATGG - Intergenic
1055333294 9:75206501-75206523 ACACATAGGCTTAACATAAAAGG - Intergenic
1055831664 9:80386355-80386377 AAACATAGGGGAAAACTAATTGG - Intergenic
1057067416 9:92068430-92068452 AAACATTGGTGAGACCTCAATGG - Intronic
1059190439 9:112320983-112321005 ATACAAAGCTATAACCTAAAAGG + Intronic
1062495410 9:136829219-136829241 AAACATAGGTTTGCCCCAAAGGG - Intronic
1185995452 X:4943585-4943607 TAAAATAGGTGGAACCAAAAAGG - Intergenic
1186212375 X:7262916-7262938 ATAGATAGGTGTAAACTAAAGGG + Intronic
1187595617 X:20769133-20769155 AAACATAGGTTAAAAGTAAAAGG + Intergenic
1187640181 X:21279001-21279023 AAACATAGGTTCAAAGTAAAAGG + Intergenic
1188041148 X:25370690-25370712 AAACATATGTATAAACAAAAAGG - Intergenic
1189824336 X:44901855-44901877 AAAAATAGGTTGAAACTAAAAGG - Intronic
1190147522 X:47909329-47909351 TAACAAAGGGGAAACCTAAATGG - Intronic
1192505414 X:71678519-71678541 AAACATAGATGGAAAATAAAGGG - Intergenic
1192819266 X:74626432-74626454 GAACTTTGGTATAACCTAAAGGG + Intergenic
1192829743 X:74739441-74739463 AAACACAGGTAAAACCCAAAAGG + Exonic
1193831426 X:86293814-86293836 AAACATAGGGTTACCCTCAAAGG - Intronic
1194098807 X:89676390-89676412 ACACATAGGTACAACATAAAGGG + Intergenic
1194196509 X:90900804-90900826 ACACATAGGTGAAAAGTAAAGGG - Intergenic
1198254237 X:134911409-134911431 ATACAAAGGTGTAACTGAAATGG + Intronic
1199186792 X:144924779-144924801 AAACTAAGGTGTGACCGAAAGGG - Intergenic
1200451832 Y:3337763-3337785 ACACATAGGTACAACATAAAGGG + Intergenic
1200542355 Y:4475004-4475026 ATACATAGGTGAAAAGTAAAGGG - Intergenic