ID: 960818326

View in Genome Browser
Species Human (GRCh38)
Location 3:121697813-121697835
Sequence TCTCCTCGATGGTTTGTTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960818322_960818326 25 Left 960818322 3:121697765-121697787 CCATTTTCTCAGTCATACTAAAG 0: 1
1: 0
2: 4
3: 26
4: 285
Right 960818326 3:121697813-121697835 TCTCCTCGATGGTTTGTTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960818326 Original CRISPR TCTCCTCGATGGTTTGTTGG AGG Exonic
902488810 1:16765693-16765715 TCTCCTGGATGGGTTGGGGGTGG - Intronic
902882176 1:19379436-19379458 TCTCCTCCCTGATTTGCTGGAGG + Intronic
902888201 1:19422166-19422188 TCTCCTGGCAGGGTTGTTGGAGG - Intronic
906588299 1:47000440-47000462 TCTCCTCTATGCTTTCTGGGGGG + Intergenic
906611297 1:47205479-47205501 CCTCCTCTTGGGTTTGTTGGGGG + Intergenic
908815306 1:68026029-68026051 TCTCATCTATGGATTTTTGGGGG + Intergenic
912771885 1:112471448-112471470 TCTCCTAGATGTTCTATTGGAGG + Intronic
918467168 1:184832509-184832531 TCTCCTCGAGGGTTTTTGTGAGG - Intronic
922056202 1:222044821-222044843 TCTCCTCTATAGTTTTTTTGTGG - Intergenic
923531626 1:234816831-234816853 TCTCCTGGATGGGTTGGGGGTGG + Intergenic
1069025485 10:63535942-63535964 CTTCCTCTATGGTTTGTTGTAGG - Intronic
1069136352 10:64771214-64771236 TATTCTAGATGGATTGTTGGTGG + Intergenic
1078938395 11:15973285-15973307 TCTCCTTGATGCTATGTTAGGGG + Intronic
1084586687 11:70066609-70066631 TCTCCTTGGTGATTTGGTGGCGG + Intergenic
1086752686 11:90518011-90518033 TCTTTTCTATGGGTTGTTGGAGG - Intergenic
1092534864 12:9378474-9378496 TCTCATTTAGGGTTTGTTGGAGG + Intergenic
1093525198 12:20097135-20097157 TTTCCTTGATGGTATATTGGTGG + Intergenic
1098066885 12:66628054-66628076 TCTCCTCGATGCTTATTTTGTGG - Intronic
1099664093 12:85604317-85604339 TCTCCTCTCTGTTTTGTGGGAGG + Intergenic
1099755029 12:86834772-86834794 TCTCCTCATTGGTGTGTAGGCGG + Intronic
1100099398 12:91084706-91084728 TCTATTCAATGGTTTATTGGTGG - Intergenic
1101304180 12:103511087-103511109 TCTCCTCCATTTTTTCTTGGAGG - Intergenic
1102521359 12:113479047-113479069 TCTTCTGGGTGGTTGGTTGGGGG + Intergenic
1103031632 12:117619072-117619094 TCTCCTAGAAGGTTTCTTGAAGG - Intronic
1104151866 12:126091540-126091562 TCTGCTCCATTTTTTGTTGGTGG - Intergenic
1109529355 13:63621222-63621244 TCTCCTTGTTGGTATGTTGGTGG - Intergenic
1110392951 13:74996630-74996652 TCACCACGATGGTTGGTTGATGG + Intergenic
1120130955 14:80807435-80807457 TCTCCTCGATGTTCTATTTGAGG - Intronic
1124244075 15:28055524-28055546 GCTCCTAGATGGTTTGTTTGGGG + Intronic
1126103686 15:45134565-45134587 CCTCCTCGTTGGGTTGTTGGTGG + Intronic
1130969923 15:88724350-88724372 TCTCATCTATGGTTGGTGGGAGG + Intergenic
1134914341 16:18057313-18057335 TCTCCTCGATTTTCTTTTGGGGG - Intergenic
1137602738 16:49767716-49767738 TGTCCTCGATGCTGTGTTTGAGG - Intronic
1138404167 16:56775560-56775582 TCTCCTCAGTAGTTTGCTGGAGG + Intronic
1144439682 17:15270431-15270453 TCCCCTCGTGGGATTGTTGGAGG - Intergenic
1146491525 17:33286706-33286728 GATCTTCGATGGTTTATTGGAGG - Intronic
1148467332 17:47872857-47872879 TCTCCTGGATGCCTTGTGGGAGG - Intergenic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1152456642 17:80420996-80421018 ACCCCTCCATGGGTTGTTGGAGG - Intronic
1157100816 18:44727736-44727758 TCTCCTTGGTGCTTTGTGGGTGG + Intronic
1161204844 19:3035637-3035659 TCTCCGCGGTGGTTGGCTGGGGG + Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925919025 2:8626598-8626620 TCTCCTGGGGGGTTTGTCGGGGG - Intergenic
926351226 2:11996628-11996650 TCTAGTTGATGGTGTGTTGGGGG + Intergenic
930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG + Intergenic
937780951 2:125836936-125836958 TGTCCTCAATGGTTGGTTGTAGG - Intergenic
940211776 2:151262486-151262508 TATCCTAGATGGTTAGTTTGAGG - Intergenic
1169257043 20:4107502-4107524 TCTCAGGGCTGGTTTGTTGGAGG + Intergenic
1177382423 21:20362098-20362120 GCTCTTCTATGGTTTGTTGTTGG - Intergenic
1178420853 21:32442172-32442194 TCTCCTCTGTGGTTTGTTTCAGG + Intronic
1180910933 22:19449452-19449474 TCTCCTCTCTGGAGTGTTGGAGG + Intergenic
1182992176 22:34778352-34778374 TCTCCTTGTGGTTTTGTTGGTGG - Intergenic
1184918842 22:47591397-47591419 TCTTCTCAATTGTTTTTTGGGGG - Intergenic
952848828 3:37711323-37711345 TCTCCTGGATGGTTTCATTGGGG - Intronic
959846039 3:111035232-111035254 TCTCCTAGATGTTCTGTTTGTGG - Intergenic
960818326 3:121697813-121697835 TCTCCTCGATGGTTTGTTGGAGG + Exonic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
976631428 4:87241161-87241183 TCTTCTCGCTGTTTTTTTGGAGG - Intergenic
984119256 4:175722296-175722318 TCTCTTCGGTGGTCTGTTTGAGG - Intronic
990939796 5:61190082-61190104 TCTCCAAAATGGTTTTTTGGAGG + Intergenic
992111310 5:73497080-73497102 TCTCCTCCATGTTATATTGGAGG - Intergenic
992952818 5:81877210-81877232 TTTACTTGATGTTTTGTTGGAGG - Intergenic
993370923 5:87091095-87091117 CCTCCTCTATTGTTTGGTGGAGG - Intergenic
1004668516 6:17772463-17772485 TCTGTTCCATGGTTTTTTGGGGG - Intronic
1011791810 6:90907017-90907039 ACCCCTCCATGGGTTGTTGGTGG - Intergenic
1012215804 6:96582065-96582087 TCTCCTCAAAGGCTTGTTTGAGG - Intronic
1012339647 6:98104361-98104383 TGTCCTCGAGGGTTTGATTGTGG + Intergenic
1016524958 6:144991160-144991182 TCTGCACAATGCTTTGTTGGAGG + Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1023604325 7:41914874-41914896 TCTCCTCGAGGGTTACTTTGGGG + Intergenic
1023754679 7:43405574-43405596 TCTACTAGATGGCTGGTTGGGGG + Intronic
1033572664 7:142647722-142647744 TTTCCTCAATGATTTGTAGGGGG + Intergenic
1034497919 7:151433146-151433168 TCTGCTCTCTGGGTTGTTGGTGG - Intronic
1035430724 7:158818719-158818741 TTTCCTCTTTGGTTTGATGGGGG - Intronic
1036690999 8:10944730-10944752 TCTGCTCTAGGGTATGTTGGGGG - Intronic
1036812180 8:11874764-11874786 CCTCCCCGATGGTTCCTTGGGGG + Intergenic
1043874499 8:85468969-85468991 TCTCCTTGCTAGTTTGCTGGAGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1051147502 9:14043130-14043152 TCTCCTCCATGGTGAGTTGAAGG + Intergenic
1051586537 9:18732657-18732679 TCTCCTCTAATGTTTGTGGGAGG + Intronic
1061100440 9:128487911-128487933 TCTCCTCCAGGGTTTGTTGTTGG - Exonic
1061569044 9:131464786-131464808 TGTCCTCGATGGACTGTTGCCGG - Exonic
1192090543 X:68151425-68151447 TTTTCATGATGGTTTGTTGGAGG - Intronic
1193436125 X:81477037-81477059 TCTTCAAGATGGTTTATTGGGGG + Intergenic
1195692285 X:107636811-107636833 TCTCCTTGAAGTTTTGTTTGGGG + Intronic
1196156007 X:112431158-112431180 TCTCCTACATGGTAGGTTGGAGG + Intergenic