ID: 960821562

View in Genome Browser
Species Human (GRCh38)
Location 3:121738536-121738558
Sequence AATGCCCACTGGCTCTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960821562_960821567 25 Left 960821562 3:121738536-121738558 CCTCAAAAGAGCCAGTGGGCATT 0: 1
1: 0
2: 2
3: 17
4: 127
Right 960821567 3:121738584-121738606 ACAGAACAGTAGTTGATACAAGG 0: 1
1: 0
2: 0
3: 22
4: 174
960821562_960821569 29 Left 960821562 3:121738536-121738558 CCTCAAAAGAGCCAGTGGGCATT 0: 1
1: 0
2: 2
3: 17
4: 127
Right 960821569 3:121738588-121738610 AACAGTAGTTGATACAAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 195
960821562_960821568 28 Left 960821562 3:121738536-121738558 CCTCAAAAGAGCCAGTGGGCATT 0: 1
1: 0
2: 2
3: 17
4: 127
Right 960821568 3:121738587-121738609 GAACAGTAGTTGATACAAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 120
960821562_960821570 30 Left 960821562 3:121738536-121738558 CCTCAAAAGAGCCAGTGGGCATT 0: 1
1: 0
2: 2
3: 17
4: 127
Right 960821570 3:121738589-121738611 ACAGTAGTTGATACAAGGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960821562 Original CRISPR AATGCCCACTGGCTCTTTTG AGG (reversed) Intronic
901953662 1:12769050-12769072 CATCCCCACTGGCTCTTCTAGGG - Intergenic
904028070 1:27517399-27517421 AATGCCCTCTGCCACTTTTCCGG - Intergenic
907562348 1:55402546-55402568 ACTTCCCACTGTCTCTCTTGAGG - Intergenic
909212765 1:72845398-72845420 AATCCCTACTGACTCTTTTTGGG - Intergenic
916430154 1:164720277-164720299 AATGACCACAGGCAATTTTGTGG + Intronic
916901123 1:169224917-169224939 AATGGCTACTTCCTCTTTTGTGG - Intronic
918008141 1:180561341-180561363 AATGCCCACTGCATCCTCTGTGG - Intergenic
920316239 1:205077395-205077417 ACTGCCAACTGGCTCATTGGTGG + Exonic
921974066 1:221182109-221182131 ATTGCCCACTGGCTCTCTTCAGG + Intergenic
923329046 1:232905779-232905801 AAACCCAACTGGCTCTTCTGTGG - Intergenic
924632809 1:245757956-245757978 AAATCCCAATGGCTTTTTTGGGG - Intronic
1063014468 10:2062238-2062260 GATGCCCACTGGCCCTTTGCAGG - Intergenic
1063780418 10:9316211-9316233 AATGTCCCCTGGGTCTTCTGAGG + Intergenic
1065185100 10:23163622-23163644 AATGCCACCTGGCCCCTTTGAGG - Intergenic
1066697958 10:38095082-38095104 AATGCCCACTGGTGCTAATGGGG - Intronic
1069118499 10:64538118-64538140 AATGCCCTCTGTCTCCTTGGAGG - Intergenic
1069479172 10:68765340-68765362 AATACCTACTGGCTGTTTTTTGG + Intronic
1069646898 10:70006636-70006658 AATGCCTACTGGATATTTTGGGG - Intergenic
1069671215 10:70205934-70205956 AATTCCCATTGATTCTTTTGCGG + Intronic
1072520178 10:96224096-96224118 AATGCCCCGTGGATCATTTGTGG - Intronic
1073454842 10:103630189-103630211 CATGCCCTCTGGCTGTTTTGGGG - Intronic
1080479666 11:32633428-32633450 TACCCCAACTGGCTCTTTTGGGG + Intronic
1081134146 11:39417402-39417424 TATGCCCACAGTCTCTTCTGAGG + Intergenic
1081861112 11:46333799-46333821 GATGCCCCCTGGCCCTTCTGGGG + Intronic
1083528667 11:63396797-63396819 AATTCAGAATGGCTCTTTTGAGG - Intronic
1084755687 11:71237194-71237216 ATTGCCCACTGGCTACTTGGTGG - Intronic
1086119024 11:83286311-83286333 AATGGCCGCTGGCTATCTTGGGG - Exonic
1088895645 11:114076347-114076369 AAGGGCCACTGGCTCATTTCTGG + Intronic
1093933319 12:24975797-24975819 AATCCCTACTGGCTCTTTTCAGG + Intergenic
1095593954 12:43938051-43938073 AATCCCTACGGGCTCTTTTCAGG - Intronic
1097117863 12:56711544-56711566 AATGCACACTGGGGCTTTTGTGG - Intergenic
1098084498 12:66827764-66827786 AACAAGCACTGGCTCTTTTGAGG + Intergenic
1099368507 12:81799959-81799981 TATGCCCACTGTCTCATTGGGGG - Intergenic
1101446399 12:104739745-104739767 AAACCTCACTGGCTCTTATGAGG - Intronic
1102972900 12:117184784-117184806 AATGTCTACTTACTCTTTTGTGG - Intronic
1106127703 13:26913836-26913858 AATGCCAACAGTCTCTGTTGTGG + Intergenic
1108646067 13:52429890-52429912 AATCCCTATTGGCTCTCTTGGGG - Intronic
1109721872 13:66285326-66285348 AATTCCCACTGTCTCTCTTGTGG + Intergenic
1110780493 13:79459661-79459683 AGTGCCCACTGGCTCTGCTCTGG + Intergenic
1113484392 13:110643615-110643637 AAGGCGCTCTGGCTCTTTTGGGG - Intronic
1115943171 14:38630735-38630757 AAGGCACTCTGGCTCTTTAGTGG - Intergenic
1118135350 14:63019311-63019333 AATGACAACAGGCTTTTTTGAGG + Intronic
1120886535 14:89456219-89456241 AGGGCCCACGGGCTCTTTTGTGG - Intronic
1122406582 14:101504558-101504580 GCTCCCCACAGGCTCTTTTGAGG - Intergenic
1127500333 15:59548794-59548816 ACTACCCTCTGCCTCTTTTGAGG - Intergenic
1129684927 15:77680373-77680395 AATCCCCACTGCCCCTTTGGGGG + Intronic
1132899195 16:2244166-2244188 CCTACCCACTGGCTCTTTTCTGG + Intronic
1137002247 16:35239362-35239384 AATCCCCTCTGGCACTTATGGGG - Intergenic
1137016161 16:35377579-35377601 AATCCCCTCTGGCACTTATGGGG - Intergenic
1137415592 16:48275435-48275457 AGTGCTCACTGGCTCTATAGAGG + Intronic
1140981980 16:80119231-80119253 AATTCCCCTTGGCTCTTTTAGGG + Intergenic
1141135405 16:81461614-81461636 AAATCCCACTGGCTCCCTTGAGG - Intronic
1142540607 17:655809-655831 AATGCCAACTTTCTCTTTTGGGG - Intronic
1142933505 17:3308487-3308509 AAATCCCACTGGATCTTTTTGGG - Intergenic
1150165294 17:62935661-62935683 AATGCCTGTTGGCTATTTTGGGG - Intergenic
1151266826 17:72962984-72963006 AAGGCCCACTCTCTCTTTTAAGG + Intronic
1159868089 18:73729687-73729709 AAAGCCCACTGGCCTTTTGGGGG - Intergenic
1163564507 19:18042467-18042489 AATGCCCATTGGCTCTTATGTGG - Intergenic
1165181800 19:33978133-33978155 AATGCCCATTCCATCTTTTGGGG + Intergenic
927810937 2:26179866-26179888 AATGCCCACTGCCCCCTGTGGGG - Intronic
928729909 2:34219730-34219752 AACGCCCACTGATTCCTTTGAGG - Intergenic
932697413 2:73968439-73968461 AAGGCCCTCTGGCTCCTCTGTGG - Intergenic
933522292 2:83389248-83389270 TAAGCCTACTGGCTCTTCTGTGG - Intergenic
939163978 2:138620587-138620609 AATCCCTACTGGCTCTTTTTGGG - Intergenic
942433923 2:175950045-175950067 AATGCTTGGTGGCTCTTTTGGGG - Intronic
945035999 2:205704434-205704456 ACTGCTCACTGGCTCCTTAGGGG - Intronic
948587842 2:239030880-239030902 AATGCCCACTGGCTGGTGAGTGG - Intergenic
1173315601 20:41940439-41940461 ACTGACCACTGGCTCTTCTGTGG + Intergenic
1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG + Intronic
1176744693 21:10640875-10640897 AAGTCCCCCTGCCTCTTTTGGGG + Intergenic
1180839434 22:18952277-18952299 AGAGCCCCCTTGCTCTTTTGGGG - Intergenic
1181133248 22:20746844-20746866 AGTGCCCTCTGGCTTTTGTGGGG - Intronic
1182535093 22:30995124-30995146 AATTTCCACTTCCTCTTTTGTGG - Intergenic
1183511606 22:38238597-38238619 ACTGGCCTCTGGCTCTTGTGTGG + Intronic
949873146 3:8606456-8606478 CTTGCCCTCTGGCTTTTTTGAGG - Intergenic
952233980 3:31460141-31460163 CATGCACACTGGCTCATTGGTGG + Intergenic
953038810 3:39236937-39236959 ATTACCCACTGGCTCTGTTCGGG + Intergenic
954284706 3:49610681-49610703 AATGCCTATTGTCTATTTTGTGG - Intronic
954499206 3:50994494-50994516 AATGTCCACTGGCTTTCTTGAGG - Intronic
954904305 3:54046822-54046844 ATTGCCCACTGGCTCTACTCTGG - Intergenic
958544857 3:95532420-95532442 AATGTCCACTTTCTCTTTTCTGG + Intergenic
960445822 3:117747364-117747386 AATGTCCATTTGCCCTTTTGAGG + Intergenic
960821562 3:121738536-121738558 AATGCCCACTGGCTCTTTTGAGG - Intronic
960838497 3:121932219-121932241 AAAGCCCACTGTCTCTGTAGGGG + Intronic
964840018 3:160983678-160983700 GGTGCCCACTGGCTCTTTATTGG + Intronic
967903872 3:194485956-194485978 TATGACCTCTGGCTTTTTTGGGG - Intronic
969576108 4:8036627-8036649 AAGGCCTACTGGCTCTTTTGTGG - Intronic
970318069 4:14848004-14848026 AATGCCAACAGGCTATTTTCAGG + Intergenic
970396302 4:15670643-15670665 ATTGCCCAGTGTTTCTTTTGTGG - Intronic
970786913 4:19808995-19809017 AATACACACTGGCTGTTGTGTGG + Intergenic
971258313 4:25033017-25033039 AACGCCCAGTGCCTCCTTTGTGG - Intergenic
973804595 4:54513681-54513703 AAGGCTCACTGGCTCTGATGGGG - Intergenic
975179904 4:71332948-71332970 AATTCCCAATAGCTGTTTTGCGG - Intronic
977074056 4:92431686-92431708 AATTCAAACTGGCTGTTTTGAGG - Intronic
979605885 4:122638556-122638578 AGAGCCCATAGGCTCTTTTGGGG - Intergenic
979654998 4:123181688-123181710 TTGGCCCACTGGCTGTTTTGGGG + Intronic
980728095 4:136790797-136790819 AGTTACCACTGGCTCTTTTCAGG + Intergenic
983765771 4:171481056-171481078 AATCCCAACAGGCTATTTTGTGG + Intergenic
984087681 4:175332560-175332582 AATGACCACAGGTTCTTTTGGGG - Intergenic
987374419 5:17219632-17219654 AACGCCCACTGACAGTTTTGAGG - Intronic
987809201 5:22811976-22811998 AGTGGACACTGGCTCTTTAGGGG + Intronic
988366390 5:30305774-30305796 GATGCCCACTGGCTTTGGTGAGG - Intergenic
988813076 5:34804430-34804452 AATGCAAACTGGCTGTTTTCAGG + Intronic
989956024 5:50361091-50361113 AATGCCTACTTACTATTTTGGGG + Intergenic
990707245 5:58543183-58543205 AATGTTCACTGTCTCTTGTGAGG + Intronic
992008641 5:72505227-72505249 AATGCCAACTCACTCTTTGGCGG + Intronic
993058805 5:83014498-83014520 AATGCCCAGTTGCTTCTTTGGGG - Intergenic
993371056 5:87092565-87092587 AAAGCCCACTGTCTCTGTAGGGG - Intergenic
993835023 5:92809369-92809391 AAGGCCCACTTGCTTTTTTGGGG - Intergenic
998186871 5:139986961-139986983 AATCCCCAAAGGCTCTTTAGGGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000576983 5:162986953-162986975 AATGGCCACTTGCTCTTCTCTGG - Intergenic
1000821686 5:165992499-165992521 AATACTCACAGGCTGTTTTGAGG + Intergenic
1001810721 5:174626117-174626139 AATGCTGAGTGGTTCTTTTGTGG - Intergenic
1002706130 5:181161683-181161705 AATGCCCACAGTGTCTTCTGGGG - Intergenic
1002906333 6:1452204-1452226 AAGTCCCACCAGCTCTTTTGAGG - Intergenic
1008288923 6:49688470-49688492 AATGCCCAGTGACTCATTTGTGG - Intergenic
1009594148 6:65712587-65712609 AATGGCAACTGGCAATTTTGGGG - Intergenic
1017151090 6:151281465-151281487 AGTGCCCACTTTATCTTTTGAGG + Intronic
1017379808 6:153814766-153814788 AATTCACAATAGCTCTTTTGAGG + Intergenic
1022293137 7:29022761-29022783 AATGCCCACAGGCACTGGTGAGG - Intronic
1024420905 7:49165481-49165503 ACTGGCCACTAGCTATTTTGGGG + Intergenic
1026134421 7:67646906-67646928 ACTGGCCACTGGCTCTGTGGTGG - Intergenic
1027469673 7:78557322-78557344 AATGCTAACTGGCTCCTTTGGGG - Intronic
1028901123 7:96101480-96101502 AATGCCCATAGGTCCTTTTGGGG - Intronic
1031254916 7:119435275-119435297 AATCCCCATTGGCTGTTTTCAGG + Intergenic
1031456754 7:121990437-121990459 AATGGACACTGGCTCTTCTAAGG + Intronic
1034726737 7:153343236-153343258 CATTCCCACTTTCTCTTTTGGGG + Intergenic
1035118596 7:156546078-156546100 AATGCACACAGGATCTCTTGGGG + Intergenic
1036481065 8:9140050-9140072 AAAACCCACTGGCTCCTGTGCGG - Exonic
1039017957 8:33173889-33173911 AATGCCCACTTCCTGTTTTCAGG - Intergenic
1039300381 8:36202703-36202725 TATGTGAACTGGCTCTTTTGGGG + Intergenic
1045872460 8:106941878-106941900 TATGCCCACTCTCTCTCTTGTGG + Intergenic
1047970841 8:130083100-130083122 AAGGCCCTCTGGCTCTGCTGTGG + Intronic
1049647986 8:143745046-143745068 AATGGCCACAGACTCCTTTGGGG + Intergenic
1049874501 8:145007611-145007633 AAGTCCCACTGGGGCTTTTGGGG + Intergenic
1049961116 9:739107-739129 GATGTCCACTGGCTCTATTCTGG - Intronic
1050507296 9:6361401-6361423 AATGGCCACTGGTCCTTTTAGGG + Intergenic
1058155943 9:101514894-101514916 AGTGTCCCCTGGTTCTTTTGAGG - Intronic
1059401593 9:114073795-114073817 AGTCCCCACTGGTTCTTTTAAGG + Intronic
1062617612 9:137405096-137405118 AATGGCCACTGGCTCACCTGTGG - Intronic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic
1188199520 X:27281917-27281939 AATGCACACTGGCTGTTTTAGGG - Intergenic
1195702801 X:107717313-107717335 AATGCCCTCTGCCTCTTGTTAGG - Intronic
1196694482 X:118596709-118596731 AAAGCCAAAAGGCTCTTTTGGGG + Intronic
1197094911 X:122582338-122582360 AATGCAGACTTGCTCTCTTGGGG - Intergenic
1197198300 X:123725782-123725804 AATGCCATCTAGGTCTTTTGTGG + Intronic