ID: 960807553

View in Genome Browser
Species Human (GRCh38)
Location 3:121598674-121598696
Sequence TGGTGGAGATGGAAAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 1, 2: 9, 3: 93, 4: 720}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960807541_960807553 26 Left 960807541 3:121598625-121598647 CCCATTGCACTACACCGGGTGAG 0: 1
1: 0
2: 0
3: 5
4: 34
Right 960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG 0: 1
1: 1
2: 9
3: 93
4: 720
960807544_960807553 12 Left 960807544 3:121598639-121598661 CCGGGTGAGCAAGGATGATGCCT 0: 1
1: 0
2: 1
3: 37
4: 225
Right 960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG 0: 1
1: 1
2: 9
3: 93
4: 720
960807550_960807553 -8 Left 960807550 3:121598659-121598681 CCTGGCATTGGGCAGTGGTGGAG 0: 1
1: 0
2: 1
3: 25
4: 297
Right 960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG 0: 1
1: 1
2: 9
3: 93
4: 720
960807542_960807553 25 Left 960807542 3:121598626-121598648 CCATTGCACTACACCGGGTGAGC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG 0: 1
1: 1
2: 9
3: 93
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960807553 Original CRISPR TGGTGGAGATGGAAAGAAGT GGG Intronic
900487457 1:2930102-2930124 TGGTGGAAAAGGAGAGAAGCCGG + Intergenic
900737445 1:4308071-4308093 TGGTGGCGGGGGAAAGAAATAGG - Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
901211527 1:7529115-7529137 TTGTGGATATGGAATGAAGGGGG + Intronic
902606923 1:17573963-17573985 TGGTGAAGAGGAAAGGAAGTTGG + Intronic
902928276 1:19712163-19712185 TGGAGGAGAGGGAGAGAGGTGGG + Intronic
904254744 1:29247819-29247841 CCGTGGAGATGGCAAGATGTTGG + Intronic
904367393 1:30023121-30023143 TTGTGGAGCTGGGAAGGAGTGGG + Intergenic
905045677 1:34998612-34998634 TAATGGAGGTGGTAAGAAGTAGG + Intronic
905401976 1:37710358-37710380 TGGTGCAGATGGAATGAAACAGG - Intergenic
905589285 1:39148060-39148082 TGGGGTAGAAGGAAAGAAGCAGG - Intronic
905689844 1:39934944-39934966 GAGTGGAGATGGAAAGAATGAGG + Intergenic
905961537 1:42046409-42046431 TGATGGGGATGGAAGGGAGTAGG + Intergenic
905971101 1:42143065-42143087 TGCTGGAGATGGAAAGACACAGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906399818 1:45496658-45496680 GGAGGGAGAAGGAAAGAAGTTGG - Intronic
907577368 1:55539396-55539418 TGATGGAGAGAAAAAGAAGTGGG - Intergenic
907646278 1:56246800-56246822 TGGTGAAGATGTAAAGAAATTGG + Intergenic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
907924800 1:58945066-58945088 TGGCAGAGATGGTAAGAAGTGGG + Intergenic
908037068 1:60067297-60067319 TGGTGAAGATGTAGAGAAATAGG - Intronic
908118026 1:60960306-60960328 TGTTTGAGCTGGAAAGAATTTGG + Intronic
908121643 1:60991525-60991547 TGGTAGAGCTGGTGAGAAGTAGG - Intronic
908712559 1:67032924-67032946 TGATGGAGATAGAAAGTAGGTGG - Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909041796 1:70662169-70662191 TGGTGAGGATGTAAAGAATTTGG - Intergenic
909191192 1:72554520-72554542 TGGTGGAGAAAGAATGAAATTGG + Intergenic
909230861 1:73087872-73087894 TGGAGGACATTGAAATAAGTTGG - Intergenic
909815035 1:79982164-79982186 TGGGGGATAGGGAAAGAATTGGG - Intergenic
910024830 1:82637651-82637673 GGGTGGGAAGGGAAAGAAGTGGG + Intergenic
910064134 1:83132652-83132674 TGGTGGAAATGGATAAAAGTGGG - Intergenic
910174952 1:84419369-84419391 TGGAGGAGATGGGAAGAGGTTGG + Intergenic
910604456 1:89067961-89067983 TGGGGGCTATGGAAAGAAGGTGG + Intergenic
910686248 1:89919547-89919569 TTTTGCAGATGGAAAGAAGCAGG + Intronic
910775950 1:90875019-90875041 AGGTGGAGATGGGAGGAAATTGG - Intergenic
911398521 1:97342868-97342890 TGGTGGTGATGGTAAGTGGTAGG - Intronic
912428221 1:109612936-109612958 TGGAAGAGAAGGAAAAAAGTTGG + Exonic
912466291 1:109877230-109877252 TGGTGGAGCTGGAAGGAAGCTGG - Intergenic
912967360 1:114248305-114248327 TGGGGAAGAAGGAAAGAAGGAGG - Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913399815 1:118419025-118419047 TGGTGGAGAAGGCAGGGAGTAGG + Intergenic
913613598 1:120533130-120533152 TGCTGGAGGTTGACAGAAGTAGG + Intergenic
914254491 1:145950304-145950326 TGGAAGAGAGGGAAAGAAGGAGG + Intronic
914372368 1:147039396-147039418 TGCTGGAGGTTGACAGAAGTAGG + Intergenic
914577137 1:148983380-148983402 TGCTGGAGGTTGACAGAAGTAGG - Intronic
914895587 1:151668995-151669017 GGGGGGAGATGGAAATAAGTAGG - Intronic
915736993 1:158091332-158091354 TGGTGGAGAGGGAAGGAAGAAGG - Intronic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
915925701 1:160017599-160017621 TACTAGAGATGGTAAGAAGTGGG - Intergenic
915972298 1:160363295-160363317 TGGAGGAGCTGGGAAGCAGTGGG - Intergenic
915982225 1:160427328-160427350 TGGGGGAGAGGGAAAGGATTTGG + Exonic
916316798 1:163457911-163457933 TGCTGGAAATGGAAAGAAAAAGG + Intergenic
916492630 1:165315349-165315371 GGGTAGAGATGAAAGGAAGTAGG - Intronic
916522467 1:165577068-165577090 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
916808808 1:168286861-168286883 TGGTGAAGATGTAGAGAAATTGG - Intronic
917089509 1:171338478-171338500 TGGATGAGATGGAGAGCAGTAGG - Intronic
917273053 1:173299491-173299513 CGTGGGAGAAGGAAAGAAGTAGG - Intergenic
917700856 1:177579561-177579583 TGGGTGAGATGGGAAGATGTTGG - Intergenic
917873667 1:179265662-179265684 TGGTGAAGATGTAGAGAAATTGG - Intergenic
918123058 1:181556693-181556715 TGGGGCTGATGGGAAGAAGTTGG + Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918458499 1:184752307-184752329 TGGTGGGGAGGGAAAGGGGTGGG + Intronic
918631785 1:186728147-186728169 AGGGGGAAATGGAAAGATGTTGG - Intergenic
919318969 1:196009641-196009663 TGGGGGAAATGGAGAGAGGTTGG + Intergenic
919363442 1:196624978-196625000 TTGTTGGGATAGAAAGAAGTTGG + Intergenic
919733910 1:200932604-200932626 TGGTGGAGATGGAAGCCAGATGG - Intergenic
920402287 1:205683499-205683521 TGATGGAGATGGCAAGAGATGGG - Intergenic
921411920 1:214845172-214845194 TGGAGGAGATGGGAAGTTGTTGG - Intergenic
922132690 1:222795288-222795310 TGGCTGAGATGGCAAGAAGCTGG - Intergenic
922769099 1:228172489-228172511 AGCTGGAGATGGACAGAAGTGGG - Intronic
923132694 1:231091252-231091274 TGGTGAAGGTGGTAAGAACTGGG + Intergenic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
923396124 1:233566496-233566518 AGGTGGGGATAGGAAGAAGTTGG + Intergenic
923556626 1:235005959-235005981 TGGTGGAGGTGGGAGGAAGGTGG - Intergenic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
923964189 1:239118211-239118233 TTGTGTAGGAGGAAAGAAGTAGG + Intergenic
924309896 1:242729350-242729372 TGGTGAGGATGTAAAGAAATTGG - Intergenic
924518037 1:244782348-244782370 TGGGGGAGATGGAAAGGAATTGG - Intergenic
1064250816 10:13705146-13705168 TGGCGGGGAAGGAAGGAAGTCGG - Intronic
1064343050 10:14504142-14504164 TGTTGCATATGGCAAGAAGTGGG + Intergenic
1064484911 10:15776359-15776381 TGGTGAAGATGGGGAGAAATTGG - Intergenic
1064828826 10:19438634-19438656 TGGTGAAGAGGCAAAGAAATAGG - Intronic
1064943324 10:20759080-20759102 AGGTGGAGATGGGGAGATGTTGG + Intergenic
1065119576 10:22515508-22515530 TGGTAGTGAGGGAAAGAAATGGG + Intergenic
1065608512 10:27446615-27446637 AGGAGGAGAAGGAAAGAAGAAGG - Intergenic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067902520 10:50256994-50257016 TTGTGGATATGAAAAGAACTGGG + Intergenic
1068423864 10:56830653-56830675 TGGTGGAAATAGGAAGAAGTAGG - Intergenic
1068795828 10:61078970-61078992 ATGTGGAGATGGAAATGAGTTGG + Intergenic
1068910018 10:62369235-62369257 TGGTGGAGAGGAAAAGAGGTGGG - Intergenic
1069938317 10:71935056-71935078 TGGTGGGGAAGGATGGAAGTGGG - Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070006716 10:72431670-72431692 TGGTGGTGATGCAAAGCAGTGGG - Intronic
1070050766 10:72887389-72887411 TGGTGGAGGGAGAAGGAAGTGGG - Exonic
1071058756 10:81544768-81544790 TGGTGAGGATGTGAAGAAGTTGG + Intergenic
1071233378 10:83615482-83615504 GGGTGGAGCAAGAAAGAAGTGGG + Intergenic
1071239254 10:83686028-83686050 TGGAAGAGCTGGAAAGAAGGTGG + Intergenic
1071263582 10:83943434-83943456 GGGTGGAGATGGGATGGAGTAGG - Intergenic
1071313844 10:84371934-84371956 TGCTGCTGGTGGAAAGAAGTTGG + Exonic
1071770637 10:88725936-88725958 AGCAGGAGATGGAAAGAAATAGG + Intronic
1072518253 10:96208032-96208054 GGGTGGAGAGGGATGGAAGTGGG + Intronic
1073049278 10:100656976-100656998 TGTTGGGGGTGGAAAGAAGATGG + Intergenic
1073165731 10:101448675-101448697 TGGTGGAGATGAACAGAAAATGG + Intronic
1073316787 10:102587338-102587360 TGGTGAGGATGCAAAGAATTTGG - Intronic
1073689225 10:105788954-105788976 TGGTGAAGATGTAAAGAAAAGGG + Intergenic
1073694275 10:105847731-105847753 TGATAAAGATGGAAAAAAGTTGG - Intergenic
1073888531 10:108069818-108069840 TGAAGGAGATGGAAAGGATTTGG - Intergenic
1075559528 10:123458475-123458497 AGGTAGAGAGGGAAAGAAGAAGG - Intergenic
1075609133 10:123837104-123837126 TGATGGTGAAGGAAAGGAGTGGG - Intronic
1076111000 10:127859641-127859663 TGGGGGAGAAGGAAAGATGGGGG - Intergenic
1077279648 11:1736850-1736872 GAGTGGAGCTGGAAAAAAGTTGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078693814 11:13608971-13608993 TGGTGAGGATGTAAAGAAATTGG - Intergenic
1078919679 11:15817868-15817890 AGGTAGAGATGGGAAGAAGATGG - Intergenic
1079106138 11:17573570-17573592 TGGCGGAGGTGGTAAGAAGTGGG - Intronic
1079488134 11:20956967-20956989 TGGTGGAGATGGCAGTAAGGGGG + Intronic
1079600618 11:22308581-22308603 TGGTGAAGATGTAAAGAAACTGG + Intergenic
1080056939 11:27916280-27916302 TAATGGAGATGGAAAGGAGGGGG + Intergenic
1080315348 11:30941125-30941147 TGGAGGTGATGAAAAGTAGTTGG - Intronic
1080941239 11:36921231-36921253 TGGTGAAAAGGGAAAAAAGTGGG + Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081744576 11:45463931-45463953 AGCTGGTGTTGGAAAGAAGTAGG + Intergenic
1081974782 11:47226244-47226266 TGGTGGGGAAGTAGAGAAGTTGG - Intronic
1082136357 11:48553982-48554004 TGGGGAGGATGGAAACAAGTTGG - Intergenic
1083086928 11:60158404-60158426 TGGTGAGGTTGTAAAGAAGTTGG + Intergenic
1083254479 11:61487713-61487735 TGGTGGGCATGGAAAGAACAGGG + Intronic
1083288058 11:61673764-61673786 TGAGGGAAATGGACAGAAGTTGG + Intergenic
1083528333 11:63393895-63393917 TGGGGAGGATGGAAACAAGTTGG - Intronic
1084514573 11:69629520-69629542 TGCTGGAAAGGGAAGGAAGTTGG - Intergenic
1084951703 11:72670007-72670029 TGGTGGAGCAGGAGAGGAGTGGG - Intronic
1084994372 11:72961067-72961089 TGTTGGCGATGGAAAGCATTAGG - Intronic
1085136427 11:74093211-74093233 TGGTGCAGATGTAAAGGGGTGGG + Intronic
1085265944 11:75238190-75238212 TGTTGGAGAAGGAAAGAACATGG + Intergenic
1085302579 11:75467154-75467176 TTGTGGAGATGGAAAGAGCACGG + Intronic
1085472248 11:76765871-76765893 TGGTGAAGATGGGAATGAGTGGG - Intergenic
1085576363 11:77607448-77607470 TGGTCAAGAAGGAAAGAAGGTGG - Intronic
1086356873 11:86010094-86010116 TGGTGGAGATGGGTAGAGGCTGG + Intronic
1086450359 11:86909404-86909426 TGGTGGAGATGAAAGTAAGCAGG + Intronic
1086721486 11:90127132-90127154 AGGAGGAAATGGAAAGTAGTAGG - Intergenic
1087024380 11:93635467-93635489 TGGTGAAGAAGGAAAAAAGGAGG - Intergenic
1087137823 11:94738588-94738610 GGGTGTAGATGGAAAGAAGGTGG + Intronic
1087204039 11:95375277-95375299 TGGTGGAGATAGACAGAAGTGGG + Intergenic
1087281121 11:96211710-96211732 TGGAGCAGATGGAAAGGGGTTGG + Intronic
1087362315 11:97176552-97176574 AGGTGAAGATAGAAAGAAGATGG - Intergenic
1087505166 11:99011759-99011781 TGCTGGAAATGGGAAGAAGCAGG + Intergenic
1088022763 11:105139595-105139617 GGGTGGAGAGAGAAAGAAGAAGG - Intronic
1088061301 11:105654206-105654228 TGGTGGGGCTGGAAAGATGTTGG + Intronic
1088182534 11:107128540-107128562 TGGTGGAAATGGAATTGAGTGGG - Intergenic
1088218948 11:107546531-107546553 TATTTGAGATGGAAAGAAATTGG + Intronic
1088400466 11:109418087-109418109 TCTTAGAGATGGAAAGATGTGGG - Intergenic
1088445873 11:109927675-109927697 TGGAGGAGTTTGAAAGATGTTGG + Intergenic
1088629212 11:111758041-111758063 TAGTGAAGATGGAAAGGATTTGG - Intronic
1088821265 11:113459644-113459666 AGGGGGAGATGGAGAGAGGTTGG + Intronic
1088952019 11:114581410-114581432 TTGTGGTGAGGTAAAGAAGTGGG + Intronic
1089045722 11:115501381-115501403 TGGTGGTGATGGGAAGGAGGGGG - Intronic
1089096180 11:115921948-115921970 AGGCTGAGATGGAAAGAAGAAGG + Intergenic
1089453734 11:118613754-118613776 GGCAGGAGAGGGAAAGAAGTAGG - Intronic
1089507119 11:118971376-118971398 TGGTGGAGATGGAATTACATTGG - Intergenic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089674128 11:120078512-120078534 TCGTGGAGCTGGAATTAAGTAGG + Intergenic
1089938651 11:122392707-122392729 TGAAAGAGATAGAAAGAAGTGGG - Intergenic
1090122470 11:124046539-124046561 TGGGGAAAATGGAAAGAGGTTGG + Intergenic
1090202837 11:124868422-124868444 AGGTGGAGATGGAAACCACTGGG + Intronic
1090473513 11:127000417-127000439 TGCTGGAGTTGGAAGAAAGTCGG - Intronic
1090737958 11:129628263-129628285 TGGTGGAAATAGTAAGAACTAGG - Intergenic
1091076083 11:132618530-132618552 TAGTGAAGGTGAAAAGAAGTGGG - Intronic
1091472207 12:738871-738893 AGGTGGGGAAGGAAATAAGTAGG - Intergenic
1092277894 12:7076131-7076153 GGGTGGAGATGGAATCGAGTTGG - Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092589793 12:9941947-9941969 TGATGGAGTTACAAAGAAGTAGG - Intergenic
1092655802 12:10684431-10684453 CCGTGGAGAGAGAAAGAAGTGGG + Intergenic
1093481015 12:19603922-19603944 TGGAGGGGCAGGAAAGAAGTGGG + Intronic
1093737986 12:22645845-22645867 GGGGGGTGATGAAAAGAAGTTGG - Intronic
1093995002 12:25631396-25631418 TGGTGGAGGTGGCAAGGGGTGGG - Intronic
1094092402 12:26665229-26665251 GGGAAGAGAAGGAAAGAAGTAGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094664923 12:32510194-32510216 TAGTGGGAATGGGAAGAAGTGGG + Intronic
1095292609 12:40492794-40492816 TGGTGTAGAAGGTAAGAAATAGG - Intronic
1095319613 12:40810523-40810545 TGGTGGAAATGGGGAGATGTTGG - Intronic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096263774 12:50108437-50108459 TAGGGGTGATGGACAGAAGTGGG - Intronic
1096843686 12:54393627-54393649 TGGTGGAGATGAAAAGGAGAAGG - Intergenic
1097258338 12:57697396-57697418 TGGAGGTGATGGGAAGTAGTTGG + Intronic
1097595605 12:61625739-61625761 TGATGCAGAGGGCAAGAAGTAGG + Intergenic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098049005 12:66433744-66433766 TGATGGTTTTGGAAAGAAGTGGG + Intronic
1098280513 12:68857619-68857641 TGGTGGAGAAGGGAAAAAATGGG + Intronic
1098298141 12:69025323-69025345 TGGAGGAGATGGAGATAAGCAGG - Intergenic
1098451318 12:70621240-70621262 TGGTGGAGAGTGAGAGAATTTGG + Intronic
1098471844 12:70854157-70854179 TGGTGGTCATGGAAAGAAAAGGG - Intronic
1098605966 12:72389937-72389959 TAGTGGAGGTGGTAAGAAGGGGG + Intronic
1098867744 12:75782090-75782112 TGGCAGGGATGTAAAGAAGTTGG + Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099048079 12:77748730-77748752 TGGGGGAGATGGGGAGATGTTGG + Intergenic
1099095481 12:78370250-78370272 AGGTGGAGATGTCAAAAAGTAGG - Intergenic
1099109112 12:78534954-78534976 TGATAGAGCTGGAAAGAAGGCGG - Intergenic
1100199571 12:92284024-92284046 TCATGGAGATAGAAAGAACTTGG - Intergenic
1100396871 12:94193364-94193386 TAGTGGTGAGGGAAGGAAGTGGG + Intronic
1100731885 12:97479842-97479864 TGTTGGACATGGCAAGCAGTTGG - Intergenic
1100753197 12:97722030-97722052 TGGGGAAGATGGAACCAAGTTGG + Intergenic
1101048386 12:100834959-100834981 TGAAGGAGAAGGAAAGTAGTGGG + Intronic
1101449287 12:104761616-104761638 TGGTTGTGATGGAAAAAGGTTGG - Exonic
1101519479 12:105468299-105468321 AGAAGGAGATGGAAAGAAATGGG - Intergenic
1101741970 12:107507676-107507698 TTGTGGGGATTGTAAGAAGTTGG - Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103806910 12:123580883-123580905 TGGTGGAGGTGGAAAGAGAGAGG - Intergenic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1104329714 12:127833537-127833559 TGGTGGACATGGAGAGATGATGG + Intergenic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1105774713 13:23646920-23646942 TGGTGGAGATGTGGAGAAATTGG - Intronic
1106804050 13:33287829-33287851 GGGTGGAGAGAGAAAGAAGAGGG + Intronic
1107246142 13:38296965-38296987 TGAGGGAAATGGAAAGATGTTGG + Intergenic
1107317542 13:39149995-39150017 AAGTAGAGAAGGAAAGAAGTCGG + Intergenic
1107349263 13:39497155-39497177 TTGTGGAGATTGTAATAAGTGGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108703932 13:52968127-52968149 TGGTGGAGGTGGAGGAAAGTCGG - Intergenic
1108943473 13:55988771-55988793 TGGTGGAAATGGGAAGAAACTGG + Intergenic
1109417345 13:62059186-62059208 TGATGGTGATGGGAAGAATTCGG - Intergenic
1109769909 13:66956843-66956865 GGGGGGAGAGGGGAAGAAGTGGG - Intronic
1110100505 13:71595491-71595513 TAATGGAGAAGGAAAGAAGTAGG + Intronic
1110300806 13:73924556-73924578 TGGAGGAGATGGAAAGAGATAGG - Intronic
1111200522 13:84929364-84929386 TGGTGAAGCTGTAAAGAAATTGG + Intergenic
1111252523 13:85621735-85621757 TGGGGGAAATGGAAGGATGTTGG + Intergenic
1111897855 13:94163323-94163345 AGGTGGAGGTGGAAGGAAGTAGG - Intronic
1112002596 13:95225099-95225121 TGGGGGAGAGGGAGAGAAGAAGG - Intronic
1113144797 13:107196688-107196710 TGGGGGAGATGGGGAGATGTAGG + Intronic
1113171117 13:107504303-107504325 GGGAGGAAATGGAAAGATGTAGG + Intronic
1113237895 13:108301646-108301668 GGGTGGAGGTGAAAAGACGTTGG + Intronic
1113342032 13:109435223-109435245 TTCTGGAGATGTAAAGAAATAGG + Intergenic
1114443425 14:22769433-22769455 GGGAGTAAATGGAAAGAAGTAGG - Intronic
1114523649 14:23354125-23354147 TGGTAGAGATGGAGAGATGTGGG - Intergenic
1114600569 14:23953067-23953089 TGGTGGAAATGCAAAGAACTCGG - Intergenic
1114604803 14:23988211-23988233 TGGTGGAAATGCAAAGAACTCGG - Intronic
1114610253 14:24035777-24035799 TGGTGGAAATGCAAAGAACTCGG - Intergenic
1114678837 14:24465613-24465635 GGGTGGAGATGTTAAGAATTAGG - Intergenic
1114701725 14:24685496-24685518 TGCTGGCGATGGTAAGAAATCGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115842970 14:37492729-37492751 TGGTGTAGATGAAGAGATGTTGG - Intronic
1116633337 14:47360934-47360956 TGGGGGAAATGGGAAGATGTAGG + Intronic
1117521543 14:56556571-56556593 TGGTGGAGATGAACAAAAATGGG - Intronic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1120138676 14:80901763-80901785 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1121642098 14:95492132-95492154 TGGTGAAGATGTAGGGAAGTTGG + Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1122043082 14:99003708-99003730 TTCTGGAGATGGACAGAATTGGG - Intergenic
1122064775 14:99165191-99165213 TCTTGCTGATGGAAAGAAGTCGG + Intergenic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1123055205 14:105566224-105566246 TGGTGGAGGGGGTAACAAGTCGG - Intergenic
1123079654 14:105686068-105686090 TGGTGGAGGGGGTAACAAGTCGG - Intergenic
1123634967 15:22295957-22295979 TGGGGGAGATGGGAAGATATTGG - Intergenic
1124385541 15:29205452-29205474 TGGTGAGGATGTAGAGAAGTTGG - Intronic
1125568274 15:40694522-40694544 TCGAGAAGATGGATAGAAGTGGG - Intergenic
1125787505 15:42333874-42333896 TGGTGGAGGTGGGAGGAAATAGG + Intronic
1126204480 15:46029568-46029590 TGGAGGAAATGGGAAGATGTTGG - Intergenic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1128079561 15:64848184-64848206 TGGTGGAGTGGGAAAAACGTGGG + Intronic
1128496290 15:68200428-68200450 TGGTGGAGGTGGAAGGCAGCCGG + Intronic
1128571424 15:68736255-68736277 TCATGAAGATGGAAAGAAGTGGG - Intergenic
1128663961 15:69524743-69524765 AGAGGGAGATGGAAAGGAGTTGG - Intergenic
1128681009 15:69651616-69651638 TGGTACAGATAGAAAGAAGTAGG - Intergenic
1128682063 15:69659621-69659643 TGGTGGAGCAGGAAAGGAGTAGG + Intergenic
1128849396 15:70937446-70937468 AGGAGGAGAAGGAAAGAATTAGG - Intronic
1129014144 15:72450973-72450995 TGGTGAAGATGCAAGGAAGCTGG - Intergenic
1129146819 15:73655936-73655958 TGGTGGGGATGTGAAGAAATTGG - Intergenic
1129207673 15:74046665-74046687 TGGTGGGGCTGGAAATCAGTGGG - Exonic
1129783419 15:78290502-78290524 TCGTGGAGAAGTAAGGAAGTAGG - Intronic
1129798467 15:78395847-78395869 TCGTGGAGCTGGAAAGAACTTGG + Intergenic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131545828 15:93314754-93314776 AGGTGGAGATGGTGAGAAGGTGG + Intergenic
1131694952 15:94866987-94867009 TGGTGGAGGTGGAAACAGGGTGG - Intergenic
1131977710 15:97961809-97961831 TGGGGGAGAGGGGAAGAAGCGGG - Intronic
1132995233 16:2819263-2819285 TGGGGGAGGTGGAAAGATGCAGG - Intronic
1133876047 16:9735598-9735620 TGGTAGAAATGGAATGCAGTGGG + Intergenic
1134323124 16:13181757-13181779 TGATGGAGATGGGGAGAAGGGGG + Intronic
1134442499 16:14307641-14307663 GGCTGGAAGTGGAAAGAAGTGGG + Intergenic
1135248293 16:20876963-20876985 GAGGGGAGATGAAAAGAAGTGGG + Intronic
1135481892 16:22827494-22827516 TGGTGGAGAGAGAAAGGAGAGGG + Intronic
1136180966 16:28551733-28551755 TGGTGGAGGTGAAAAGTAGGTGG + Intergenic
1137511797 16:49107135-49107157 TGTTGGGGAGGGGAAGAAGTAGG + Intergenic
1138369147 16:56510858-56510880 TGATGGTGATGGAAAGAAAGAGG - Exonic
1138434338 16:56988907-56988929 AGGGGGAGATGGAAAGAGGTAGG - Intergenic
1138542194 16:57695210-57695232 TGGTGGGCAAGGAAAGAAGTAGG - Intronic
1138917178 16:61479870-61479892 TGGTGAAGATGTAAAGAAAAAGG + Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139530542 16:67540429-67540451 TGGAGGAGAAGGGGAGAAGTCGG - Intronic
1140588819 16:76326810-76326832 TGGGGGAGAGGGAAAGCATTAGG + Intronic
1140880574 16:79194593-79194615 GGGTGGAGAAGGATGGAAGTGGG - Intronic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1143949205 17:10619454-10619476 TTTTGGAGATGGAAAGTGGTGGG + Intergenic
1143978108 17:10845122-10845144 TGGTGGAGTTTACAAGAAGTAGG + Intergenic
1144562518 17:16332912-16332934 TGGTGAGGATGTAAAGAAATTGG + Intronic
1144935187 17:18892462-18892484 TGGTGAAGATGTGGAGAAGTTGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147134518 17:38427541-38427563 TGGGGGACAAGGAAAGAAGCTGG + Intergenic
1148065761 17:44868571-44868593 TGGTGGAGATGGAGAGGCTTGGG - Intronic
1148194213 17:45701627-45701649 TGGAGGAGAGGGAAGGAAATGGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149045861 17:52244627-52244649 TGGTGGAAATGGCAAGTAGTCGG - Intergenic
1149231737 17:54542599-54542621 TGGGGGATCTGGGAAGAAGTGGG + Intergenic
1149300259 17:55298713-55298735 ACATGGAGGTGGAAAGAAGTAGG + Intronic
1149317321 17:55450836-55450858 CAAAGGAGATGGAAAGAAGTGGG - Intergenic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150636509 17:66916877-66916899 TGGTGGAGACAGAAAGGAGTGGG + Intergenic
1150957630 17:69878067-69878089 TGGTGAAGATATAAAGAAATTGG + Intergenic
1151345736 17:73500251-73500273 TGGAGGAGATGGAAGGAGGATGG - Intronic
1151345743 17:73500281-73500303 TGGAGGAGATGGAAGGAGGATGG - Intronic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1152369073 17:79874111-79874133 TGGTGGGGATGCACAGAAATAGG - Intergenic
1152561203 17:81079650-81079672 TGGGGGTGATGGAAAGCAGGTGG - Intronic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153266469 18:3275276-3275298 TCATGGAGATGGAAAGTAGAAGG + Intronic
1153390575 18:4553246-4553268 TGGTGAAGATGCAGAGAAATTGG - Intergenic
1153798327 18:8646049-8646071 TGGTGAAGATGTAGAGAATTTGG + Intergenic
1153904229 18:9646819-9646841 TTGTGCAAATGCAAAGAAGTAGG + Intergenic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1155104016 18:22642639-22642661 TGGAGGAGATGGGGAGAAGATGG + Intergenic
1155124754 18:22861793-22861815 TGAGGGAGATGAAGAGAAGTGGG + Intronic
1155182036 18:23356299-23356321 TTGTGGAGGAGGAAAAAAGTGGG + Intronic
1155325305 18:24658504-24658526 TGGGGGAGATGGAGAGGAGGAGG + Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155844457 18:30688033-30688055 TAGCTGAGATGGAAAGAAGATGG - Intergenic
1155855199 18:30825488-30825510 TGGTTGAGATGGACAGAAATGGG + Intergenic
1155981681 18:32186810-32186832 AGGAGGAGATGAAAAGAAGTTGG - Intronic
1156317337 18:35982506-35982528 TGGTGAAGATGTAAAGAAATTGG + Intergenic
1156738313 18:40291574-40291596 GGGAGGAAATGGAAAGATGTAGG + Intergenic
1158345193 18:56509024-56509046 TGGTGGAAATAGAAAGCTGTGGG - Intergenic
1158683059 18:59586265-59586287 TGGTTGAAATGGAAAGAAGAGGG - Intronic
1158951168 18:62496678-62496700 TGGGGGAAATAGAAACAAGTAGG - Intergenic
1159400880 18:67932329-67932351 TGGGGTAGATGGAAAGAGATGGG + Intergenic
1159949282 18:74468652-74468674 TGGAGGAGATGGAGGGAACTGGG + Intergenic
1160082737 18:75744872-75744894 TGATGGAGGTGGAACGAAGAGGG + Intergenic
1160676340 19:393355-393377 TGGTGGGAATGGGAAGGAGTTGG + Intergenic
1161104189 19:2435112-2435134 TGGTGGAGGTGGACAGCAGCCGG - Exonic
1162006642 19:7785048-7785070 TGGTGAAGATGTGAGGAAGTGGG - Intergenic
1162548494 19:11345462-11345484 GGGTGGGGATGGAAATAAGAGGG - Intronic
1163106387 19:15125288-15125310 TGGTGGTGATGTAAAGGACTGGG - Intronic
1163255953 19:16155968-16155990 TGGTGGAGATGGAAAGAAGGAGG + Intronic
1163507985 19:17719603-17719625 TGGAGGAGCTCGAAAGAGGTCGG + Exonic
1164077994 19:21837849-21837871 AGGTGGAGAAGGAAAAAGGTAGG - Intronic
1164800578 19:31073006-31073028 TGGGGGAGAGGGCAAGAAGGTGG + Intergenic
1166331678 19:42081384-42081406 TGGTGGGGATGGGAAGAGGAAGG - Exonic
1166914120 19:46182959-46182981 TGGGAGAGATGGGGAGAAGTGGG - Intergenic
1167435208 19:49475038-49475060 AGGGGGAGATGGACAGAGGTGGG + Intronic
1167519876 19:49948063-49948085 TGGAGGAGAAGGAAGCAAGTGGG + Intronic
926025830 2:9543780-9543802 TGGTGGAGATGAACAGAAAGTGG + Intronic
927528951 2:23775823-23775845 TTCTGGAGGTTGAAAGAAGTGGG - Intronic
927727172 2:25434841-25434863 TGGTGAAGATGTAGAGAAATTGG - Intronic
928471626 2:31581345-31581367 CGGAGGAGATGGAAAGACCTTGG - Intergenic
928587976 2:32781406-32781428 TGGCGGACATGGGAAGAAGCAGG - Intronic
929271782 2:39980828-39980850 TGGTGGAGATGGGAGAAAATGGG + Intergenic
929716008 2:44310291-44310313 TGGTGAGGATGAAAAGAAATTGG - Intronic
929912645 2:46103876-46103898 TGGCAGAGATGGAAAGGAGGAGG + Intronic
929965479 2:46531659-46531681 TGGTGAAGATGTGAAGAAATTGG - Intronic
931532588 2:63232934-63232956 TGGTGGAGAAGGAAGCAAGGAGG + Intronic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
931913703 2:66930086-66930108 GGGTTGTGATGGAAAGAACTTGG - Intergenic
932324936 2:70852563-70852585 TGGTGGATATGCAGAGAAATTGG + Intergenic
932717307 2:74110934-74110956 TGGTGGTGATAGGAAGGAGTGGG - Intergenic
932733446 2:74236852-74236874 TGTTGGAGATGGAAAGCAGTAGG - Intronic
932793659 2:74676669-74676691 TGGTAGAGGTGGACAGAAGAGGG - Intronic
933067876 2:77820600-77820622 GGGTGGAGATGAAAAGATGGGGG + Intergenic
933977861 2:87526354-87526376 TGGTGGAGATGAAACTTAGTGGG + Intergenic
934147494 2:89109896-89109918 GGCTGTAGATGGAAAGAACTTGG + Intergenic
934221776 2:90090696-90090718 GGCTGTAGATGGAAAGAACTTGG - Intergenic
934698397 2:96417297-96417319 TGGTGAGGATGCAGAGAAGTAGG - Intergenic
935152331 2:100449320-100449342 TGGTGGAGATGGGAAGGTGAAGG - Intergenic
935585404 2:104796320-104796342 TTGTGGAGATGGAAAGGAACTGG + Intergenic
935655910 2:105422961-105422983 TGCAGGAAAAGGAAAGAAGTGGG - Intronic
936315968 2:111424453-111424475 TGGTGGAGATGAAACTTAGTGGG - Intergenic
936680073 2:114760013-114760035 TGGTGCAGGTGGTGAGAAGTGGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
936989633 2:118348864-118348886 TGGTGGGGATGGAAAGGAAAGGG + Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937261786 2:120591334-120591356 TGGTGGTGCTGGAAACAAGATGG - Intergenic
937399548 2:121570175-121570197 GGGTGGGGAGGGAAAGAAGGAGG - Intronic
938364319 2:130722271-130722293 TGGTGGAGATGTATATAAGGAGG + Intergenic
938606138 2:132894752-132894774 TGGTGCAGATGGACAGTAGCAGG + Intronic
938664394 2:133519565-133519587 TGGTGGAGAGGGAAATATGAGGG - Intronic
938924820 2:136029322-136029344 TGGGGGAAATGGGAAGATGTTGG + Intergenic
940218833 2:151329360-151329382 TGGTGGTGATGGAATGATCTGGG - Intergenic
940306067 2:152228033-152228055 TGGGGGAGACAGAAAGAAGCAGG + Intergenic
940726318 2:157340749-157340771 AGGTGAAGATGTAAAGAATTTGG - Intergenic
940773875 2:157866885-157866907 TTTTGGAAATGGGAAGAAGTGGG - Intronic
942997874 2:182286645-182286667 CGGTGGAGAGGGAAAGAACATGG + Intronic
943307335 2:186279807-186279829 TGGTGAAGTTGCAAAGAAATGGG - Intergenic
943460884 2:188170522-188170544 TGGCGGTGAGGGACAGAAGTTGG + Intergenic
944291312 2:198008836-198008858 TGGTGAAGATGTAGAGAAGATGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946019301 2:216629888-216629910 TGGTTGAGATGGAAAAAGGCAGG + Intergenic
946058045 2:216918492-216918514 TGGTGGAGGGGGAAAGAGCTGGG - Intergenic
946132325 2:217616377-217616399 TGGTGGTGTTGGGAAGAAGAAGG - Intronic
946628195 2:221637580-221637602 GAGTGGACATGGAAAGAGGTGGG + Intergenic
946920315 2:224573942-224573964 TAGTGGAAATGGAAAGGAATTGG + Intronic
947283155 2:228479078-228479100 TGCTGGTGATGGAAAGGAGATGG - Intergenic
947283162 2:228479127-228479149 TGCTGGTGATGGAAAGGAGATGG - Intergenic
947283188 2:228479352-228479374 TGCTGGTGATGGAAAGGAGATGG - Intergenic
947289549 2:228557207-228557229 TGGTGGAAATGGAAAGAAGAGGG - Intergenic
947691574 2:232141695-232141717 TGGTAGAGATGGGAAGTAGGGGG + Intronic
948821943 2:240554328-240554350 TCGTGGAGATGGAAAGAGAGAGG + Intronic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169597978 20:7222652-7222674 TGGGGGGGATGAAAAGAGGTTGG - Intergenic
1169655849 20:7922305-7922327 TGGTGAAGATGCAAAGAAAAGGG + Intronic
1169776461 20:9259582-9259604 TGGCAGAGATGGAGAGAAGGAGG + Intronic
1170175434 20:13463866-13463888 TGGTGAGGATGTAAAGAAATGGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171820072 20:29827986-29828008 TGATGGAGAGGGAAAGCACTGGG + Intergenic
1172313536 20:33935788-33935810 TGATTGTGATGGTAAGAAGTTGG + Intergenic
1172790505 20:37502095-37502117 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1173022264 20:39276828-39276850 TGATTGAGATGGCAAAAAGTAGG + Intergenic
1173079203 20:39849917-39849939 TGGTGGAGATGGAAACAGCAAGG + Intergenic
1173504933 20:43579411-43579433 AGGATGTGATGGAAAGAAGTTGG + Intronic
1173678166 20:44856145-44856167 AGGAGGAGATGGGAAGGAGTGGG + Intergenic
1173902618 20:46601895-46601917 GGGTGGAGGTGGTAGGAAGTGGG + Intronic
1174177579 20:48654790-48654812 TCTTGGAGATGGAACCAAGTAGG - Intronic
1174273005 20:49383237-49383259 TTGTGGGGATGGAAAGCAATGGG - Intronic
1174403513 20:50289098-50289120 CGGTGCAGATGGGAACAAGTGGG + Intergenic
1174999287 20:55608798-55608820 TGGTGGGGATGGGAAAAAATAGG + Intergenic
1175224112 20:57434890-57434912 AGCTGGAGATGCAAAGAAGAGGG - Intergenic
1175857306 20:62129015-62129037 GGGAGGAGATGGAGAGAGGTGGG + Intronic
1176950133 21:15034677-15034699 TGGAGGAAGTGGAAAGAACTAGG + Intronic
1177618273 21:23554584-23554606 GGGTGGAGGTTGAAAGAATTTGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177944914 21:27455938-27455960 TGGGGGAGAGGGAAGGAAGAAGG - Intergenic
1178231507 21:30790366-30790388 TGTTGGAGGTGGGAACAAGTGGG + Intergenic
1178529228 21:33361324-33361346 CGGAGCGGATGGAAAGAAGTAGG + Intergenic
1178632438 21:34274093-34274115 TGGTGTAGAGGGAATGTAGTAGG - Intergenic
1178859358 21:36276047-36276069 TGGTGGAGCTGGAGCGGAGTCGG + Intronic
1178905309 21:36631555-36631577 TGGAGAAGATGGAAAAAAGCGGG + Intergenic
1178927281 21:36786536-36786558 GGGTGGAGAAGGAAAGGATTTGG + Intronic
1178985723 21:37301166-37301188 TGGAGTAGATGGAAAGAAGGGGG - Intergenic
1179110029 21:38438489-38438511 TGATGGAGATGAGAAAAAGTAGG - Intronic
1179386924 21:40952088-40952110 TGGTGGGGATGCGAAGAAATTGG - Intergenic
1179931465 21:44573707-44573729 TGGGGGAGATGGGAGGGAGTGGG - Exonic
1179992810 21:44957453-44957475 TGGTGGAGATGAAGAGGAGGAGG - Intronic
1180324069 22:11352674-11352696 TGATGGAGAGGGAAAGCACTGGG + Intergenic
1180649775 22:17368865-17368887 TGATTGAGCTGGAACGAAGTAGG - Intronic
1182044427 22:27263090-27263112 TTGTGGAGATGGAACAAAGGTGG + Intergenic
1182163720 22:28150704-28150726 TGTTGCAGATGGAAAGATTTAGG + Intronic
1182243206 22:28933905-28933927 CGGTGGAGATGGAATGATGGTGG + Intronic
1182474382 22:30568493-30568515 GGGTGGAGATGCAAAGACCTAGG - Intronic
1182931943 22:34182714-34182736 TGGTGGAGATGGAAACCAGCTGG + Intergenic
1183743965 22:39682936-39682958 TGGTGAAAAGGGAAAGAGGTGGG + Intronic
1184666758 22:45993366-45993388 TGGTGGTGATGGAATGATGGTGG + Intergenic
949535668 3:4994682-4994704 TTGGGGAGATGGAAGGAAGCTGG - Intergenic
949572507 3:5307118-5307140 TGGTGGAGAAGGACTGAAGGAGG + Intergenic
950041278 3:9920867-9920889 TGGGGGCCAAGGAAAGAAGTGGG - Intronic
950053037 3:10006510-10006532 TAGTGGAGATGCTAAGTAGTGGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950304674 3:11908798-11908820 TGGTGGAGATGCTAAGTAGCGGG - Intergenic
950305650 3:11913919-11913941 TGGTGGAGATGCTAAGTAGCGGG - Intergenic
950359030 3:12437404-12437426 TGGTGCTGATGGAAAGAGCTGGG + Intergenic
950711311 3:14814715-14814737 TGGTGGAGATGTCAAGCAGCTGG - Intergenic
950943096 3:16914168-16914190 TTGTGGAGAGAGAAAGTAGTTGG + Intronic
950983307 3:17332172-17332194 TGGTGGAACTGGTAACAAGTGGG + Intronic
951383711 3:22018943-22018965 GGGTAGAGACGGAAAGGAGTAGG - Intronic
952023304 3:29048895-29048917 GGGAGGAGATGCAAAGAAGGTGG - Intergenic
952552859 3:34498600-34498622 TGGTGGAGACGTAGAGAAATAGG + Intergenic
952674907 3:36016876-36016898 TGGGGGAAATGGGAAGACGTAGG - Intergenic
952835363 3:37597445-37597467 TGGTGGAGGTGAAGAGAAGAGGG + Intronic
952978864 3:38719305-38719327 TGGTGGAGATGGAAAAGAATAGG + Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953902471 3:46851143-46851165 TGGTGGAGATTGGAAGCACTTGG - Intergenic
954163426 3:48738253-48738275 TAGTGGAGATGTCAAGCAGTGGG + Intronic
954960039 3:54556352-54556374 AGGTGGAGATGGAAATAATGAGG + Intronic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
956014499 3:64867385-64867407 TAGTGGAGAAGGAAAGAAGAGGG + Intergenic
956233208 3:67040086-67040108 TGGTCGTGAGGGACAGAAGTTGG + Intergenic
957157709 3:76566725-76566747 GGGTGGAGAGGAAGAGAAGTGGG + Intronic
957273338 3:78059225-78059247 TGGGGCAGATGAAAAGAAGAAGG - Intergenic
957542532 3:81592276-81592298 TGGAGGAAATGGAGAGATGTTGG - Intronic
957596036 3:82268077-82268099 TGGTGGAGAGAGAGAGAAATAGG + Intergenic
958411753 3:93825550-93825572 TGGTCCAGATGAACAGAAGTGGG + Intergenic
959680837 3:109094438-109094460 TGGTGGAGGTGGAAAGAATGGGG + Intronic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959801774 3:110503625-110503647 TGAAGGAGTGGGAAAGAAGTGGG + Intergenic
959990004 3:112621027-112621049 TGGCTCAGATGGAAGGAAGTTGG + Intronic
960431607 3:117575968-117575990 TGGAGGGGATGAAGAGAAGTTGG - Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960533806 3:118794636-118794658 TGGTTCAGATGGGAACAAGTTGG - Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960691912 3:120355196-120355218 TGGTGCAGATGTAGAGAAATTGG + Intergenic
960767925 3:121158032-121158054 TGGCAGAAATGGAAACAAGTGGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961596703 3:128023360-128023382 TGTTAGAAATGGAAAGAAATAGG - Intergenic
961957278 3:130816980-130817002 TAATGGAGATGGTAAGTAGTTGG + Intergenic
962245428 3:133786712-133786734 TGATGGAGATGGGAAGGTGTAGG + Intronic
962725969 3:138227235-138227257 AGGTGCAGATGGGAAGAAATGGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964245071 3:154642262-154642284 TGGAGGAGATGAAGAGAATTGGG - Intergenic
964547124 3:157846756-157846778 TGGTGGAGATGAAAAGGATGGGG - Intergenic
964869110 3:161293511-161293533 TGGGGGAGGAGGAAAGAAGCAGG + Intergenic
964874107 3:161346833-161346855 GGTTGGAGGTGGGAAGAAGTAGG + Intronic
965279363 3:166728040-166728062 TGGGGGAGAGAGAAAGAAGAAGG - Intergenic
965363759 3:167773417-167773439 TGGTGTAGGTGAAAAAAAGTAGG - Intronic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965908249 3:173737889-173737911 TGGTGAGGATGCAGAGAAGTTGG - Intronic
966165626 3:177013458-177013480 AGGCAGAGACGGAAAGAAGTGGG + Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967650302 3:191977559-191977581 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
967661552 3:192116720-192116742 TAATTGAGATGGAAAGTAGTTGG - Intergenic
967768772 3:193311542-193311564 GGGTGGGGAGGGAAAGAAGGAGG + Intronic
967977943 3:195045824-195045846 TGGGGGAGAAGGAAGGAAGCAGG - Intergenic
968227238 3:196980896-196980918 TGGTGAGGATGAAAAGAAATAGG + Intergenic
968571123 4:1341260-1341282 TGGAGCAGATGGGCAGAAGTGGG - Intergenic
969180131 4:5434043-5434065 TGGTAGAGATGGTTAGCAGTAGG + Intronic
970623611 4:17852526-17852548 TGGTGAAAAGAGAAAGAAGTGGG + Intronic
970693236 4:18643987-18644009 TGGTGGAAATATAGAGAAGTTGG - Intergenic
970894827 4:21089791-21089813 TGGTTGAAATGTAAAGAAGCTGG - Intronic
971109054 4:23562041-23562063 GGGGGGAGATAAAAAGAAGTTGG - Intergenic
971429267 4:26547079-26547101 TGGTGGAGGTAGAGAGAAGGAGG - Intergenic
971527278 4:27636472-27636494 TGGTCCAGATTGAAAGAGGTGGG + Intergenic
971551879 4:27967520-27967542 AGGTGGAGAAGGAAAAGAGTAGG + Intergenic
971609098 4:28699140-28699162 TGCTGGCAATGGAAAGAAGCTGG - Intergenic
972012459 4:34201600-34201622 GGGAGGAGATGGAAAGAATGAGG - Intergenic
972164595 4:36266925-36266947 TAGAGGGGATGGAAATAAGTAGG + Intergenic
972401186 4:38705290-38705312 TGGTGGAGAATGATTGAAGTGGG - Intergenic
972568400 4:40289051-40289073 AGGTGGAGAAGGAAAGACCTAGG + Intergenic
973050181 4:45586275-45586297 TTGTGGAGAAGGAAAGTACTGGG + Intergenic
973116087 4:46461382-46461404 TGGTGAAGATGGGAAGAAAGGGG + Intronic
974436676 4:61865768-61865790 TGGTTAAGATGGAAGGAAGAGGG + Intronic
974669046 4:65004713-65004735 TGGTGGAGATAGAGAAAAGACGG - Intergenic
975641737 4:76507377-76507399 TGGTGAAGATGTAGAGAAATTGG - Intronic
975656589 4:76647277-76647299 TGGTGGTGATGAAGAGATGTTGG + Intronic
975927911 4:79481832-79481854 TGGGGGAGGGGGAAAGAAGGAGG - Intergenic
975955346 4:79830606-79830628 GGGTGGAGAAGGAAGGAAGTAGG - Intergenic
978421288 4:108535869-108535891 GGGTGGAGAAGGAAGGAAGTTGG - Intergenic
979318539 4:119296851-119296873 TGGTGAAGATGGAGAGATCTTGG - Intergenic
979453220 4:120897197-120897219 TGGAAGAGATGGGAAGAACTAGG + Intronic
979686512 4:123516277-123516299 TGGTGGAGATGAAAAACAGCTGG + Intergenic
979859296 4:125674149-125674171 TTATGGAGATGTAAAGAAGAGGG + Intergenic
979880966 4:125960341-125960363 TGGGGGAAATGGAGAGATGTTGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980176421 4:129351210-129351232 TGGTGGAGAAGGGAAGAAAGTGG - Intergenic
980697094 4:136372601-136372623 TGGTGAGGATGTAAAGAAATTGG - Intergenic
981735217 4:147942632-147942654 TAGGGGAGAAGGAAAGAAGGGGG - Intronic
981900470 4:149856085-149856107 TGGTGGAGACAGAAAGTAGTGGG - Intergenic
983308880 4:166030124-166030146 TGGTGAGGATGGACAGAAATTGG - Intronic
983398930 4:167238192-167238214 AGGTGGAGAAGGAAAGATATGGG - Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983783085 4:171697557-171697579 TGGCAGAGATGAATAGAAGTGGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984085502 4:175305811-175305833 TAGAAGAAATGGAAAGAAGTAGG + Intergenic
984500201 4:180549154-180549176 AAGGGGAGATAGAAAGAAGTTGG - Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
984783582 4:183548087-183548109 GGGAGGAGATGGAGAGATGTTGG - Intergenic
984837282 4:184033663-184033685 TGGTGGAGCTGGAGATAAGTGGG - Intergenic
984846183 4:184109987-184110009 TGGGGGAGATGGAAGGGAGAAGG + Intronic
985053879 4:186019213-186019235 TGTTGGAGATGGACACAAGAGGG + Intergenic
985626211 5:989902-989924 TGGTGAAGAAGGAAGGCAGTTGG - Intergenic
986092406 5:4523262-4523284 GGGTGGTGATGGCGAGAAGTGGG + Intergenic
986517058 5:8575047-8575069 TGTTGGAGATGGAACCAGGTAGG - Intergenic
986639349 5:9857155-9857177 AGGAGGAGATGAAGAGAAGTTGG + Intergenic
987991839 5:25222749-25222771 TTGTGGCCATAGAAAGAAGTAGG - Intergenic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988159221 5:27497411-27497433 TGTTGATGAGGGAAAGAAGTGGG - Intergenic
988453932 5:31370841-31370863 TGGTGCAGGTGGAAAGAAAAGGG - Intergenic
989813566 5:45708305-45708327 TGGTGAAGAAGGGAGGAAGTGGG - Intergenic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
990930347 5:61083009-61083031 TGGTGAAGTTGCAAAGAAATGGG - Intronic
991560283 5:67943909-67943931 TGATAGAGACAGAAAGAAGTGGG + Intergenic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
992689333 5:79227876-79227898 TGGAGTAAATGGAAAGAAGAGGG - Intronic
992970111 5:82047738-82047760 TGCTGGAGGTGAAAAGAAGGGGG + Intronic
993042962 5:82836282-82836304 GGGTAGAGATGGGAAGAATTTGG - Intergenic
993608866 5:90030439-90030461 TGTTTGGGATGTAAAGAAGTTGG + Intergenic
993844914 5:92929567-92929589 TGGTAGAGATAGAAAGAAGTGGG + Intergenic
994459027 5:100050403-100050425 TGTTGGAGATTGAAACTAGTAGG + Intergenic
994749090 5:103716488-103716510 TAGGGGATATGGAAAGAAGGGGG - Intergenic
995245848 5:109934716-109934738 TGGTGGAGAAAGAAAGAACCAGG + Intergenic
996080146 5:119250042-119250064 TGGTGAAGATGCAAGGAAATTGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996399622 5:123047156-123047178 AGGGGGAGATGGAAAGGGGTCGG + Intergenic
996866769 5:128132297-128132319 TTGTGGAGCGGGAAAGATGTGGG + Intronic
997305217 5:132831156-132831178 TGGGAGAAATGGAAAGAAATGGG - Intergenic
997941892 5:138165383-138165405 AGATGGAGATGGGCAGAAGTAGG + Intronic
998717487 5:144902122-144902144 TAGGAGAGAGGGAAAGAAGTAGG + Intergenic
998956492 5:147443982-147444004 TGGGGGACATGGAAAACAGTTGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999304680 5:150511911-150511933 TGGTGGAGCTGGGAAGCTGTGGG + Intronic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000627556 5:163556682-163556704 AGGTGGAGATGGAAACACATGGG + Intergenic
1000644353 5:163742795-163742817 GGGTGGAGGTTGAAAGAACTAGG + Intergenic
1000887193 5:166760516-166760538 TGAGGGAGATGAAAGGAAGTAGG + Intergenic
1000924265 5:167174801-167174823 GGGAGGAAATGGGAAGAAGTAGG - Intergenic
1000993555 5:167935620-167935642 AGGTGGTGAAGGAGAGAAGTTGG + Intronic
1001054790 5:168440314-168440336 TGGTGAAGATGTAGAGAAATTGG + Intronic
1001621904 5:173093903-173093925 TGGGGGAAATGGGAAGATGTTGG - Intronic
1001626993 5:173144467-173144489 GGGTGGGGAGGGAAAGAAGGTGG + Exonic
1001848254 5:174940497-174940519 GGATGGAGATGGAGAGAAGGAGG + Intergenic
1002000916 5:176195895-176195917 TGGGGGATATGGAAAGAAAAGGG - Intergenic
1002253418 5:177943077-177943099 TGGGGGATATGGAAAGAACAGGG + Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002647827 5:180669909-180669931 TTGTGGGGATGGAATGAGGTTGG - Intergenic
1003062349 6:2873609-2873631 AGGTGGTGAAGAAAAGAAGTAGG - Intergenic
1003404912 6:5820440-5820462 TGGTGCAGAGGGAAGGGAGTTGG - Intergenic
1003665999 6:8111865-8111887 TGATGGATATGGGAAGAAGAGGG + Intergenic
1003801954 6:9680317-9680339 TGGAGAAGATGGAGAGAATTTGG - Intronic
1003905509 6:10695524-10695546 CGGTGGAGATGCAAAGATGCTGG + Intronic
1003938636 6:11001904-11001926 TGGTGAAGATGGGAAGAAGCTGG - Intronic
1004240316 6:13915493-13915515 TAGTGGAAATGAAAAGGAGTAGG + Intergenic
1004244434 6:13959578-13959600 TGATGAAGATGGAATGAAATTGG + Intronic
1004351791 6:14896583-14896605 TGGTGACTATGAAAAGAAGTAGG - Intergenic
1004464461 6:15871490-15871512 TGGTGGTGAGAGAAAGATGTGGG - Intergenic
1004696643 6:18040263-18040285 TGGTGGTGATGGAGACAAGGGGG + Intergenic
1004911244 6:20287181-20287203 TGGTGGGGATGGATAGAAACTGG + Intergenic
1005515389 6:26549777-26549799 TGGAAGAGTTGGAAAGAAGAGGG + Intergenic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1006340376 6:33443409-33443431 TGGTGGTGATGGGAGGAAGGTGG - Exonic
1006703260 6:35994537-35994559 TGGCAGAGATGGAAAAAAGAGGG - Intronic
1006856586 6:37137846-37137868 AAATGGAGAGGGAAAGAAGTAGG - Intergenic
1006972752 6:38063577-38063599 TGGTAAAGATGGATAGAAGGTGG + Intronic
1008501307 6:52185678-52185700 TGATGGAGATGGAGAAAAGGGGG - Intergenic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1009984346 6:70765211-70765233 TGGTGGATATGAAAAGAATTGGG - Intronic
1010186533 6:73150219-73150241 TGGGGGAGATGCAAAGAAGCCGG + Intronic
1010538807 6:77064916-77064938 TGGTGGAGATGAAGAGAAACTGG - Intergenic
1011014587 6:82740940-82740962 TGGAGGACATGGGAAGAGGTAGG + Intergenic
1011995185 6:93577755-93577777 TGGTGGAAATGGAAACCAGATGG + Intergenic
1012570638 6:100723568-100723590 GTGTGGAAATGTAAAGAAGTAGG - Intronic
1012637378 6:101561389-101561411 AGGGGGGGATGAAAAGAAGTTGG + Intronic
1013060869 6:106632590-106632612 TGGTGAGGATGGAGAAAAGTTGG - Intronic
1013473287 6:110485315-110485337 TGGTGGAGATGTGGAGAAGGTGG - Intergenic
1014340326 6:120197530-120197552 GAGTGGAGATGGAAAGCACTAGG + Intergenic
1014696795 6:124631755-124631777 TGGTGAAGAAAGAAATAAGTGGG - Intronic
1014741013 6:125147583-125147605 TGGTAGAGGTGGAAAAAAGGTGG + Intronic
1015359213 6:132317795-132317817 TGGTTGAAATGGGAAGAAGAGGG - Intronic
1015662464 6:135590639-135590661 TGCTGGAGATGGAAACTGGTGGG - Intergenic
1016076238 6:139799454-139799476 TGATGGAGATGGAAAGAGCTTGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017242107 6:152181906-152181928 TGGTGAAGATGTAGAGAAATTGG - Intronic
1017358627 6:153540548-153540570 TGGTGAAGATGTGAAGAAATTGG - Intergenic
1017441757 6:154470915-154470937 TGGTGAAGATGTGAAGAAATTGG - Intronic
1018262842 6:161987866-161987888 TGTTGGAGAGGCAAAGAAGGAGG + Intronic
1018406614 6:163490776-163490798 TGGAAGAGATGGACAGAAGTGGG + Intronic
1019106632 6:169673077-169673099 TGATGGAGATGGAGAGGAGATGG + Intronic
1020239334 7:6380540-6380562 TGATGGAGATGTGAAAAAGTAGG - Intronic
1021330451 7:19332037-19332059 TGGTGAGGATGTAAAGAAATTGG - Intergenic
1021381221 7:19969040-19969062 TGGGGGAGATGGGGAGAGGTTGG - Intergenic
1021579251 7:22135095-22135117 TGGTGGCAATGGGAGGAAGTGGG + Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021847108 7:24774114-24774136 TGATGGAGTTAGAAAGGAGTTGG - Intergenic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022045010 7:26615831-26615853 TGGCTGAGGTGGAAAGAACTAGG - Intergenic
1022606817 7:31823657-31823679 TGGTAGAGCTGGAAAGAAAGAGG - Intronic
1022814126 7:33897732-33897754 TTGTGTAAATGGAAAGGAGTTGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023752931 7:43389007-43389029 TGATGGGGATGCAAAGAAGCAGG + Intronic
1023855884 7:44183604-44183626 TGCTGGAGAGGCCAAGAAGTGGG - Intronic
1024097258 7:45992343-45992365 GGGTGGAGGTAGGAAGAAGTAGG - Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1024726059 7:52196477-52196499 TGGTGAAGATGTGAAGAAATTGG - Intergenic
1025239810 7:57261827-57261849 TGTTGGAGAAGGAAAGGAGGGGG - Intergenic
1026407641 7:70084018-70084040 GGGTGGAGATGGAAGGGAGGTGG - Intronic
1027047166 7:74998688-74998710 TGGTGGGGGTGAAAGGAAGTTGG + Intronic
1027279980 7:76602092-76602114 TGGTGGAAATGGATAAAAGTGGG + Intergenic
1028044871 7:86105917-86105939 TGGGGAAGATGGAAGGAGGTTGG + Intergenic
1028573165 7:92314914-92314936 TACTGGAGATGGAAAGAATGAGG + Intronic
1030152325 7:106419926-106419948 TGGTGGTGATGGAATGAAGTGGG - Intergenic
1030553720 7:110997054-110997076 TGGGGGAGAGGGAAGGAGGTGGG - Intronic
1030632632 7:111912610-111912632 AGGAGGAGAAGGAAAGAAGATGG + Intronic
1030704561 7:112678091-112678113 AGATGGAGATGGAGAGAACTGGG + Intergenic
1031079586 7:117245477-117245499 TGGTGGGGATGTGAAGAAATTGG + Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032238137 7:130141714-130141736 TGGAGGAGAGGGAGAGCAGTGGG - Intergenic
1032411382 7:131695421-131695443 TGGTGGAGATGGACAGCAGCTGG + Intergenic
1032573414 7:133026381-133026403 TGGTGAAGATGTAAAGAAATTGG + Intronic
1032610617 7:133408402-133408424 TGATGGAGGTGGAGAGAGGTTGG + Intronic
1032853623 7:135816169-135816191 TGGTTGAGATGCAGAGAAGTGGG + Intergenic
1033405648 7:141070389-141070411 TGGTGCAAATGGGAAGAAATAGG + Intergenic
1033588156 7:142789496-142789518 TGGTAGAGAAAGAAAGAAGGAGG - Intergenic
1034115791 7:148582708-148582730 TGATGGAGAAGGAAAGAGGAAGG - Intergenic
1035659249 8:1334399-1334421 TGGTGGATATGTCAAGGAGTCGG + Intergenic
1035957301 8:4095109-4095131 TGACGGATATGGAAAGAACTTGG + Intronic
1037680678 8:21095036-21095058 AGGTGGAGAGGGAAAGATGAAGG + Intergenic
1037681026 8:21097587-21097609 AGGTGGAGAGGGAAAGATGAAGG + Intergenic
1037743907 8:21628442-21628464 TGGGGGAGAAGGAAGGAAGGAGG + Intergenic
1038277625 8:26135015-26135037 TGGTGGAGAGGCAAAGAAACTGG - Intergenic
1038826100 8:31003896-31003918 AGGTGGAGATGGTAAGAATAGGG + Intronic
1039209151 8:35192126-35192148 TGGGGGTGATGGAGAGATGTTGG - Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039409665 8:37342283-37342305 AGGGAGAGCTGGAAAGAAGTGGG + Intergenic
1039659494 8:39447353-39447375 TGGTGGAGGTAGCAATAAGTGGG - Intergenic
1040061382 8:43106127-43106149 TGGTGAAGATGCAGAGAAATGGG - Intronic
1040581116 8:48699448-48699470 TGGTGGTGGCGGCAAGAAGTTGG + Intergenic
1040738980 8:50548378-50548400 TGGTGGTGATGGAAAGGAAGAGG + Intronic
1040880400 8:52198923-52198945 TGGTGGGGCTGGAAGGAGGTGGG - Intronic
1040949723 8:52925183-52925205 GGGTGGAAAGGGAAAAAAGTGGG - Intergenic
1040989326 8:53332674-53332696 TGGTGAGGATGCAGAGAAGTTGG - Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041709914 8:60885058-60885080 TGCTGGAGCTGGAAAAAAGCTGG + Intergenic
1041811432 8:61914718-61914740 TGATGGAGATGGAATAAAGATGG - Intergenic
1041942724 8:63406427-63406449 TGCTGGAGATGCAAAGATGAAGG - Intergenic
1041982991 8:63884690-63884712 TGATGGGGATGTAAAGAAATTGG - Intergenic
1042408099 8:68429399-68429421 TGGTGAAGATGTAGAGAAATGGG + Intronic
1042838598 8:73100923-73100945 AATTGGAGATGGAAAGAACTAGG + Intronic
1043196350 8:77297149-77297171 TAGTAGAGGTGGAAAGAAGCAGG - Intergenic
1043448167 8:80339752-80339774 TGACAGAGATGGAAAGAATTTGG - Intergenic
1044133409 8:88555508-88555530 TGGTGAAGATGTAGAGAAATTGG - Intergenic
1044340055 8:91036542-91036564 TGGTAGAGATGGAGAGATGAAGG - Intronic
1044690646 8:94874194-94874216 GGGAGGAAATGGGAAGAAGTAGG - Intronic
1045370623 8:101518753-101518775 TAGCAGAGATGGAAAGAACTTGG - Intronic
1045374118 8:101553934-101553956 TGGGTGAGTTTGAAAGAAGTGGG - Intronic
1045563312 8:103287231-103287253 TGGGGGAAATGGGAAGATGTTGG - Intergenic
1045696016 8:104809660-104809682 TAGTGGGGATGGTAAGAAGATGG - Intronic
1046713837 8:117545622-117545644 TGGGGGAGAGGGAGAGGAGTCGG + Intergenic
1047507804 8:125493777-125493799 TGGAGGAGATGGATTGGAGTTGG - Intergenic
1047777352 8:128083987-128084009 TGGTGGAGAAGGTAAGTAGGGGG - Intergenic
1047880212 8:129184584-129184606 TGGTGAAGATGTAGAGAAATTGG + Intergenic
1048190204 8:132281580-132281602 AGGTGGAGATGGAATGAAGTAGG - Intronic
1048559569 8:135519188-135519210 TGGGGGAGACGGAAGGAAGCAGG - Intronic
1048748983 8:137649606-137649628 AAGAGGAGATGGAAAGAAGGAGG + Intergenic
1048888878 8:138930880-138930902 TGGGGGAGAAGGAAAGAAGAAGG + Intergenic
1048898519 8:139016232-139016254 TGCTCGGGAAGGAAAGAAGTGGG + Intergenic
1049062504 8:140286910-140286932 AGATGGGGAAGGAAAGAAGTGGG + Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050181596 9:2928637-2928659 TGGGGCAGATGGAAAGCTGTGGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051320604 9:15900712-15900734 TGGGTGTGAGGGAAAGAAGTAGG + Intronic
1051706847 9:19889649-19889671 TGGTAGAGATAGAAACAAGAAGG - Intergenic
1052001518 9:23288013-23288035 TTGTGGAGCAGGAAAGAAGTTGG - Intergenic
1052247587 9:26355331-26355353 TGGGAGAAATGGAAAGATGTTGG + Intergenic
1052261929 9:26526853-26526875 TGCTGGGGATGGAAAGATGGTGG - Intergenic
1052658547 9:31398245-31398267 AGGGGGAGATGAAGAGAAGTTGG - Intergenic
1055748903 9:79482464-79482486 TTGTTGATTTGGAAAGAAGTGGG + Intergenic
1055956196 9:81775853-81775875 AGGAGGAGGAGGAAAGAAGTAGG - Intergenic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056376791 9:86022304-86022326 TGCTGGAGATGAAAAACAGTAGG + Intergenic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1056781537 9:89554678-89554700 AGGATGTGATGGAAAGAAGTGGG - Intergenic
1057976929 9:99615202-99615224 GGGAGGAAATGGAAAGATGTAGG + Intergenic
1058059646 9:100481652-100481674 TGGTGAAGATGGAATGGAGAAGG + Intronic
1058115030 9:101075814-101075836 TGGTGTAGATGGAGAGTGGTTGG + Intronic
1058197677 9:101998900-101998922 TGATAGAGATGTAAAGAATTGGG + Intergenic
1059045073 9:110857831-110857853 TGGTGTGCATGGAAAGAAGTGGG - Intergenic
1059566695 9:115389539-115389561 TCATGAAGATGGAAAGAAGAAGG - Intronic
1059768824 9:117408886-117408908 GCTTTGAGATGGAAAGAAGTGGG + Intronic
1059820652 9:117968659-117968681 TGGGGGAGATGGAGAGAACAAGG + Intergenic
1059910915 9:119043198-119043220 TGGTGAGGAGGGAAAGAAGAAGG - Intergenic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1060619401 9:125050165-125050187 TTGGGGAAATGGAATGAAGTGGG - Intronic
1061182905 9:129035607-129035629 TGGTGAGGATGGAAAGAGGACGG - Intergenic
1061596653 9:131634827-131634849 TGGTGAAGTTGGGAAGAGGTGGG + Intronic
1062323275 9:136000948-136000970 CGGTGGGGAGGGAAAGGAGTGGG + Intergenic
1203371738 Un_KI270442v1:313252-313274 TGATGGAGAGGGAAAGCACTGGG + Intergenic
1185922232 X:4106538-4106560 TGGGGGAAATGGAGAGATGTTGG - Intergenic
1186657351 X:11629133-11629155 TGGTGGAGATGGAGGAAAGTAGG - Intronic
1186831364 X:13393522-13393544 TGGTGGTCATGAAAAGCAGTTGG - Intergenic
1187512302 X:19931651-19931673 TGGTAGAGAAGGAAAGACTTTGG + Intronic
1187608284 X:20910835-20910857 TGGGAGAGATGAAATGAAGTTGG - Intergenic
1187867893 X:23740689-23740711 TGGGGGAGATCGGAAGAACTGGG - Intronic
1187872618 X:23777094-23777116 TGGTGTAGATGTAGAGAAATTGG + Intergenic
1187915434 X:24149423-24149445 CGGAGGAGGTGGAAAGAAGGGGG + Intronic
1187918437 X:24177533-24177555 TGGTGGAGGTTGAGAGTAGTTGG - Intronic
1188310485 X:28611113-28611135 TTGTGGAGAAGGGAAGAGGTTGG + Intronic
1188390181 X:29610285-29610307 TTGTTGAGATGGTAGGAAGTGGG + Intronic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1188657229 X:32713380-32713402 AGCTGGAGATTGAAAGAAGAGGG + Intronic
1189524346 X:41803890-41803912 TGGTGGAGTTGGAACAAATTAGG + Intronic
1190475080 X:50818652-50818674 TGTGGGAAATGGAAAGATGTTGG - Intergenic
1190912924 X:54788788-54788810 TGGGGCAGGTGGAAAGATGTAGG - Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191682907 X:63859448-63859470 TGCTGGAGATGGGAAGAAAGTGG - Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192560680 X:72126090-72126112 TTGTGGAGATGAAATGATGTTGG + Intergenic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1192613974 X:72598362-72598384 TGGTGAAGATGTAAAGAAATTGG + Intronic
1192898453 X:75469856-75469878 TGGTGAAGATGTAAAGAAATTGG - Intronic
1193181282 X:78460132-78460154 TGGTGGATAGGGAAGGAAATGGG - Intergenic
1193242677 X:79190289-79190311 TGGTGAAGATGCAAACAAATTGG - Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193812172 X:86064649-86064671 TGGGGGAAATGGGAAGACGTTGG - Intergenic
1193891848 X:87057151-87057173 TGGTGGAGATGTGAAGAAATTGG + Intergenic
1194763973 X:97827637-97827659 TTGTGAAGATGGAAAGACATAGG + Intergenic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1195324504 X:103747350-103747372 TGGTTGCCATGGTAAGAAGTAGG + Intergenic
1195393752 X:104389292-104389314 TTGAGCTGATGGAAAGAAGTAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195418610 X:104647676-104647698 TGGTGAAGATGCAAGGAAGCTGG + Intronic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195831650 X:109065985-109066007 AGGGGAAGATGGAAAGAAGTTGG - Intergenic
1196241918 X:113352541-113352563 TGGTGGATATGGAAAGGGTTGGG - Intergenic
1196468154 X:115993695-115993717 TGGGGGAGAAGGGAAGGAGTGGG - Intergenic
1196561982 X:117160351-117160373 TGGGGTAAATGGAAAGATGTTGG + Intergenic
1196666547 X:118323179-118323201 TAGTGGACTTGGAAAGAAGTTGG - Intergenic
1196893892 X:120314501-120314523 TGAAGAAGATGGAGAGAAGTAGG - Intergenic
1197081279 X:122420142-122420164 TGGTGAAGATGTGAAGAAATTGG - Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1198959538 X:142169762-142169784 TGGGGAAGATGAAAAGGAGTTGG - Intergenic
1199406560 X:147468676-147468698 TGATGCAGATGGAAGGAAGATGG + Intergenic
1200722711 Y:6626230-6626252 TGGGGGAGATGGAAAGAAGGAGG + Intergenic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1201247907 Y:12024643-12024665 AGGGGGAGAAGGAAAGAAGAAGG - Intergenic
1201504492 Y:14682550-14682572 TGGTTGAGTTGGGAAGCAGTTGG + Intronic
1201949055 Y:19542936-19542958 TGGTGGTGGTGGAAAGGAATGGG - Intergenic
1202300585 Y:23409477-23409499 TGCTGGGGAAGAAAAGAAGTTGG - Intergenic
1202570226 Y:26261121-26261143 TGCTGGGGAAGAAAAGAAGTTGG + Intergenic