ID: 960817893

View in Genome Browser
Species Human (GRCh38)
Location 3:121692014-121692036
Sequence CAGTGTTTCCATAAGCTGAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960817890_960817893 11 Left 960817890 3:121691980-121692002 CCTTTTGCTGAATGTTTTCCTTT 0: 1
1: 1
2: 9
3: 100
4: 851
Right 960817893 3:121692014-121692036 CAGTGTTTCCATAAGCTGATTGG 0: 1
1: 0
2: 0
3: 13
4: 174
960817889_960817893 20 Left 960817889 3:121691971-121691993 CCAACTGTGCCTTTTGCTGAATG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 960817893 3:121692014-121692036 CAGTGTTTCCATAAGCTGATTGG 0: 1
1: 0
2: 0
3: 13
4: 174
960817892_960817893 -7 Left 960817892 3:121691998-121692020 CCTTTTTGATGGTTTTCAGTGTT 0: 1
1: 0
2: 1
3: 36
4: 422
Right 960817893 3:121692014-121692036 CAGTGTTTCCATAAGCTGATTGG 0: 1
1: 0
2: 0
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960817893 Original CRISPR CAGTGTTTCCATAAGCTGAT TGG Exonic
901814565 1:11786934-11786956 CAGTTTCTCCATCAGCTTATGGG - Exonic
904919200 1:33993719-33993741 AAGTGTTTCCTTAATGTGATAGG - Intronic
904960842 1:34331714-34331736 CAGTGTTTCCATCAGCAAAATGG + Intergenic
911035742 1:93544990-93545012 CAATGTTTCAGTCAGCTGATTGG + Intronic
915195498 1:154186024-154186046 CGGTATTTCCAAAAGGTGATAGG - Intronic
915679477 1:157566736-157566758 AAGTATTTACATAAGCTGAGGGG - Intergenic
916518595 1:165543541-165543563 CAGTGTTGCCAGAAGAAGATGGG - Intergenic
917748810 1:178036466-178036488 CAGTTTTTCCATGGACTGATGGG - Intergenic
917786546 1:178464731-178464753 CTGTGTTTCCATAAACTTGTTGG + Intronic
918889561 1:190248091-190248113 CTGTGTATTCATAAGTTGATAGG - Intronic
919266639 1:195275545-195275567 CAGGGATTCCATAAACTGGTTGG - Intergenic
919590860 1:199500224-199500246 CAGTCTTTTCATATGCTTATTGG - Intergenic
921558721 1:216630685-216630707 CAGTCTTTTCAACAGCTGATTGG + Intronic
922227133 1:223655224-223655246 CAGTGTGTCCATCAGCACATGGG - Intronic
923949714 1:238935516-238935538 CAATTTTTCCATATGCTCATGGG - Intergenic
1063276793 10:4578123-4578145 CAGTCTTTCCAGAAGGTGTTTGG - Intergenic
1064658929 10:17586150-17586172 CAGTGTGTTGATAATCTGATGGG - Intergenic
1065371653 10:24992877-24992899 CAGTGTTTCCTGAAGTGGATTGG - Intronic
1065623413 10:27606793-27606815 CAGTGTCTACATAAGCAAATTGG + Intergenic
1072228911 10:93396511-93396533 CAGTGTTTCCAAAGGGTGACTGG - Intronic
1074161254 10:110838179-110838201 GAGTGTTCCCATGAGCTGAGCGG - Exonic
1076491231 10:130862908-130862930 CGGTTTCTCCAAAAGCTGATTGG + Intergenic
1078459012 11:11499259-11499281 CAGTATTTCCATCAGCTGGCAGG + Intronic
1078617850 11:12881729-12881751 CAGTTGTTCCATAAACTGAGAGG - Intronic
1079418458 11:20263083-20263105 CAGTGTTTCCCTATGTTGCTTGG - Intergenic
1079818022 11:25087276-25087298 CAGTGCTTCCATCAGTAGATTGG + Intergenic
1087714050 11:101586606-101586628 CAGTGTTTTGAAAAGCTGATAGG + Intronic
1088722608 11:112607736-112607758 CAGTGTTTCCAGATTATGATTGG + Intergenic
1093782985 12:23157891-23157913 CAATATCTCCTTAAGCTGATAGG + Intergenic
1095606680 12:44076027-44076049 CAGTGATTGCATCAGCTGATTGG - Intronic
1098553843 12:71795714-71795736 CAGTGTTTCCAAGAGATGACAGG - Exonic
1099272006 12:80522238-80522260 CAAAGTCTCCTTAAGCTGATAGG - Intronic
1101229044 12:102721019-102721041 CAGTGTTTCCACATGGAGATAGG - Intergenic
1107569819 13:41644874-41644896 CAGTTTTACCATAGGCTAATTGG - Intronic
1109293152 13:60499572-60499594 CAGTGATGACATATGCTGATTGG + Intronic
1110493983 13:76143661-76143683 GAGTGTTTCTTTAAGCTGCTGGG + Intergenic
1111942136 13:94621490-94621512 CTGTGCTTAAATAAGCTGATAGG - Intronic
1112085129 13:96022315-96022337 CAGTTTTTCCCGAACCTGATTGG - Intronic
1113214433 13:108022051-108022073 CAGTGCTTCTATAACCTTATTGG + Intergenic
1118679185 14:68221918-68221940 CATTTTTTCCATATGCTTATTGG - Intronic
1125430681 15:39590061-39590083 CTGTGTTTTGATAAGGTGATGGG - Intronic
1125572552 15:40732202-40732224 CAGGGTTTCCATAATCTTTTTGG + Intronic
1126419863 15:48460116-48460138 CAGTGTTTCAATAAAGTGAAAGG + Intronic
1126782721 15:52152239-52152261 CAGTTTTTCCAAAAGCAGGTTGG - Intronic
1129957544 15:79653058-79653080 CAAAGTCTCCTTAAGCTGATAGG - Intergenic
1130340363 15:82995974-82995996 CAGTGTCTTCATGGGCTGATGGG + Intronic
1130802243 15:87277192-87277214 CAAAGTCTCCTTAAGCTGATAGG - Intergenic
1131556303 15:93402877-93402899 CAAAATCTCCATAAGCTGATAGG - Intergenic
1132212373 15:100033975-100033997 CAGTGATGCCATCAGCTTATTGG + Intronic
1137366332 16:47862823-47862845 CAGAGTTGCCATCTGCTGATGGG + Intergenic
1137652486 16:50132441-50132463 CAGTGTCTCCCTATGCTGTTTGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1139670913 16:68492159-68492181 CAGTGTTTCCAAAAGCTGGGAGG + Intergenic
1140636652 16:76922763-76922785 CATTTTTTCCATATGCTTATTGG + Intergenic
1141591586 16:85072821-85072843 CAGTGTTTCCAAATGCAGCTGGG - Intronic
1142223234 16:88865418-88865440 CAGTGTTTCCTCAAGGTGACGGG + Intronic
1142598395 17:1040535-1040557 CATTATTTTCTTAAGCTGATGGG - Intronic
1144947071 17:18974981-18975003 CAGAGTTTCCATGAGCTGTGAGG - Intronic
1147974719 17:44240186-44240208 CAGTCTTCCCATAAACTGCTAGG + Intergenic
1148964444 17:51422874-51422896 CAGTGTTACCAGAGCCTGATAGG + Intergenic
1149039445 17:52170679-52170701 CAGAGTTTCAAGAGGCTGATGGG + Intergenic
1149232134 17:54546790-54546812 CAGTGTTTCTGTAAGGGGATGGG - Intergenic
1155157139 18:23167359-23167381 CAGTTTTTTCAAAAGCTGTTTGG + Intronic
1155649608 18:28125377-28125399 CAGTGATTCCAAAGGCAGATAGG + Intronic
1157092745 18:44655217-44655239 CAGGGTTTCCATAAGCACATAGG + Intergenic
1157658111 18:49412966-49412988 CAGTGATCACACAAGCTGATGGG - Intronic
1159728937 18:72000798-72000820 CTGTGTTTCCATTAGCTGCTGGG - Intergenic
925284385 2:2706275-2706297 CAGGTTTTCCACAAGCGGATGGG - Intergenic
925819071 2:7781389-7781411 GAGTGTTTTCATAGGATGATTGG + Intergenic
926563726 2:14446008-14446030 TAGTTTTTCCATAGGCTGCTTGG + Intergenic
929902716 2:46019649-46019671 CAGTTTTACCATAGGCTAATTGG - Intronic
930280153 2:49360285-49360307 CAGTATTTCCATTATCTGTTAGG - Intergenic
932916485 2:75864829-75864851 CAGTTCTTCCATAAACTGTTGGG + Intergenic
933116041 2:78473130-78473152 AAATGTTTCCATAAATTGATTGG + Intergenic
938683477 2:133715048-133715070 CAGTGTTTAAGTAGGCTGATGGG + Intergenic
939116003 2:138061450-138061472 TAGTGTTTCTATAACCTGAAAGG + Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
941161089 2:162035122-162035144 CAGTGGTTCCATGATTTGATGGG - Intronic
942539527 2:177001322-177001344 CAATGTTTCCAAATGCTGAATGG + Intergenic
942682627 2:178494050-178494072 CAGTCATTCCATAAGATGACAGG + Intronic
943140860 2:183979681-183979703 CAAAATTTCCTTAAGCTGATAGG + Intergenic
943261091 2:185664731-185664753 CAGTGTGTTAATTAGCTGATTGG - Intergenic
945561329 2:211344309-211344331 CAGTGCTTCCTTAAGCTCAAGGG + Intergenic
945584845 2:211647821-211647843 GAGTGAGTCCATATGCTGATTGG - Intronic
946257432 2:218455476-218455498 AAATGTTTCCATCAGTTGATTGG - Intronic
946565856 2:220965047-220965069 AAGTGTTTCCATTAAGTGATAGG + Intergenic
948795523 2:240400406-240400428 CAGTTTTTCCATCAGAGGATTGG + Intergenic
948799690 2:240426641-240426663 GGGTGTTCCCATAAGCTGAGTGG - Intergenic
1172974959 20:38899365-38899387 CAGTGGGTCCCAAAGCTGATCGG + Intronic
1174610875 20:51797867-51797889 CAGTGTCTCCAGAATTTGATTGG - Intronic
1175666445 20:60864105-60864127 CAGTGCTTCCTTAAGCTGTGGGG + Intergenic
1176358157 21:5969879-5969901 CAGTGTTTCCACATGCAGCTGGG + Intergenic
1176421601 21:6520428-6520450 CAGGGTTTCCATTGGCTAATAGG + Intergenic
1178137826 21:29647688-29647710 CAGTCTATCCAAAAGCTGAAAGG + Intronic
1178848787 21:36195899-36195921 CTGTGTTTCCATAATCTTAGAGG + Intronic
1179697091 21:43128744-43128766 CAGGGTTTCCATTGGCTAATAGG + Intergenic
1179765361 21:43568672-43568694 CAGTGTTTCCACATGCAGCTGGG - Intronic
1181663565 22:24372890-24372912 CAGAATCTCCTTAAGCTGATAGG + Intronic
1182533293 22:30979850-30979872 AAGTGTTTCAAGAAGCTGGTGGG - Intergenic
1185225338 22:49648719-49648741 CAGTGTGTCCATCAGCTCCTTGG + Intronic
949265933 3:2156205-2156227 CAGTGCTTCCATAACCAGCTGGG + Intronic
950481490 3:13247027-13247049 CAGTGGTCCCACAAGCTGAAAGG - Intergenic
950981176 3:17306057-17306079 ATGTGTTTCTATAAGCTGTTTGG - Intronic
951976701 3:28518309-28518331 CAGTGTTGACAGAAGATGATTGG + Intronic
954513134 3:51145798-51145820 CAATTTTTCCATAGACTGATGGG + Intronic
955620098 3:60854145-60854167 CAGTGTTACCATATGCTTGTGGG - Intronic
960589237 3:119349603-119349625 CTGTGTTTTCAAAAGCTCATTGG + Intronic
960817893 3:121692014-121692036 CAGTGTTTCCATAAGCTGATTGG + Exonic
964272432 3:154972034-154972056 AAGTGTTCCAATAAGCTGAGTGG + Intergenic
966586895 3:181636261-181636283 CAGTGTTTTCATAATCTGAAAGG + Intergenic
972937485 4:44156280-44156302 CAGTGTGTCCATAAAATGAGTGG - Intergenic
973688766 4:53403192-53403214 CAGTATTTTTATATGCTGATGGG + Intronic
975191147 4:71464082-71464104 CAGTGTATGCATAAGATGAAAGG - Intronic
977031505 4:91890335-91890357 CAAAGTCTCCTTAAGCTGATAGG + Intergenic
977108297 4:92918227-92918249 CAATATATCCTTAAGCTGATAGG - Intronic
977544455 4:98360571-98360593 CAGGGTTTCAATAAGCAGACTGG - Intronic
978359571 4:107915640-107915662 CAGTGTTTCCACAGGATGATGGG - Intergenic
978733209 4:112055619-112055641 CTGTGTTTTCAGAAGCTGCTAGG - Intergenic
978788732 4:112638652-112638674 CAGTGGTCCCATAAGATTATAGG + Intronic
979896617 4:126165789-126165811 CAAAATCTCCATAAGCTGATAGG - Intergenic
980401597 4:132294474-132294496 CAGTGTTTTAAGAAGCTGCTGGG + Intergenic
981211973 4:142117908-142117930 CAAAATTTCCTTAAGCTGATAGG + Intronic
982520528 4:156410930-156410952 CAGTGTTTACAAATGCTGATTGG + Intergenic
982729349 4:158939121-158939143 CAGTGTTTCTGTGAGCTGATCGG + Intronic
983110774 4:163746800-163746822 AAGTGATTCCATCAGCTTATGGG - Intronic
983165003 4:164464719-164464741 TAGTGTTTCCATAAGAAGATGGG - Intergenic
984623894 4:181983889-181983911 CAGTGTTTTAAAAACCTGATCGG + Intergenic
985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG + Intergenic
986522121 5:8630950-8630972 CAAAATTTCCTTAAGCTGATAGG + Intergenic
986629329 5:9754516-9754538 CAAAGTCTCCTTAAGCTGATAGG + Intergenic
987481600 5:18465768-18465790 CGGTGTTTCCATGAGATGGTGGG - Intergenic
987769798 5:22286972-22286994 CACTGTTTCCATAACCAGGTGGG + Intronic
988355378 5:30167048-30167070 CATTTTTTCCATATGCTCATTGG + Intergenic
989958240 5:50379749-50379771 CAAAGTCTCCTTAAGCTGATAGG + Intergenic
991143925 5:63279006-63279028 CAAAATTTCCTTAAGCTGATAGG - Intergenic
991498926 5:67256508-67256530 CATTGTTTCCATCTGCTGAGAGG - Intergenic
992901240 5:81299118-81299140 CAGTATTTCAATAAGTAGATGGG + Intergenic
994319565 5:98377114-98377136 CAGAGTTTCTTTAAGCTGAAAGG - Intergenic
994499484 5:100556818-100556840 CAAAGTCTCCTTAAGCTGATAGG - Intronic
996030500 5:118699454-118699476 CTGTGTTTCCATCTGCTGCTGGG - Intergenic
996233113 5:121090755-121090777 CAATATTTACATAAACTGATAGG - Intergenic
1000288954 5:159851992-159852014 CAAAATCTCCATAAGCTGATAGG + Intergenic
1000972429 5:167728760-167728782 CATTGTCTCCAGGAGCTGATTGG - Intronic
1001800052 5:174535221-174535243 CAGTGGTTACAATAGCTGATGGG + Intergenic
1003333670 6:5150959-5150981 CACTGATTAAATAAGCTGATAGG - Intronic
1006293786 6:33160818-33160840 CAGTGTCTCCATTGGCTGGTGGG - Intergenic
1006439448 6:34043963-34043985 CAGTCTTTCCATATGCTACTGGG - Intronic
1010038746 6:71357210-71357232 CAGTATCTTCTTAAGCTGATAGG - Intergenic
1014424664 6:121289270-121289292 CAGAATCTCCTTAAGCTGATAGG + Intronic
1014964108 6:127725146-127725168 CAGTGTTTATATAAGCAGAGAGG - Intronic
1015711054 6:136140841-136140863 CAAAGTCTCCTTAAGCTGATAGG - Intronic
1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG + Intergenic
1020996158 7:15267742-15267764 CAGTGATTACACAAGCTGAAGGG + Intronic
1021233120 7:18109437-18109459 CAGTGTTTCCTAAAGTAGATGGG + Intronic
1022072810 7:26934364-26934386 CAATATCTCCTTAAGCTGATAGG + Intronic
1023611705 7:41978329-41978351 CCGTGGTACCATAAGCTGTTGGG + Intronic
1024371092 7:48584808-48584830 CAATTTTACCATAAGCTGATTGG - Intronic
1033317145 7:140306861-140306883 CAGAGTTTCCATACGCTGAAAGG + Intronic
1034479974 7:151312276-151312298 CGGTGGTCCCATAAGATGATGGG - Intergenic
1035172732 7:157027991-157028013 CAGCGTTTGCATAACCTAATTGG - Intergenic
1036189081 8:6653564-6653586 CAAAGTCTCCTTAAGCTGATAGG + Intergenic
1038846325 8:31233139-31233161 CAAAGTCTCCTTAAGCTGATAGG - Intergenic
1039903397 8:41768435-41768457 CAGTATGTCCATCAGCTAATAGG - Intronic
1040990238 8:53341912-53341934 CAAAGTCTCCTTAAGCTGATAGG + Intergenic
1042254677 8:66790761-66790783 CAGTGTTTTTATCAGCTGCTTGG + Intronic
1043761262 8:84071301-84071323 CAATGTTTCCCTATGATGATGGG - Intergenic
1044899075 8:96925143-96925165 CATTCTTTTCATAACCTGATAGG - Intronic
1045040509 8:98219461-98219483 CAGAGGTTCCAGAAGATGATGGG + Intronic
1046361259 8:113159971-113159993 CAGTGTTTTGATTAGCTTATGGG - Intronic
1050311660 9:4359344-4359366 CAGTGATTCCAAAAGCAGTTTGG - Intergenic
1051821667 9:21177562-21177584 CAGTATTTCCAGAATCTTATTGG - Intergenic
1055452852 9:76446309-76446331 GAGTTTTTGCAGAAGCTGATGGG + Intronic
1058796957 9:108508087-108508109 CAAAATTTCCTTAAGCTGATAGG + Intergenic
1059559640 9:115321198-115321220 ACATGTTTCCATAAGCTTATTGG - Intronic
1186196191 X:7112141-7112163 CAGTGTTTTCAGAAGCTTTTGGG - Intronic
1186551189 X:10507331-10507353 CAGTGTTTCCATTACCTGGCAGG - Intronic
1189603829 X:42654958-42654980 CAAAATTTCCTTAAGCTGATAGG + Intergenic
1190797930 X:53761147-53761169 CAGTGTTTCCCTCACCGGATTGG + Intergenic
1190917229 X:54820063-54820085 CAGTGTTTCCCTCACCGGATTGG - Intergenic
1192985366 X:76393444-76393466 CAAAGTCTCCTTAAGCTGATAGG - Intergenic
1197593483 X:128438851-128438873 CAGTGTTTCCATAAATTCAGAGG + Intergenic
1197987859 X:132286348-132286370 CAAAATTTCCTTAAGCTGATAGG - Intergenic
1198240706 X:134783166-134783188 CAGTCTTTCCTTAATCTTATAGG - Intronic
1199937192 X:152586154-152586176 CAATATCTCCTTAAGCTGATAGG + Intergenic
1201535483 Y:15043325-15043347 CAAAATTTCCTTAAGCTGATAGG - Intergenic
1201778350 Y:17691230-17691252 CAAAGTCTCCTTAAGCTGATAGG - Intergenic
1201823206 Y:18214762-18214784 CAAAGTCTCCTTAAGCTGATAGG + Intergenic
1201923378 Y:19258668-19258690 CAAAGTCTCCTTAAGCTGATAGG + Intergenic