ID: 960797860

View in Genome Browser
Species Human (GRCh38)
Location 3:121507336-121507358
Sequence CTGTTGATTAGAATTTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960797857_960797860 19 Left 960797857 3:121507294-121507316 CCAATGCTTTGAGCTAGGGGTCA 0: 1
1: 0
2: 1
3: 8
4: 77
Right 960797860 3:121507336-121507358 CTGTTGATTAGAATTTACCATGG 0: 1
1: 0
2: 2
3: 23
4: 221
960797859_960797860 -7 Left 960797859 3:121507320-121507342 CCTTTTGAGCATGAGTCTGTTGA 0: 1
1: 0
2: 3
3: 14
4: 158
Right 960797860 3:121507336-121507358 CTGTTGATTAGAATTTACCATGG 0: 1
1: 0
2: 2
3: 23
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960797860 Original CRISPR CTGTTGATTAGAATTTACCA TGG Intronic
904151613 1:28446348-28446370 CTGGGGATTACAATTTAACATGG - Intronic
906587514 1:46992429-46992451 AAGTTGATTAGAAATAACCAGGG - Intergenic
907976965 1:59440802-59440824 AAGGTGATTAGGATTTACCAAGG + Intronic
908822379 1:68101950-68101972 CTGTTGATTTTCATTTTCCAAGG + Intronic
909169229 1:72273419-72273441 CTGTTGATTATAATTGTCAAGGG + Intronic
909983939 1:82137206-82137228 CTGTTGTTTATAAATTACCTGGG - Intergenic
910467122 1:87511723-87511745 AAGTAGATTAGAGTTTACCAAGG - Intergenic
910640692 1:89458130-89458152 CTGTTGATTAGAATGTACAAGGG + Intergenic
910718872 1:90262978-90263000 CTGGTGGATAGTATTTACCATGG + Intergenic
911834118 1:102594220-102594242 CTATTGTTTATAAGTTACCAAGG + Intergenic
913187145 1:116379286-116379308 CTGGAGAATATAATTTACCAAGG - Intronic
915396350 1:155587772-155587794 CTGTGCTTGAGAATTTACCATGG + Intergenic
916217044 1:162405280-162405302 ATGTTGATGAGAAATTACAAAGG + Intronic
916607215 1:166354813-166354835 CTGTGGGTTGGAATCTACCAAGG + Intergenic
918670092 1:187204092-187204114 GTGTTGAATAAAATTTATCAAGG - Intergenic
921417871 1:214911652-214911674 CTGTAAATTAGGATTTAGCAGGG + Intergenic
921694543 1:218192487-218192509 CATTTGATTTAAATTTACCAGGG - Intergenic
923425408 1:233863969-233863991 CTTTTCATAATAATTTACCATGG + Intergenic
924028211 1:239860113-239860135 CAGATGATTAGAATTTCTCAGGG + Intronic
1064320962 10:14304233-14304255 CTGTTGGTGAGAATGTAGCATGG - Intronic
1065553885 10:26894814-26894836 CTAATGATTAGAATTTCCAATGG - Intergenic
1066191400 10:33059219-33059241 TTGTTGATCAGAATTTAAAAAGG - Intergenic
1066808187 10:39285674-39285696 CTGTTTTTTAGAATCTGCCAAGG - Intergenic
1069257876 10:66357192-66357214 ATGTTTAGTAGAATTAACCAGGG + Intronic
1069523559 10:69146589-69146611 CAGTAGATTAGAGGTTACCAGGG - Intronic
1071171019 10:82864064-82864086 AAGTAGATTAGAAGTTACCAAGG + Intronic
1072471044 10:95713253-95713275 CTGATGATTAGAATTTCCAATGG - Intronic
1073200245 10:101729558-101729580 CTGTTGGTGGGAATTTAACATGG - Intergenic
1073591653 10:104763314-104763336 TTGTTGATTAAAATCTATCAGGG + Intronic
1073685310 10:105746018-105746040 CTGCTGTTTAAAATTTCCCATGG + Intergenic
1074875759 10:117611891-117611913 ATGTAGATTAGAGGTTACCAGGG - Intergenic
1078824513 11:14916099-14916121 CAGTTGATGAGAATTTGTCAAGG - Intronic
1079376700 11:19899356-19899378 CTGGTGATTAGATGTAACCATGG + Intronic
1079495350 11:21037093-21037115 CTGTTTAATAGAAATTTCCACGG + Intronic
1079565901 11:21881993-21882015 TTGTTGATTAGAGGTTACAATGG - Intergenic
1079631419 11:22681785-22681807 CTGTTCTTAAGAATTTGCCATGG + Intronic
1080332352 11:31153960-31153982 CTGGTGATTACAATTCAACATGG - Intronic
1083710196 11:64543157-64543179 CTGGTGGTTAACATTTACCACGG + Intergenic
1084984990 11:72861430-72861452 ATGTTTAGTGGAATTTACCAGGG - Intronic
1085239222 11:75038211-75038233 ATCTAGATTAGAAATTACCAGGG - Intergenic
1086072029 11:82810456-82810478 CAGTTGATTGGACTTTACCCTGG + Intergenic
1086882597 11:92166931-92166953 CTGTTCAGTTGAAATTACCAAGG + Intergenic
1088085683 11:105976710-105976732 CTTTTTAGTAGAATCTACCATGG - Intronic
1088230238 11:107666607-107666629 CTGTTGAATAGTATTTACCATGG + Exonic
1090958200 11:131532666-131532688 CTGTTGGTGAGAATGTACAATGG - Intronic
1091223327 11:133943754-133943776 CGTTTGATTAGTATGTACCAAGG - Intronic
1092821134 12:12354703-12354725 CTGTAGAGTACACTTTACCAGGG - Intergenic
1094774300 12:33705700-33705722 CAATTGTTTAGAATTTACCCTGG + Intergenic
1095076466 12:37933730-37933752 CTGTTTTTTAGAATCTACAATGG - Intergenic
1095079224 12:37977360-37977382 CTGTTTTTTAGAATTTGCGAAGG + Intergenic
1095459063 12:42422756-42422778 CTATTTATTAGAAATTACAAGGG - Intronic
1095730100 12:45497365-45497387 CTGTTCATTATAAATTACCCCGG + Intergenic
1096908136 12:54955033-54955055 CTGTTGGTAAGAATGTAACATGG - Intronic
1098529097 12:71520367-71520389 ATGTAGAATAGAAATTACCAGGG + Intronic
1098928036 12:76375059-76375081 GTGTTAATTTGAATTTTCCAAGG + Intronic
1100172788 12:91994823-91994845 ATATTGATATGAATTTACCATGG + Intronic
1100730309 12:97459651-97459673 CTATGGAATAGAAGTTACCAGGG + Intergenic
1102203983 12:111077596-111077618 CTGTTGATTAGATTTTGAAATGG + Intronic
1102827832 12:115965192-115965214 CTGTGGAGTAGAGATTACCATGG - Intronic
1106097575 13:26661704-26661726 CTGTTGGTGAGAATGTACAATGG - Intronic
1106992714 13:35441350-35441372 CTATAGATTAGAATTTTCAATGG - Intronic
1107786027 13:43958752-43958774 GTGTTGATTTGAACTTCCCATGG + Intergenic
1107905732 13:45059398-45059420 ATGTTGATTAAAATTAAACATGG - Intergenic
1108953778 13:56124304-56124326 ATGTAGATTAGAATTGACCAGGG - Intergenic
1110547834 13:76776251-76776273 CTGTAAATTAGAATGTACTATGG - Intergenic
1110564561 13:76945400-76945422 CTGTTGATCACAATATCCCAGGG - Intergenic
1110740431 13:78989845-78989867 CAGTGGATGAGAATTTATCATGG + Intergenic
1112213032 13:97400425-97400447 CTGATGACTAGAATGTCCCATGG + Intergenic
1117878480 14:60281686-60281708 CAGCTGGTTAGAATTTACCTTGG - Intronic
1118100025 14:62588004-62588026 CTTTTGATTAGTATTTAATATGG + Intergenic
1120376812 14:83719130-83719152 CTGTTGTTTAGAAATTATCCAGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1122733164 14:103816897-103816919 CTGATGAATACAATTTACAAAGG + Intronic
1123669976 15:22646230-22646252 CTGGTGATTTGATTTGACCAAGG + Intergenic
1125243947 15:37612191-37612213 CTGTTGATGAGAATGTAAAATGG - Intergenic
1129200645 15:73996808-73996830 AGGTAGATTAGAAGTTACCAAGG - Intronic
1130147938 15:81289079-81289101 CTGTTGATAAGAATGTAAAATGG - Intronic
1132087161 15:98917801-98917823 AAGTAGATTTGAATTTACCAGGG + Intronic
1135655748 16:24247468-24247490 CAGTAGATTAGAGTTTATCAGGG - Intergenic
1136034735 16:27530603-27530625 CTGTTGACTAGACATCACCAGGG + Intronic
1137808225 16:51327784-51327806 CTGTGGAGTAGAATTGCCCAGGG - Intergenic
1141380975 16:83576602-83576624 CTGTTGGTTAGAATATAAAATGG - Intronic
1144646294 17:16976254-16976276 CTGTTGATCAATATTTCCCAGGG + Intergenic
1149227779 17:54495493-54495515 CTGTTGATTAGAAAGTACCGAGG + Intergenic
1150911164 17:69389102-69389124 CTGTTGATGAGAATGTAAAAGGG - Intergenic
1150983137 17:70166823-70166845 CTGTGGATTAAATTTTTCCAAGG - Intergenic
1152934500 17:83128150-83128172 GTGTTGATCAGGATTTACCAAGG - Intergenic
1153132139 18:1866331-1866353 CTGTTGATTACAATGTAAAATGG + Intergenic
1155418827 18:25631770-25631792 CTGTTGATGAGAATGTAATATGG + Intergenic
1155765929 18:29632569-29632591 CTGTTGATGGGAATTTAAAATGG - Intergenic
1156135818 18:34036219-34036241 CTGTTGATTAGTATTTTGCTGGG - Intronic
1156380526 18:36555865-36555887 CTTTTGATTAGCAATTAACATGG + Intronic
1156390813 18:36648857-36648879 CTCTTGATTAGAAATCACCAAGG - Intronic
1157058604 18:44259658-44259680 CTGCTGATTAGAATCCTCCAGGG - Intergenic
1159415469 18:68142204-68142226 CTGTTCATTAGATTTTAATAAGG - Intergenic
1159731297 18:72032273-72032295 CTGTTGATTATAGATTCCCAGGG - Intergenic
1161758947 19:6156627-6156649 CTTATCATTAGAATTTACCTGGG - Intronic
1166820636 19:45577375-45577397 ATGGTGATTGGAATTTCCCAGGG - Intronic
927612332 2:24553871-24553893 ATGTTTAGTAGAATTCACCAAGG + Intronic
929459623 2:42093221-42093243 CTGTACTTTAGAATCTACCAAGG + Intergenic
930153843 2:48085376-48085398 CTGTTGATGAGAATATACATTGG + Intergenic
931812234 2:65865573-65865595 AAGTTGATTAGCATTTCCCATGG - Intergenic
933046039 2:77538789-77538811 CTGGGGATTATAATTTAACATGG - Intronic
933226856 2:79759692-79759714 CTATTTATTAGAATGTCCCAGGG + Intronic
933611507 2:84440921-84440943 GACTTGAGTAGAATTTACCAGGG - Intronic
936411063 2:112258745-112258767 CAGTAGATTAGAGGTTACCAGGG + Intergenic
936790079 2:116141066-116141088 CTGTTGATCAGAATATACCTGGG + Intergenic
938038654 2:128057274-128057296 CTGGTTATTAGAATTTCCCATGG - Intergenic
940721693 2:157289701-157289723 ATATTGATTATAATTTACAAAGG - Intronic
942476014 2:176321642-176321664 CTGTTGACTAGAATGTAAAAAGG - Intronic
943401489 2:187416905-187416927 CTGTTGATTTGACTTCACCTAGG + Intronic
944394694 2:199253315-199253337 CTGTTCATTAGAATTCATTAGGG + Intergenic
945048751 2:205804103-205804125 GAGTAGATTAGAAGTTACCATGG + Intergenic
947043561 2:225951175-225951197 AGTTTGATTAGAATGTACCATGG - Intergenic
1170211434 20:13849489-13849511 TTGTTGCTTAGAAATCACCATGG - Exonic
1172655955 20:36538420-36538442 CTGTTGATGGGAATTTAAAATGG + Intergenic
1174086135 20:48008664-48008686 CTGTCAGTAAGAATTTACCAAGG + Intergenic
1175057710 20:56213219-56213241 ATGTGTATTAGAATTTATCATGG - Intergenic
1175250010 20:57603569-57603591 CTGTTGCTTATAAATTACCCAGG - Intergenic
1176523314 21:7843728-7843750 GTGTTAGATAGAATTTACCAGGG - Intergenic
1177924170 21:27193463-27193485 CTGTTAATTATAAATTACCTAGG - Intergenic
1178210159 21:30521032-30521054 CAGTTGATTATAATTTAGTAAGG + Intergenic
1178657334 21:34473740-34473762 GTGTTAGATAGAATTTACCAGGG - Intergenic
1178673106 21:34609274-34609296 ATGGTGATTAGTATTTACAAAGG + Intronic
1179200250 21:39211609-39211631 CTGTAGATTAGAAGTTTTCATGG - Intronic
1180993160 22:19950813-19950835 TTGTTGATGTGACTTTACCAAGG - Intronic
1181441272 22:22936268-22936290 CTGCTCATAAGAATTTATCATGG + Intergenic
1182151832 22:28032990-28033012 TTGTTGAGTAATATTTACCAGGG - Intronic
1182282100 22:29223865-29223887 CTCTTGTTTAGCATTTACCCTGG - Intronic
1182309797 22:29396465-29396487 CTGTTTATTATAAATTACCGAGG + Intronic
1184841776 22:47056385-47056407 CGGTTGATTTGACTTCACCATGG + Intronic
949179364 3:1109391-1109413 TTCTTGTTTACAATTTACCAAGG + Intronic
950082790 3:10235270-10235292 CTCTTGATTACCTTTTACCATGG - Intronic
951374478 3:21896538-21896560 CTGTTCATAAAAATATACCAGGG - Intronic
952230010 3:31419801-31419823 CTGCTTATTAGAATTTCCCAAGG - Intergenic
954941592 3:54378011-54378033 GTGTTGACTAGAACTCACCATGG - Intronic
956013836 3:64860118-64860140 TTTTTGCTTAGCATTTACCATGG + Intergenic
957197363 3:77086670-77086692 ATGTTGATTAGAAATGAACAAGG + Intronic
957430615 3:80100912-80100934 GTGGTAATTGGAATTTACCATGG - Intergenic
957905973 3:86555474-86555496 AGGTTGACTACAATTTACCAAGG - Intergenic
958880256 3:99661511-99661533 CTGTTGATGAGAATATAAAATGG + Intronic
960382134 3:116976166-116976188 CTGTTCATGAAAATTCACCAAGG - Intronic
960797860 3:121507336-121507358 CTGTTGATTAGAATTTACCATGG + Intronic
961118040 3:124348584-124348606 CTGTTGATGAGAATGTAAAATGG + Intronic
963482928 3:145899635-145899657 AAGTAGATTAGAAGTTACCAAGG - Intergenic
963659442 3:148105646-148105668 ATGGTGAATAGAATTTACCAGGG - Intergenic
963703543 3:148656993-148657015 CTGTTGTTTGGAATTTTCCATGG - Intergenic
964380959 3:156098710-156098732 CTGGTGCTTAGAACTTGCCAGGG + Intronic
965259677 3:166466147-166466169 CTGTTGAGTAGAAAGTGCCAAGG + Intergenic
966065195 3:175812972-175812994 CTGTTGATTATAAATTAGCATGG - Intergenic
968173855 3:196531766-196531788 ATGTTGAATAGAATTAATCAAGG + Intergenic
970081349 4:12290333-12290355 CTTTTCTTTAGAATCTACCAAGG - Intergenic
971336510 4:25728404-25728426 CTGTTGATGAGAATGGCCCATGG - Intergenic
971601869 4:28602424-28602446 CTGCTGAGTAGAATTTTCAAAGG - Intergenic
972210631 4:36832220-36832242 CCGTTGATTAGAAATGACAAAGG + Intergenic
972294764 4:37726280-37726302 ATTTATATTAGAATTTACCATGG - Intergenic
972662459 4:41129436-41129458 CTGTTGATTTGGACTTCCCAAGG - Intronic
972926120 4:44009565-44009587 CTGTTTATTAAAATTAACAAAGG - Intergenic
973881767 4:55280156-55280178 ATGTTTGGTAGAATTTACCAGGG + Intergenic
974233774 4:59153151-59153173 CTGATAATTAGAATCTCCCATGG - Intergenic
975751292 4:77526523-77526545 ATGTAGATTTGAAATTACCATGG - Intronic
975957011 4:79853254-79853276 CTGTTGCTTAGAATTTGTGATGG + Intergenic
978018205 4:103774821-103774843 CTTTAGATTATAATCTACCAAGG + Intergenic
978559105 4:110012746-110012768 CTGTAGATTAAAATTTCACATGG + Intergenic
980867594 4:138571560-138571582 CTGTTGATTAAAATTAACAAAGG + Intergenic
981255034 4:142650981-142651003 CTGTTCATTTGCATTTGCCAAGG - Intronic
982255547 4:153447974-153447996 CTGTAGAATAGAATTTGCCATGG - Intergenic
984993793 4:185408236-185408258 CAGTTGATTATAATTTAAAACGG + Intronic
988394709 5:30681914-30681936 GTGTTGATTAGAATGTTCCAAGG + Intergenic
988425863 5:31063467-31063489 CTGTTGATTCAAATTCATCAAGG - Intergenic
988720293 5:33870667-33870689 CTGGGGATTACAATTTGCCATGG - Intronic
988728794 5:33949649-33949671 ATGTTGATTTGAATTAACAATGG + Intronic
989132458 5:38121118-38121140 AAGTAGATTAGAAGTTACCAAGG - Intergenic
990656025 5:57956321-57956343 CTCTTGAATAAACTTTACCAAGG - Intergenic
990852494 5:60222803-60222825 CTGTTAATAAGCATTAACCATGG + Intronic
992089689 5:73305971-73305993 CTGTTCATTAGAATTAGCCAGGG + Intergenic
992457124 5:76926159-76926181 ATGATGATTAGAATTCACCCAGG + Intergenic
992488330 5:77216819-77216841 CTGTTGATTGGGGTTTTCCAGGG + Intronic
993358931 5:86948844-86948866 CTGTTGTTTACTATTTAACATGG - Intergenic
995403992 5:111773604-111773626 ATTTTGATTATAATGTACCAAGG - Intronic
996924377 5:128806829-128806851 CTTTTGATTAGTATTAACAAGGG + Intronic
997836998 5:137202934-137202956 TTGTTGATTAGAATGCAACAAGG - Intronic
1001446078 5:171784574-171784596 CTGTTAATGAGAATGTACAATGG + Intergenic
1004900725 6:20191329-20191351 CTATTGTTTACAATTTACCCGGG + Intronic
1004997181 6:21204965-21204987 AAGTAGATTAGAAGTTACCAGGG - Intronic
1007466375 6:42054502-42054524 AAGTAGATTAGAAGTTACCAGGG - Intronic
1009564648 6:65297814-65297836 CAGTTGTTTTGAATTTACCTAGG - Intronic
1010744488 6:79545486-79545508 CAGATTATTTGAATTTACCAAGG - Intergenic
1012387313 6:98697214-98697236 CTTTTGGTTAGAATTTCACAGGG + Intergenic
1012586179 6:100925559-100925581 CTGTTGATGGGAATATAACATGG + Intergenic
1014336090 6:120139442-120139464 ATTTTAATTAGTATTTACCAAGG - Intergenic
1014415815 6:121182866-121182888 CTGTTAATTTGGATTTAACACGG - Intronic
1014862685 6:126488757-126488779 CTGTTAATGAATATTTACCATGG + Intergenic
1017149978 6:151270627-151270649 CTGCTGGTTAGAATTTAAAATGG - Intronic
1018735308 6:166683400-166683422 CTGTAGATTATAATTGATCATGG - Intronic
1021965081 7:25909967-25909989 CTGTTGATTATTATTTGCCTAGG - Intergenic
1022059873 7:26782907-26782929 CTGTTGATTATAAGTTACCCAGG + Intronic
1022883578 7:34617882-34617904 CTGTTGATGAGAATGTAAAATGG + Intergenic
1023491426 7:40746674-40746696 CAGTTGATTGAAATTTTCCACGG - Intronic
1023790797 7:43751836-43751858 CTGATGATTAGAAGTTGGCATGG + Intergenic
1023916678 7:44595128-44595150 GTGTTTGATAGAATTTACCAGGG - Intergenic
1024315965 7:48016786-48016808 CTGTTGTTTATAAATTACCCAGG - Intronic
1030302346 7:107987268-107987290 AAGTTGATTAGCAGTTACCAGGG + Intronic
1032949397 7:136889940-136889962 CTGTTGACTAGGATTTTCCAGGG + Intronic
1035471836 7:159115207-159115229 CTGTCGAGTAGAATTTCCCATGG - Intronic
1036596927 8:10221711-10221733 CTGTTGATTAAAATAAAGCAGGG + Intronic
1036756005 8:11471548-11471570 CTGGTGATTAGTATGTACCATGG + Intronic
1037378822 8:18262401-18262423 CTGATAATTAGAATTTCCAAGGG - Intergenic
1038306759 8:26410646-26410668 CTGTTGTTTAGAAATTTGCAAGG + Exonic
1040345862 8:46492797-46492819 CTGTTTTTTAGAATTTGCAAAGG - Intergenic
1040348243 8:46532977-46532999 CTGTTTTGTAGAATTTACAAAGG + Intergenic
1042689055 8:71476303-71476325 CTCTTAATTAGAATTTATCTGGG - Intronic
1043129477 8:76442725-76442747 ATGTTAATTTCAATTTACCATGG - Intergenic
1043671256 8:82887832-82887854 AAGTAGATTAGAAGTTACCAGGG + Intergenic
1043685602 8:83082847-83082869 CTCTTGATTTTAATTTACTATGG + Intergenic
1046792661 8:118338761-118338783 CTGTTGCTTGGAAATTAACAGGG + Intronic
1048744171 8:137594684-137594706 ATGTTGATGACTATTTACCAGGG - Intergenic
1051572284 9:18572914-18572936 CTTCAGATTAAAATTTACCATGG - Intronic
1052000701 9:23276209-23276231 AAAATGATTAGAATTTACCAAGG - Intergenic
1052342360 9:27376568-27376590 CTGTGCATTAGAATTATCCAGGG + Intronic
1052571300 9:30227698-30227720 CTGGGGATTACAATTTAACATGG - Intergenic
1052728449 9:32258373-32258395 CTGCAGATGAGCATTTACCAAGG - Intergenic
1055919573 9:81444588-81444610 CTGTTGATGAGAATGTAGAATGG + Intergenic
1056315481 9:85385524-85385546 CTGTTGTTTATAAATTACCTAGG - Intergenic
1060043307 9:120320287-120320309 CTGTTGTTTATAAATTACCCTGG - Intergenic
1062224972 9:135444870-135444892 CTGTTGATGAGAATATAAAATGG + Intergenic
1186624802 X:11281665-11281687 ATGTTTATTATAATTTAACAGGG + Intronic
1186887505 X:13929264-13929286 CTAATCATTAGAAGTTACCAAGG + Intronic
1189094861 X:38127363-38127385 ATGTTGATTAGAATTGACCTGGG + Exonic
1189202190 X:39205980-39206002 CTATTCATTAGAATGTATCAGGG + Intergenic
1190170678 X:48109481-48109503 CTGTTGATGAGAAATGAGCATGG - Intergenic
1191025240 X:55907458-55907480 CTGTTGAACAGATTTTAGCAGGG + Intergenic
1191568558 X:62574543-62574565 CTTTTTGTTAGAATCTACCAGGG + Intergenic
1191854289 X:65610279-65610301 AAGTAGATTAGAAGTTACCAGGG - Intronic
1192555689 X:72087325-72087347 AAGTTGACTAGAAGTTACCAGGG + Intergenic
1193098148 X:77577217-77577239 CTGTTGGTTAGAATGTAAAATGG - Intronic
1194673309 X:96763256-96763278 CAGGTGATTAGAATTTAGCCTGG + Intronic
1195036925 X:100978859-100978881 TTTTTGATTTGAAGTTACCATGG + Intronic
1195878041 X:109562848-109562870 CTGATGATTAGAATTTCCAATGG - Intergenic
1196908411 X:120461445-120461467 CTGTATACTATAATTTACCATGG - Intronic
1197576731 X:128221882-128221904 CTGTTGGTGAGAATGTACAATGG + Intergenic
1197693748 X:129529178-129529200 CTGTTCATTATCATTTATCAGGG + Intergenic
1197902421 X:131388682-131388704 ATGTTGATTATAATTTAACATGG - Intronic
1197965773 X:132060060-132060082 CTGTTGAATTGAATCTAACATGG - Intergenic
1198547634 X:137709805-137709827 GTGTTAATTTGAATTTTCCAGGG - Intergenic
1198647654 X:138827158-138827180 CTGTTCATTAGAAGTTTCCAGGG - Intronic
1199393340 X:147306913-147306935 CTGAGGATTAGAATTCATCACGG + Intergenic