ID: 960798530

View in Genome Browser
Species Human (GRCh38)
Location 3:121514083-121514105
Sequence CTGTGGGAGGCCAAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960798522_960798530 11 Left 960798522 3:121514049-121514071 CCAGGCATGGTGGCTCATGCCTG 0: 8252
1: 39501
2: 100261
3: 172981
4: 199558
Right 960798530 3:121514083-121514105 CTGTGGGAGGCCAAGGTGGACGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
960798525_960798530 -8 Left 960798525 3:121514068-121514090 CCTGTAATTCCAGCACTGTGGGA 0: 90
1: 14432
2: 313545
3: 258591
4: 143399
Right 960798530 3:121514083-121514105 CTGTGGGAGGCCAAGGTGGACGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960798530 Original CRISPR CTGTGGGAGGCCAAGGTGGA CGG Intronic
Too many off-targets to display for this crispr