ID: 960798609

View in Genome Browser
Species Human (GRCh38)
Location 3:121514734-121514756
Sequence TAGCTCTGTGTACCTGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 2, 2: 3, 3: 16, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960798608_960798609 -2 Left 960798608 3:121514713-121514735 CCAGCATGCAGATCTTGGTGGTA 0: 4
1: 3
2: 4
3: 19
4: 132
Right 960798609 3:121514734-121514756 TAGCTCTGTGTACCTGCCAGTGG 0: 1
1: 2
2: 3
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960798609 Original CRISPR TAGCTCTGTGTACCTGCCAG TGG Intronic
905446068 1:38029209-38029231 GAGCTCTGGGGACCTGGCAGGGG - Intergenic
909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG + Intergenic
909155407 1:72068433-72068455 TTCCTCTGACTACCTGCCAGTGG + Intronic
910509058 1:87983521-87983543 TGTCTCTGTGTTCCGGCCAGGGG + Intergenic
912578511 1:110698258-110698280 TAGCTCTGAGTACCAGGAAGAGG - Intergenic
915844264 1:159247249-159247271 TAGCTCTGTGTACCTTCCAGTGG - Intergenic
916775227 1:167955162-167955184 TATCTCTGTTCACCTGTCAGTGG + Intronic
917090080 1:171343919-171343941 TAGATTTGTGTGCCTGGCAGAGG - Intergenic
917337306 1:173938789-173938811 CAGCTCTCTGAACCTGTCAGAGG - Exonic
918108741 1:181437105-181437127 TTTCTCTGTGCACTTGCCAGAGG + Intronic
918164403 1:181930719-181930741 TAACTTAGTGTACCTTCCAGAGG + Intergenic
918505104 1:185245359-185245381 TATCTCTGAGGACCTTCCAGTGG - Intronic
919135118 1:193497930-193497952 GTGCTCTGTGCAGCTGCCAGTGG + Intergenic
920952775 1:210587895-210587917 TAGGTATGTGTACATTCCAGTGG + Exonic
1072294955 10:93999877-93999899 TGGCCCTCTGTAACTGCCAGTGG + Intronic
1072746439 10:97942318-97942340 CAGCTCTTTGTACCTTCCACGGG - Intronic
1075937526 10:126355817-126355839 TATCTCTGTGTATCTTCCAGTGG + Intronic
1078623831 11:12935139-12935161 TAGCTCTTGCTACCTGGCAGAGG + Intronic
1081640328 11:44748874-44748896 TAGCTCTCTGTCCCTGGAAGTGG - Intronic
1083861208 11:65421284-65421306 TAGCCCTGTTTCTCTGCCAGGGG - Intergenic
1085128228 11:74016549-74016571 TGGCTCTGTGTACAGGGCAGGGG + Intronic
1085146651 11:74205559-74205581 TAGCACTTTGTTCCTGGCAGCGG + Intronic
1086439202 11:86811687-86811709 TAGCTCAGTCTACCTGCTTGGGG + Intronic
1089693935 11:120204713-120204735 TAGCCCTGTGTACCTGGCACTGG - Intergenic
1096445107 12:51682747-51682769 TAGGACTGTGTATCTGCCACTGG + Intronic
1097842803 12:64338325-64338347 CAGCTATGTCTACCTGCCAGAGG - Intronic
1098518135 12:71402505-71402527 TAGCTCTCTGAACCTGGCAGGGG - Intronic
1099589905 12:84574340-84574362 GAGCTCTGTGTCTCTGACAGAGG - Intergenic
1099934011 12:89104452-89104474 TGCCTCTGTGAACCTGCCATAGG - Intergenic
1100408339 12:94290626-94290648 TTGCTCTGTGTTCCTCCCTGTGG + Intronic
1102017181 12:109655695-109655717 TAGCTCTGTGAACATGTCAGTGG + Intergenic
1104254771 12:127126388-127126410 TGGCTCTGTGTTCCTGTCGGAGG + Intergenic
1105432079 13:20345515-20345537 GTCCTCTGTGTCCCTGCCAGTGG + Intergenic
1109392255 13:61708457-61708479 TATTTATGTTTACCTGCCAGAGG + Intergenic
1113442732 13:110341752-110341774 CAGCTCTGTCTCGCTGCCAGAGG + Intronic
1117971187 14:61252400-61252422 TTGCTCTGAGTTCCTGACAGAGG + Intronic
1119923863 14:78473020-78473042 TACCTCTCTCTACTTGCCAGGGG - Intronic
1119947676 14:78712200-78712222 TAGCCCTGTGGACCTGTGAGGGG + Intronic
1120002831 14:79323064-79323086 TAGCTCTGTTGCCCTGCCAGAGG + Intronic
1120182050 14:81353838-81353860 TAGCTCTGTGTACTTGACAGTGG + Intronic
1121916851 14:97843404-97843426 TAGCTCTTTGAAGCGGCCAGTGG - Intergenic
1122548392 14:102537471-102537493 TAGGTCTGAGGACCTGCCTGGGG - Intergenic
1123025884 14:105423797-105423819 TTGCTCTATATACTTGCCAGTGG + Intronic
1125501312 15:40241642-40241664 AAGCTCTGTGCACCTGAGAGGGG + Intronic
1125683044 15:41544801-41544823 GAACGCTGTGTCCCTGCCAGGGG - Intergenic
1131818864 15:96251118-96251140 CAGCTCTGTTTACCTGCCCCAGG - Intergenic
1134512735 16:14861510-14861532 TTGATTTGTGTACCTGTCAGAGG - Intronic
1134700373 16:16260004-16260026 TTGATTTGTGTACCTGTCAGAGG - Intronic
1134880653 16:17742877-17742899 TGTGTCTGAGTACCTGCCAGTGG - Intergenic
1134971453 16:18534657-18534679 TTGATTTGTGTACCTGTCAGAGG + Intronic
1141623212 16:85248054-85248076 CAGCTCTGTCCACCTGCCTGTGG + Intergenic
1143080657 17:4378998-4379020 TGGATTTGTGTACCTGGCAGAGG + Intergenic
1145414554 17:22703988-22704010 CAGCTCTGTGTTGCGGCCAGCGG - Intergenic
1148778945 17:50110983-50111005 AAGCTGTGTGTCCCTCCCAGTGG + Exonic
1150205733 17:63405246-63405268 TCGCCCTGCTTACCTGCCAGTGG - Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1151988669 17:77560048-77560070 TAGCTAAGCGTCCCTGCCAGGGG + Intergenic
1152011566 17:77721987-77722009 CAGCCCTGTGTACCTCACAGAGG + Intergenic
1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG + Intergenic
1157500490 18:48187047-48187069 TTGATCTGTGTCCCTGGCAGAGG + Intronic
1159859183 18:73626951-73626973 TAGCACTTTGTACCTACCACGGG - Intergenic
1160243132 18:77137039-77137061 CAGCGCTGTGCTCCTGCCAGGGG - Intergenic
1160525561 18:79533527-79533549 TAGCACTGTTTTCCTGGCAGGGG + Intergenic
1165129819 19:33624716-33624738 GAGCTCTGAGTTCCTGCCAGAGG + Intronic
1166786101 19:45368200-45368222 TAGCTCTTTGTACATGCTAAGGG + Intronic
1167368943 19:49069527-49069549 TAGCTCTGTGATTCTTCCAGGGG - Exonic
1167621917 19:50565552-50565574 TGTGTGTGTGTACCTGCCAGGGG + Intronic
1167894110 19:52567301-52567323 AAGGTATGTCTACCTGCCAGTGG - Intronic
925251438 2:2442238-2442260 TGTCTCTGTGAACCTTCCAGTGG - Intergenic
926571689 2:14536320-14536342 AAGCTCTGTAAACATGCCAGAGG - Intergenic
931999913 2:67875751-67875773 TAGCTCTGTGTAACTGGCAATGG - Intergenic
933603735 2:84360073-84360095 TGGCTCTGTGTTGCTCCCAGGGG - Intergenic
934710567 2:96511402-96511424 TAGATCTGTGTCCCTCCCCGGGG - Intergenic
935954618 2:108363280-108363302 TAACTCTGTGTACCTGTCAGTGG - Intergenic
936824055 2:116558858-116558880 TATCTCTCTCTACCTGACAGAGG - Intergenic
939685437 2:145193023-145193045 TAGCTCTATGTACCAACCAAGGG + Intergenic
940005792 2:149008412-149008434 TACCTCTGTGGACCTGAAAGTGG + Intronic
941252395 2:163182198-163182220 TAGCTCTGGCTCCTTGCCAGTGG + Intergenic
941782530 2:169460507-169460529 TCACTCTGTGTACCTGCGTGTGG - Intergenic
942327392 2:174787634-174787656 TATCTCTGTGCTGCTGCCAGAGG - Intergenic
943440006 2:187916534-187916556 TAGCTCTGCATACCTGCCAATGG - Intergenic
948263790 2:236622977-236622999 TGACTCTGTGTTCCTCCCAGGGG - Intergenic
948359455 2:237409085-237409107 TAGCTCTGTGGCCCTGTCACTGG + Intronic
948467100 2:238157941-238157963 AAGCACTGTGTACCCACCAGGGG + Intergenic
1172652475 20:36513610-36513632 AACCTCTGTGTACCTTCCATTGG + Intronic
1173446350 20:43122327-43122349 TGGCTCTGTGTGCCAGACAGAGG - Intronic
1177948289 21:27500826-27500848 TGACCCTGTGTGCCTGCCAGTGG + Intergenic
1178484153 21:33006499-33006521 AAGCACTTTGTACATGCCAGGGG + Intergenic
1180731766 22:17987614-17987636 TTGCTCGGAGTACCTGCCATAGG - Intronic
1182471511 22:30551268-30551290 TTGCTCTGTGACCCTGGCAGAGG + Intergenic
1183115198 22:35686456-35686478 GTGCTCTGTGCACCTGCCAAGGG + Intergenic
951577902 3:24132265-24132287 TTGCTCTGTATACCTTCAAGAGG - Intronic
956638157 3:71386985-71387007 GAGCTCTGTGTACCAACCAAAGG + Intronic
959845721 3:111030983-111031005 TTGGTCTTTGTACCTGACAGAGG + Intergenic
960798609 3:121514734-121514756 TAGCTCTGTGTACCTGCCAGTGG + Intronic
963734192 3:149001652-149001674 TAGCACTGGGGACCTGCCATTGG + Intronic
965470671 3:169086648-169086670 TAGCTCAGTGTGCCTGACTGAGG + Intronic
966321727 3:178708353-178708375 TAGCTCTCTGTGCCTGGCATTGG + Intronic
968451783 4:679346-679368 CAGCTCTGTGGTCCTGCCTGGGG - Intronic
969556858 4:7917778-7917800 TGGTTCTGTGTACCTGCCCGGGG + Intronic
970037389 4:11753173-11753195 TGGCCCTGTGTACCTGCCAGTGG - Intergenic
974680480 4:65154729-65154751 TAGCTCAGTGTAACTGCCTATGG + Intergenic
976768059 4:88619093-88619115 TTGCTCTGTGTTCCTTCCTGTGG + Intronic
980926055 4:139139485-139139507 TAGTTCTTTGGAACTGCCAGCGG + Exonic
981043128 4:140241526-140241548 AAGCACTGTCTACGTGCCAGGGG - Intergenic
982206335 4:152999879-152999901 TGGCACTGGGCACCTGCCAGGGG - Intergenic
984119911 4:175729348-175729370 CAGATCTGTGTACTTGCCACCGG - Intronic
986049656 5:4076917-4076939 TAGCTCTCTATACCTGCCACTGG - Intergenic
990963058 5:61415106-61415128 TAGCTCTGTGTTGCAGCCATAGG - Intronic
992573525 5:78085780-78085802 TTTCTCTGTGTATCTGTCAGTGG - Intronic
993629693 5:90270898-90270920 TAGCTCTGTTTAGCTGACTGGGG - Intergenic
995764529 5:115601749-115601771 TGGCTCTGTGTGCCTGGCAGGGG + Intronic
996073541 5:119161888-119161910 TAGCTCTGTGTTCCTGCCAGTGG - Intronic
996622300 5:125521907-125521929 TAGCCCTGTGAAGTTGCCAGAGG + Intergenic
997475301 5:134139144-134139166 CAGCTCTGTTTAGATGCCAGGGG + Intronic
997589698 5:135065174-135065196 TGTCTCTGTGTTCCTGCCTGGGG + Intronic
998587586 5:143443620-143443642 TGGCTCTGTGTAAAAGCCAGTGG + Intergenic
998823254 5:146075935-146075957 TAGCACTGTCTACAGGCCAGGGG - Intronic
999515334 5:152296464-152296486 TAGCTCAGTGTACCAGTCAGGGG + Intergenic
1002833379 6:844538-844560 GAGCTCTGAGTACCTCCTAGAGG + Intergenic
1006197679 6:32255791-32255813 TGGCTCTGTGTCGCTCCCAGGGG + Intergenic
1012074454 6:94667525-94667547 TAATTCTGTGTATCTGCCTGCGG - Intergenic
1012358547 6:98347621-98347643 TAGCTTTGTGTATCTGCCCTAGG - Intergenic
1014323170 6:119957494-119957516 TAGCTCCTTATCCCTGCCAGCGG + Intergenic
1015311712 6:131774046-131774068 TTGCTATGTGTAGCTGCCAAAGG - Intergenic
1016833263 6:148453546-148453568 CAGCTCTGTTTATCTGCAAGGGG + Intronic
1018048000 6:159981584-159981606 TAGCTCTGTGTTCCTGGTGGTGG + Intronic
1019210509 6:170401123-170401145 CAGCCCTGGGTCCCTGCCAGGGG + Intronic
1020280344 7:6647088-6647110 TGGCTGTGGGTGCCTGCCAGTGG + Intronic
1023154799 7:37238113-37238135 TGGCTCTGTGTCCCTGCCAAAGG + Intronic
1024618928 7:51140659-51140681 TAGCTCCTTGTCCCTGTCAGTGG - Intronic
1026453306 7:70548598-70548620 TAGTTCTGTGTTCCTGCATGTGG + Intronic
1026652328 7:72226349-72226371 TAACTCTGCCTACCTGGCAGGGG + Intronic
1027501542 7:78958050-78958072 TTGCTATGTTTACCTGGCAGGGG + Intronic
1028365277 7:90021881-90021903 AAGCTCTGTGTACTTGGAAGAGG - Intergenic
1028485152 7:91349259-91349281 TACCTCTGTGCTCCTGGCAGGGG - Intergenic
1028625790 7:92875584-92875606 TAGCTGTGTATTCCTGCCAATGG + Intergenic
1037126797 8:15361556-15361578 TAGCTCTCTTTACCAGTCAGTGG - Intergenic
1040439258 8:47424063-47424085 CAGCCTTGTGTGCCTGCCAGTGG + Intronic
1041208522 8:55523207-55523229 CAGCTCTGTGTGACTTCCAGGGG + Intronic
1041399219 8:57423889-57423911 TAGATCTGTGTCCATGCCAATGG + Intergenic
1041738272 8:61133626-61133648 TAGCTGTGTATCTCTGCCAGAGG + Intronic
1044501580 8:92964944-92964966 TTGCACTGTAAACCTGCCAGAGG + Intronic
1044843678 8:96359784-96359806 TACCTTTGTCTCCCTGCCAGAGG - Intergenic
1044875012 8:96656818-96656840 TGGCTCTATGTTCCTCCCAGTGG - Intronic
1047855083 8:128900894-128900916 TGTCCCTGGGTACCTGCCAGTGG + Intergenic
1049770774 8:144380008-144380030 TGGCTCAGTGAACCTGGCAGGGG + Intronic
1051199143 9:14597741-14597763 TTGCTGTGTGTGGCTGCCAGTGG - Intergenic
1056274798 9:84983687-84983709 TAGTTTTTTGTACCTGACAGTGG - Intronic
1058271035 9:102971630-102971652 AAGCTCTATGTATCTGCCAGTGG - Intergenic
1060749995 9:126162734-126162756 TGGCTCTGTTTCCCTCCCAGAGG + Intergenic
1060788839 9:126471774-126471796 TAATTCTGTGTACCTGCCCGGGG - Intronic
1190434608 X:50410978-50411000 CTGCTCTGTGTTCCTGCCAATGG + Intronic
1195458860 X:105100982-105101004 TAGCTCTGTGGGCCTGCCCATGG + Intronic
1197630104 X:128848579-128848601 TGGCTCTGTGTGCCTGCAAAAGG + Intergenic