ID: 960819878

View in Genome Browser
Species Human (GRCh38)
Location 3:121718129-121718151
Sequence CCTTTGCCATTTTAGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960819878_960819882 19 Left 960819878 3:121718129-121718151 CCCTAGATCTAAAATGGCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 175
Right 960819882 3:121718171-121718193 AGTGCAATGTATGCTCCATGAGG 0: 1
1: 0
2: 10
3: 36
4: 351
960819878_960819883 20 Left 960819878 3:121718129-121718151 CCCTAGATCTAAAATGGCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 175
Right 960819883 3:121718172-121718194 GTGCAATGTATGCTCCATGAGGG 0: 1
1: 0
2: 14
3: 65
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960819878 Original CRISPR CCTTTGCCATTTTAGATCTA GGG (reversed) Intronic
900075127 1:808450-808472 CTTTTGCAATATCAGATCTATGG - Intergenic
905095514 1:35466803-35466825 CCTTTTCCATTTTGGAAATAGGG - Intronic
905320722 1:37114982-37115004 CCATTCCCATTTTATAGCTATGG - Intergenic
906105223 1:43287500-43287522 CTTTTGCCATTTTAGATATGGGG - Intergenic
909122770 1:71625533-71625555 ACTATGCCATTTTATATATAAGG + Intronic
910308983 1:85801554-85801576 CCTTTACCATTTCAGGTCTAAGG + Intronic
910730064 1:90385410-90385432 ACTTTTACATTTAAGATCTATGG - Intergenic
911225777 1:95304093-95304115 CCTTTGGCATTTTAGACCTTTGG + Intergenic
911355112 1:96807654-96807676 AATTTGCCATTTTTGATGTAAGG + Intronic
911453514 1:98095205-98095227 TCTTGGCCATTTTATATCTTTGG + Intergenic
911554434 1:99326217-99326239 CATTTGCCAGTTTATATTTATGG - Intergenic
917556636 1:176096908-176096930 CCTCTGCCATTTTACATTTGTGG + Intronic
918767773 1:188511067-188511089 CATTTGCCATATTATCTCTAAGG + Intergenic
918980717 1:191555128-191555150 CCTCTGCAAATTTAGATGTAGGG - Intergenic
920103169 1:203530971-203530993 CCTTTGCCATTCTCCACCTAGGG + Intergenic
920585627 1:207157239-207157261 CCATTACCATTTTATATTTATGG + Intergenic
921921488 1:220674962-220674984 CCTTTTCCACTTAAGCTCTATGG + Intergenic
922270967 1:224033349-224033371 CTTTTGCAATATCAGATCTATGG - Intergenic
924675115 1:246167919-246167941 CCTTTGCTCTTTTATATTTAGGG + Intronic
1068507840 10:57925628-57925650 CCTTTATCCTTTGAGATCTACGG - Intergenic
1069496196 10:68905606-68905628 CCTTTGCCATTTTATAGACAAGG - Intronic
1071263173 10:83939556-83939578 TCCATGCCATTTAAGATCTATGG + Intergenic
1073226656 10:101926603-101926625 TCTTTTCCATTCTATATCTAGGG - Intronic
1073420978 10:103423439-103423461 TCTTTGCTTTTTTGGATCTAAGG + Intronic
1074944283 10:118266149-118266171 CCTTTGCCATTTTACAGATGAGG - Intergenic
1081141978 11:39512775-39512797 TCTTTGCCATTTTATAACAAGGG + Intergenic
1081273712 11:41120667-41120689 CCTTTCCCCTTTCAGATCTAAGG + Intronic
1081978102 11:47248624-47248646 CCTTTGCCCTTTTAGCTTCAGGG + Intronic
1082691946 11:56316197-56316219 CCTTTCTCATATTAGATATATGG - Intergenic
1086403100 11:86476779-86476801 CCATTTCCATTTTAGATCCCTGG - Intronic
1086435541 11:86776603-86776625 CCATTGCCATTATACATCTCTGG + Intergenic
1089471087 11:118720727-118720749 CTTTTGACCTTTTAGGTCTAGGG + Intergenic
1090105140 11:123845683-123845705 CTTTTGCCATTTTAGAGATGAGG - Intergenic
1092286857 12:7133563-7133585 CCTTTGCCAGGTGAGATCTGCGG + Exonic
1093003845 12:14031068-14031090 CCCTTTCCATTTTAGAGCTTAGG + Intergenic
1093186177 12:16021935-16021957 ACTTTGGCATTTTTGAGCTAAGG + Intronic
1093664605 12:21796194-21796216 TCTTTGTCATTTTAGAAGTAGGG + Intergenic
1095941601 12:47730896-47730918 CTTGTTCTATTTTAGATCTACGG - Intergenic
1096059338 12:48683148-48683170 CCTTTCCCATTTAATAGCTATGG - Intergenic
1097935958 12:65251190-65251212 ACTATGCCATTTTATATATATGG - Intergenic
1099452898 12:82828943-82828965 CCTTTTCCATTTTCGTTTTAAGG - Intronic
1099578821 12:84415341-84415363 CCTTTGCTTTTTTAGATTCAGGG + Intergenic
1102999428 12:117374187-117374209 CCTTTTCCCTTTTACATCGAGGG - Intronic
1107839533 13:44441561-44441583 CTTTTTCCATTTTAGATGTTAGG - Intronic
1108439535 13:50436599-50436621 GCTCTGCCATTTTTGACCTAGGG + Intronic
1108765809 13:53628035-53628057 TCTTTTCTATTTTATATCTATGG + Intergenic
1110161530 13:72384261-72384283 CTTCTTCCATTTTAGATTTATGG + Intergenic
1112644039 13:101308932-101308954 ACCTTGTTATTTTAGATCTATGG - Intronic
1114324748 14:21577354-21577376 CCTCTGCCATTTAACCTCTAAGG - Intergenic
1115517236 14:34198171-34198193 CCCTTGCCCTTTCAGCTCTAGGG - Intronic
1117763905 14:59060311-59060333 TCTTTGCCTTTTTAGGCCTAAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118016423 14:61665786-61665808 CCATTTCCATTTTTGATGTAGGG + Intergenic
1119747170 14:77052708-77052730 TCTTTGCCATTTTACATGCAAGG - Intergenic
1119787420 14:77323951-77323973 CCTCTGCCTTTTTAAATCTTCGG - Intronic
1124143028 15:27094187-27094209 CCTTTTCCATTTTAGAGTGAAGG + Intronic
1124867753 15:33509982-33510004 TCTTTCCCTTTTTAAATCTATGG + Intronic
1125926735 15:43569125-43569147 TCTTTGCCTTTTGGGATCTAGGG - Intronic
1125939879 15:43668690-43668712 TCTTTGCCTTTTGGGATCTAGGG - Intergenic
1126769378 15:52039919-52039941 ACTTTGGCATTTTAGATTTAAGG + Intronic
1128397167 15:67239668-67239690 TCTGTGCCATATTAGAGCTAGGG + Intronic
1130070014 15:80639245-80639267 CCTCTGCCATTTTATAGCTTGGG + Intergenic
1130964828 15:88689447-88689469 ACTCTGCCATTTATGATCTATGG + Intergenic
1134190757 16:12119548-12119570 CCTTTCCAGTTTTAGAACTATGG - Intronic
1134676892 16:16097075-16097097 CCTTTGGAATTTAAGATCTGAGG + Intronic
1135458733 16:22622625-22622647 CCTTTGCCATTTTACAGATGAGG + Intergenic
1135891503 16:26361372-26361394 CATTTTACATTTTAGACCTAGGG + Intergenic
1138627198 16:58261791-58261813 TCTATGCCATTTTATATCTGTGG - Intronic
1138919532 16:61510432-61510454 TCTTTGCCATTTTAGTTCCTCGG + Intergenic
1141088260 16:81111981-81112003 CCTTTGCCATTTGAGATGACTGG + Intergenic
1141230654 16:82164226-82164248 CTTTTCCCATTTTAGAACTGAGG + Intronic
1141917734 16:87111431-87111453 CCTAGGACATTTTATATCTATGG - Intronic
1143290620 17:5825258-5825280 CCTTTCCCACTTTAGATTTGGGG - Intronic
1149646583 17:58245706-58245728 CCTTTGCTAGTTTAATTCTAGGG - Intronic
1151772628 17:76174409-76174431 CCTTTGCCCGTTTAGACCTTTGG + Intronic
1151997762 17:77621023-77621045 CCTTTGCCATTTTGGAGTCAGGG + Intergenic
1157301535 18:46483237-46483259 TCTTTGTCATTTTAGATTGAGGG + Intronic
1160283385 18:77515293-77515315 CCTTTTCCATTTTATTTCTGGGG - Intergenic
1164290836 19:23867431-23867453 CCTTTGACATTTTAAATCCTAGG - Intergenic
1164942218 19:32259645-32259667 CCTTTGTCATGTCAGATATATGG - Intergenic
1166493197 19:43277548-43277570 CCTTTGCTATGTTATATTTATGG - Intergenic
1166802836 19:45468812-45468834 CCTTTTCCATCTCAGATCTAGGG - Intronic
1167553258 19:50175693-50175715 TCTTGGCCATTTTAGATGTCAGG + Intergenic
1167865997 19:52328546-52328568 CCTTTGCCATTTTAAAGTGATGG + Intergenic
1168459947 19:56546117-56546139 CCTTTTCCATTTTATAGCTGGGG + Intronic
926666901 2:15535216-15535238 ACTATGCCATTTTATATCAAGGG - Intronic
927247741 2:20971445-20971467 CCTTTCCCATTTTCAATCTTTGG - Intergenic
928229228 2:29482046-29482068 CTTTTCCCATTTGAGATCTGTGG - Intronic
931411329 2:62034762-62034784 CCTTTGCCCTTTGATTTCTAAGG + Intronic
932516435 2:72354910-72354932 CCCACACCATTTTAGATCTAAGG + Intronic
932577818 2:72972440-72972462 CCTCTGCCATCTGAGATCTTGGG + Intronic
935358813 2:102230252-102230274 CTTTTCCCATTTTCTATCTATGG + Intronic
938615363 2:132992120-132992142 CCTTTCCCATTTTACAGATAAGG + Intronic
941099922 2:161284164-161284186 CCTTTGCCCTTTTAAGTCTACGG + Intergenic
941271133 2:163430421-163430443 CCTTTTCCAGTTTAAATCCATGG + Intergenic
941545021 2:166838732-166838754 ACTTTGACATTTTGGATGTATGG - Intergenic
941879988 2:170471529-170471551 CCTCTTATATTTTAGATCTATGG + Intronic
942320141 2:174729584-174729606 CTTTTACCTTTTTAGATCCATGG - Intergenic
947510650 2:230750837-230750859 CTTTTCCCATTTTAGAGATAAGG + Intronic
948116430 2:235496819-235496841 CCTTTGCGATTTGAGATTTTAGG + Intronic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1168859223 20:1033954-1033976 CCTTTGCCCTTTCAGCTCTGGGG + Intergenic
1169470205 20:5878483-5878505 CCCTTGCCATTCTAGTTCTGTGG + Intergenic
1171248640 20:23632758-23632780 CCTTTGCCATTTTAGGACAGGGG - Intronic
1173093535 20:40001104-40001126 ACTTTTCCCTTTTAAATCTAAGG + Intergenic
1174884564 20:54318335-54318357 CTTTGGCCATTTTTCATCTATGG + Intergenic
1179648539 21:42791512-42791534 TCTCTGCCATTTCAGACCTAAGG + Intergenic
1180633921 22:17249121-17249143 CCTGTGCCATTTTAAAGGTAGGG + Intergenic
1184598983 22:45531693-45531715 CCTTTCCCCTTCCAGATCTAGGG + Intronic
949254640 3:2031025-2031047 CCTCTGCCATTTTGTATCCATGG - Intergenic
951633605 3:24748149-24748171 CCTTTGCTATTTTAGAGACATGG + Intergenic
951997800 3:28750603-28750625 CCCTTGCCTTTTTTGATCTTTGG - Intergenic
952041444 3:29266618-29266640 CCTTGGCCACCTTAGCTCTAGGG - Intergenic
952094208 3:29928945-29928967 CCTTTGTCATTGAAGCTCTAAGG + Intronic
952841799 3:37652853-37652875 TCTCTGACATTTCAGATCTATGG - Intronic
956889947 3:73603004-73603026 TCTTTGCTATTATAGTTCTAGGG + Intronic
958676850 3:97276707-97276729 CTTTTGACCTTTTAGGTCTAGGG + Intronic
959849011 3:111066706-111066728 CCTTTGTCCTTCTAGTTCTAAGG - Intergenic
960012809 3:112851664-112851686 TCTTTGCCTTTTTAAATCTTTGG - Intergenic
960361376 3:116716038-116716060 CCTTTGCCATTTTTGAGTCATGG - Intronic
960819878 3:121718129-121718151 CCTTTGCCATTTTAGATCTAGGG - Intronic
961077942 3:123998988-123999010 CCCTTGCCCTTTCAGGTCTAGGG + Intergenic
961181041 3:124877717-124877739 CCTCTGCCATCTTGGATGTAGGG + Intronic
961306622 3:125962346-125962368 CCCTTGCCCTTTCAGGTCTAGGG - Intergenic
962581825 3:136804888-136804910 ACTCTGCCATTTTAGAGCTGAGG + Intergenic
966402427 3:179561814-179561836 CCTTTGCCACTCTTGATCAAGGG - Intergenic
976735281 4:88302692-88302714 CCTTTGGTATTTTTTATCTAGGG + Intergenic
985380189 4:189385952-189385974 TCTTTTACATTTTACATCTAAGG + Intergenic
988308965 5:29532314-29532336 TCTTTTTCATTTTAGATTTAGGG + Intergenic
988315795 5:29625855-29625877 CCTTTGCCTGTTAAGATCTATGG + Intergenic
988590269 5:32542702-32542724 ACTGTGCCATTTTACATCTGTGG - Intronic
989257484 5:39381064-39381086 CTTTTGCCATAATAGATCGAAGG - Intronic
990997007 5:61742766-61742788 CCCTTTCCATATTAGATGTAGGG - Intronic
992140384 5:73790778-73790800 CCTTTGCCATTTTAATTCTCTGG + Intronic
992567856 5:78019155-78019177 CTTCTGCCATTTTACTTCTATGG - Intronic
993063000 5:83063130-83063152 GCTTTGTCATTTTATTTCTATGG - Intronic
996864160 5:128100320-128100342 CCTTTCCCATTTTTCATATAAGG - Intronic
997907212 5:137830156-137830178 ACTTTTCCATTTTATAACTAAGG + Intergenic
999080239 5:148836704-148836726 CCTATGCCAGTATATATCTAAGG - Intergenic
999635680 5:153619623-153619645 CCTTTTCCATTTTAAATAAATGG - Intronic
1008756421 6:54799819-54799841 CTTTTCAGATTTTAGATCTATGG - Intergenic
1012623380 6:101376635-101376657 TCTTTGCCATTTGAGAGCCAGGG - Intergenic
1013881594 6:114908907-114908929 GCTTTGCCATTTTAGTTCGTAGG + Intergenic
1015908207 6:138139426-138139448 CCTTTGCCATTTTTAATATTGGG - Intergenic
1015917860 6:138236259-138236281 GCTCTGCCATTTTAAATTTATGG - Intronic
1016406364 6:143735468-143735490 TCTTAGCCATTTTAGGTTTACGG + Intronic
1017247756 6:152245563-152245585 CCCTTGTCCTTTTAGATTTATGG - Intronic
1018854943 6:167668557-167668579 CCTTTGCCGTTTCAGAGCCAGGG + Intergenic
1019075980 6:169388571-169388593 CATTTTCCATTTTAGCTCTGAGG + Intergenic
1020395242 7:7708466-7708488 CATTTACCATTTTGGATATAAGG + Intronic
1023141296 7:37104999-37105021 TCCTTGCCATTTTATATTTATGG - Intronic
1024287539 7:47772405-47772427 CCCTGGCCATTTTAGAACTTCGG - Intronic
1024950729 7:54857875-54857897 CCTTTGCCCTTTCACATCTTGGG + Intergenic
1025535777 7:61946452-61946474 CCTTAGCCCTTTGAGACCTATGG + Intergenic
1026070312 7:67112973-67112995 CATTTGCCATGTTAGAACCATGG + Intronic
1026706597 7:72699296-72699318 CATTTGCCATGTTAGAGCCATGG - Intronic
1028259056 7:88639001-88639023 CCTTTCCCATTTTGGCTCTTGGG - Intergenic
1028270021 7:88777005-88777027 CCTTTGCCCTTCCAGCTCTAGGG - Intronic
1028437795 7:90824696-90824718 ACTTTGCCATTTTTGATCTATGG + Intronic
1031407416 7:121403356-121403378 CATTTGCCACATCAGATCTATGG + Intergenic
1032154215 7:129455038-129455060 CCTATGCCATTTTAATTCCATGG + Intronic
1032165053 7:129538933-129538955 ACTTTGCCATTTTGGCTCTTGGG + Intergenic
1032329475 7:130964301-130964323 CATTTCCCATTTTAGAGCTGAGG - Intergenic
1035540521 8:433037-433059 CTTTTGCAATATCAGATCTATGG + Intronic
1038888866 8:31695952-31695974 CTTTTGCCATTTTACAGTTAAGG - Intronic
1041519570 8:58740520-58740542 CCTTTGCCCTTTCAGGCCTAGGG - Intergenic
1042102466 8:65288386-65288408 CCATTGCCAGTTTACATCTGTGG + Intergenic
1043225467 8:77722866-77722888 GCTTTGCAATTTTGGATCAATGG - Intergenic
1045816872 8:106286721-106286743 GCTTTGCCATTTGAAATCCATGG + Intronic
1047288802 8:123511175-123511197 GCTTTGCCATTTTAGGAATACGG + Intronic
1048077170 8:131084269-131084291 CCTATCCCACTTTAAATCTATGG - Intergenic
1050249641 9:3731235-3731257 CCTTTGAAATTTTAGACCTCTGG + Intergenic
1050928735 9:11298324-11298346 TATTTGCCATTTTAAATCTTAGG - Intergenic
1052960323 9:34290445-34290467 CCTTTGTCATTAAAAATCTATGG - Intronic
1055069571 9:72152192-72152214 CCATTGCAAGTTTAGATCTGGGG + Intronic
1056240083 9:84636656-84636678 CCATTGTCATTTTAGATATTTGG + Intergenic
1058352932 9:104048055-104048077 TCTTTGCCATTTTATATCTTTGG - Intergenic
1060711238 9:125866699-125866721 CATCTGCCATTTTAGAACAAAGG - Intronic
1186792007 X:13008761-13008783 CCTTTTCCACTTTAGAGATACGG - Intergenic
1191270734 X:58464639-58464661 CCTTTGCACTTTGAGGTCTAGGG + Intergenic
1193685039 X:84567680-84567702 CCGTTGCCATTTTTGTTCTCTGG - Intergenic
1194574068 X:95589644-95589666 CCTTTGCCCATTCAGTTCTAAGG + Intergenic
1195113765 X:101674836-101674858 CCATAGCCAGTTTATATCTATGG + Intergenic
1195208886 X:102631641-102631663 CCTTTGCCATTTTAAAAATAAGG - Intergenic
1196349688 X:114712605-114712627 CCTTTGCCAAATTAGAGGTATGG + Intronic
1197443459 X:126518928-126518950 TCTTTGCTCTTTTAGATCTATGG + Intergenic
1197504749 X:127287983-127288005 CCTATGCCATCATAGATGTAAGG - Intergenic
1201364468 Y:13188187-13188209 CCTTTGCCAACTTACATTTAAGG - Intergenic
1201402414 Y:13617626-13617648 TGTTTGCCTTTTTAGTTCTACGG + Intergenic