ID: 960801572

View in Genome Browser
Species Human (GRCh38)
Location 3:121545666-121545688
Sequence GGCAACGGGGGCAGCTCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960801572_960801588 23 Left 960801572 3:121545666-121545688 CCGGCGGAGCTGCCCCCGTTGCC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 960801588 3:121545712-121545734 CACCTGCAGCTGCGGCCTTCAGG 0: 1
1: 0
2: 2
3: 29
4: 213
960801572_960801576 -10 Left 960801572 3:121545666-121545688 CCGGCGGAGCTGCCCCCGTTGCC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 960801576 3:121545679-121545701 CCCCGTTGCCCGCGGCCTCCCGG 0: 1
1: 0
2: 1
3: 17
4: 272
960801572_960801581 -2 Left 960801572 3:121545666-121545688 CCGGCGGAGCTGCCCCCGTTGCC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 960801581 3:121545687-121545709 CCCGCGGCCTCCCGGGTTCCTGG 0: 1
1: 0
2: 4
3: 66
4: 1446
960801572_960801586 15 Left 960801572 3:121545666-121545688 CCGGCGGAGCTGCCCCCGTTGCC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 960801586 3:121545704-121545726 TCCTGGAGCACCTGCAGCTGCGG 0: 1
1: 0
2: 3
3: 51
4: 433
960801572_960801578 -9 Left 960801572 3:121545666-121545688 CCGGCGGAGCTGCCCCCGTTGCC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 960801578 3:121545680-121545702 CCCGTTGCCCGCGGCCTCCCGGG 0: 1
1: 0
2: 3
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960801572 Original CRISPR GGCAACGGGGGCAGCTCCGC CGG (reversed) Intronic