ID: 960821722

View in Genome Browser
Species Human (GRCh38)
Location 3:121740346-121740368
Sequence GTAGAGTCACATGCAGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 2, 1: 6, 2: 16, 3: 32, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960821722 Original CRISPR GTAGAGTCACATGCAGTTGT AGG (reversed) Intronic
901052000 1:6429947-6429969 GTCGAGTCACATGCTGCTGTGGG - Intronic
902083329 1:13836731-13836753 GTAGATTTGCATGTAGTTGTAGG + Intergenic
902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG + Intergenic
902532138 1:17097364-17097386 GAAAAGTCACATGCAGGTCTAGG - Intronic
907997485 1:59647622-59647644 ATTTAGTCCCATGCAGTTGTAGG + Intronic
908819155 1:68065642-68065664 GAAGATTCACATGCAATTGTAGG - Intergenic
909205754 1:72755448-72755470 GTTGGTTCACGTGCAGTTGTAGG - Intergenic
909918130 1:81346487-81346509 GTACAGTCACATGCAGGGTTAGG - Intronic
912139658 1:106707785-106707807 ATAAAGACACATGCACTTGTGGG - Intergenic
913079327 1:115367407-115367429 TTAAATTCACATGCAGTTGCAGG + Intergenic
914506131 1:148290555-148290577 GTAGATTCACATGGAGTTATAGG - Intergenic
920633946 1:207680503-207680525 TCAGATTCCCATGCAGTTGTAGG - Intronic
921824990 1:219662456-219662478 GTTTGGTGACATGCAGTTGTTGG - Intergenic
922242660 1:223766051-223766073 ATAAAGTCACCTGTAGTTGTTGG - Intronic
922333506 1:224598862-224598884 GTGGAGTCACATGAATTTTTTGG - Intronic
922897462 1:229111534-229111556 GTTCAGTCACATGCATTTCTTGG + Intergenic
923957186 1:239035728-239035750 GTATAATCACATGCATCTGTTGG - Intergenic
1063445894 10:6116622-6116644 GGAAAGTCACATGCAGTATTTGG - Exonic
1068308746 10:55251005-55251027 GACAATTCACATGCAGTTGTAGG + Intronic
1068827635 10:61456805-61456827 GTGGAGTACCATGCAGCTGTGGG + Intergenic
1070996043 10:80783630-80783652 GTGGATTCACATGCAGTTGTAGG + Intergenic
1071719699 10:88131071-88131093 AGAGAGTCCCAGGCAGTTGTGGG + Intergenic
1072417213 10:95259224-95259246 GTAGATTCACTTGCAGTTATAGG - Intronic
1074144329 10:110703060-110703082 GTAGATTCAGATGCACTTGTAGG + Intronic
1074682471 10:115921986-115922008 GTTGACTCACCTCCAGTTGTAGG + Intronic
1075201375 10:120407233-120407255 GTATAGCCACAGGCAGTTTTGGG + Intergenic
1076184290 10:128434418-128434440 GTAGAGACAGATGCAGGTGACGG - Intergenic
1076229213 10:128806348-128806370 GAAGAGCCACATGCAGTTAGAGG - Intergenic
1076377323 10:130000336-130000358 GTAGGTTCACATACAGTTGTAGG - Intergenic
1078343866 11:10525745-10525767 GTAGAATCTCATGCGGTTGTTGG - Intronic
1083774435 11:64887539-64887561 GCTGAGTCTCATGCAGTTGATGG - Intronic
1087005333 11:93465240-93465262 GTATTTTCACATGCAGTTGTAGG - Intergenic
1087523563 11:99277374-99277396 GTAGAGTCACATGGAAGTCTAGG - Intronic
1089348784 11:117809404-117809426 GCAGAGACACATCCAGTAGTGGG - Intronic
1090800665 11:130169730-130169752 GTAGATTCCCATACAGTTGTAGG - Intronic
1091112285 11:132980981-132981003 GTATAGTAACATGCTGTTGCAGG - Intronic
1094303600 12:28993642-28993664 GGAGAGGAACATGCAGTTGGGGG + Intergenic
1095686561 12:45042555-45042577 GAAGAGTTAAATGCAGTTGATGG + Intronic
1098146290 12:67500875-67500897 GTAGAGTCACAGGAGGTTTTGGG - Intergenic
1099419803 12:82442743-82442765 ATAAAATCACATACAGTTGTAGG - Intronic
1102468696 12:113146432-113146454 GTAGATTTACATGCAGTTTAAGG - Intergenic
1107258726 13:38464369-38464391 GTATATTTACATGCACTTGTAGG + Intergenic
1108197299 13:48007785-48007807 ATAGGTTCACATGCAGTTGTAGG - Intergenic
1108693470 13:52881397-52881419 GTCGAGTCACATGCCTTTGTGGG - Intergenic
1110752114 13:79126721-79126743 GAAGAGTTACCAGCAGTTGTGGG - Intergenic
1111726026 13:92010285-92010307 GTATAGCCACATACACTTGTGGG + Intronic
1112032533 13:95470913-95470935 GTAGGGGCTCATGCATTTGTTGG - Intronic
1112230089 13:97581076-97581098 GTAGATTCACATGCAGTTGTAGG - Intergenic
1116291062 14:43041293-43041315 CAAAAGTCACATGCAGTTTTTGG + Intergenic
1117535883 14:56702969-56702991 GTAGACTCACATGCAGTTGTAGG - Intronic
1117848542 14:59940570-59940592 GTAGTGGCACATTCAGTTGGGGG - Intronic
1118250930 14:64160200-64160222 GTGGAGTCAGATGCATTTGCAGG - Intronic
1119389463 14:74281170-74281192 GTGGAGGCACATGTAATTGTTGG - Intergenic
1122681124 14:103464085-103464107 GAAGAGGCACAGGGAGTTGTGGG - Intronic
1122717588 14:103704934-103704956 GCAGTGGCACATGCAGTTGTGGG + Intronic
1124574887 15:30898465-30898487 GTAGATTCACATGAAGTTGTAGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1127528951 15:59823142-59823164 GTTCAGTCCCGTGCAGTTGTAGG + Intergenic
1128282787 15:66410345-66410367 GTACAGTGACATGCAGTCCTAGG + Intronic
1128679591 15:69638439-69638461 ACAGATTCACATGCAATTGTAGG + Intergenic
1130193417 15:81757579-81757601 GTAGAGTGACATGCAGGAATTGG - Intergenic
1134687514 16:16169237-16169259 GTAGATTCACATGCAGTTCTAGG - Intronic
1136103325 16:28011151-28011173 TTAGAGGCAGAGGCAGTTGTTGG + Intronic
1137911027 16:52378719-52378741 GGAGAGCAACATGCAGTTATTGG + Intergenic
1138013749 16:53410827-53410849 GTAGATTCACATGAAGTTGTAGG - Intergenic
1138809741 16:60135011-60135033 GTAGAGTACCATGCTGTTTTTGG + Intergenic
1139114927 16:63938656-63938678 GTAAATACACATGCAGTTTTAGG + Intergenic
1142239257 16:88937712-88937734 GCAGAGTCACATGCAGTGAGAGG - Intronic
1144454469 17:15407604-15407626 GTAGATTCACATGCAGTTATAGG - Intergenic
1150628072 17:66856352-66856374 GTAGATTCACATGCAGTTGTTGG + Intronic
1151222643 17:72624439-72624461 TTTGAGTCACATACAGTTGGAGG + Intergenic
1151882079 17:76902082-76902104 GTGGGCGCACATGCAGTTGTGGG + Intronic
1155136489 18:22999299-22999321 TCAGGGTCTCATGCAGTTGTAGG + Intronic
1157101677 18:44736029-44736051 GTAGAGTGACCTGCATTTGGAGG - Intronic
1159529958 18:69643147-69643169 GTACATTCATATGAAGTTGTAGG + Intronic
1159740937 18:72169270-72169292 AGAGAGTCACAGGAAGTTGTTGG - Intergenic
1160324532 18:77931802-77931824 GTAGAGTAGTATGGAGTTGTGGG + Intergenic
1162827533 19:13262902-13262924 GTAGGGTCCCATGGAGCTGTGGG - Intronic
1163301675 19:16451258-16451280 GTAGACTCACTTGCAGTTGTTGG - Intronic
1163369274 19:16893083-16893105 CTACAACCACATGCAGTTGTGGG - Exonic
1164505127 19:28853886-28853908 GAAGAGTCAAATACAGTAGTGGG - Intergenic
1164928483 19:32151463-32151485 GTAGATTCATGTGCAGTTGTAGG - Intergenic
1165094737 19:33403921-33403943 GTAGACTTCCAGGCAGTTGTTGG - Intronic
1165633735 19:37323118-37323140 GGAGGGTCACAAGGAGTTGTTGG + Intronic
1168570354 19:57462491-57462513 ATAGATTCACAAGCAGTTGTAGG + Intronic
925861224 2:8177786-8177808 GTAGTTTCACATGCAGTTGCAGG - Intergenic
926882174 2:17557936-17557958 GTAGAAGCACATAGAGTTGTAGG - Intronic
929019485 2:37537462-37537484 ATAGAGTGATATGCAGTGGTGGG + Intergenic
929048729 2:37816149-37816171 CAAGTGTGACATGCAGTTGTAGG - Intergenic
929305854 2:40360754-40360776 CTAGAGTCTCATGGAGTAGTGGG - Intronic
931851727 2:66258154-66258176 GAAGAGGCCCATGCAGGTGTGGG + Intergenic
933934947 2:87195736-87195758 GTAGTTTCACATGTAGTTATAGG + Intergenic
934559482 2:95305347-95305369 GTAGATTCACATGCAGTTGCAGG + Intronic
934957776 2:98638057-98638079 ATAGATTCACACGCAGCTGTAGG - Intronic
936029104 2:109057560-109057582 GGAGAGTCACTTACAGTAGTGGG + Intergenic
936358196 2:111770163-111770185 GTAGTTTCACATGTAGTTATAGG - Intronic
936869271 2:117114378-117114400 GTAGATCTACATGCAGTTGCAGG - Intergenic
937108896 2:119346955-119346977 GTAGATTCACATGTAGATGTAGG - Intronic
937108967 2:119347777-119347799 GTAGATTCACATGTAGATTTGGG + Intronic
938227867 2:129632626-129632648 GTAGAGTTACCTGCAGTTGTAGG + Intergenic
938551244 2:132384276-132384298 GGAGACCCACGTGCAGTTGTGGG + Intergenic
938682845 2:133709788-133709810 GTGGAGTCATATGCATTTGTGGG + Intergenic
940438899 2:153690625-153690647 AAAGAGTCACACACAGTTGTGGG - Intergenic
941036407 2:160573800-160573822 GTACATTCACATGCAATTGTAGG - Intergenic
942425720 2:175858434-175858456 GTAGATTCACGTACAGTTTTAGG + Intergenic
944746362 2:202660715-202660737 CTAGAGGCATATCCAGTTGTAGG - Intronic
947835920 2:233175569-233175591 GTACAGTCCCATGCATTTTTAGG - Intronic
947911094 2:233801491-233801513 GAAGTGACTCATGCAGTTGTGGG + Intronic
947916552 2:233835925-233835947 GGAGAGGCACAAGCAGTTCTGGG + Intronic
948689980 2:239695825-239695847 GTAGATTCACATGCAGTTGCAGG + Intergenic
1171390713 20:24800045-24800067 GTATGGTCACATACAGCTGTAGG + Intergenic
1172285239 20:33735659-33735681 GTAGATTCACATGCAGTTGTGGG + Intronic
1173288193 20:41691702-41691724 GTAAAGTGTCATGCACTTGTGGG - Intergenic
1174219259 20:48939543-48939565 GAAGAGGCCCATGAAGTTGTGGG - Intronic
1175530638 20:59672419-59672441 GTAGAATCACACTCAGTGGTCGG + Intronic
1175571270 20:60024597-60024619 CTAGAGTCAGATGCAGTGATTGG + Intronic
1175620236 20:60438672-60438694 GTAGGTCCATATGCAGTTGTAGG + Intergenic
1175684667 20:61019790-61019812 ACAGATTCACATGCAGTTCTAGG - Intergenic
1175710747 20:61218751-61218773 GTAGATTTAGATGCAGGTGTAGG + Intergenic
1175811111 20:61857702-61857724 GTAGAGTCACATGCAGTTGTAGG + Intronic
1176206163 20:63889322-63889344 GTAGACTCACATACAGTTGTGGG + Intronic
1177181438 21:17748527-17748549 ATAGAGACACATGCACATGTAGG - Intergenic
1179447355 21:41441490-41441512 GGAGAGCCACATGCTGTTCTGGG + Intronic
1181283178 22:21734546-21734568 GTAGAGTCTCATCTACTTGTGGG - Intronic
1182927666 22:34140954-34140976 GTAAATTCACATGAAGTTTTAGG + Intergenic
1185091179 22:48774801-48774823 GTAGATTCACATGCGGTTGTAGG + Intronic
949588602 3:5468684-5468706 GTAAAGTGACATGCAGTTTCTGG + Intergenic
950450059 3:13060430-13060452 GCGGAGGCAGATGCAGTTGTAGG + Intronic
950756735 3:15179583-15179605 AGAGAGTCACATGCAGCTGGTGG + Intergenic
955490654 3:59478820-59478842 GTAAAGTCCCATGCAGTATTTGG + Intergenic
957426332 3:80044628-80044650 GTTGAGTCTCCAGCAGTTGTTGG + Intergenic
958489821 3:94758140-94758162 GAAGGATCACATGCAGTAGTAGG - Intergenic
959078761 3:101778906-101778928 CTAGAGTCAACTGCGGTTGTGGG + Intergenic
959861413 3:111219718-111219740 ATAGATTCACAAGCAGTTGGAGG + Intronic
960092984 3:113660618-113660640 GAAGAATCACCTGCAGTTCTGGG + Exonic
960243843 3:115377783-115377805 GTAGGTTCACATGCAATTGTAGG + Intergenic
960821722 3:121740346-121740368 GTAGAGTCACATGCAGTTGTAGG - Intronic
962853730 3:139326517-139326539 GTAGAGTCTCATGAAGGAGTAGG + Intronic
964421594 3:156509680-156509702 GGAGAGTCACATTCAGTACTGGG + Intronic
966267595 3:178064767-178064789 CTATACTGACATGCAGTTGTAGG + Intergenic
967712101 3:192721009-192721031 GTAGAGACAAATTCAGGTGTTGG + Intronic
972292796 4:37705441-37705463 GTACAGTCACATGAAGATGGAGG - Intergenic
972325537 4:38011937-38011959 GTGAAGTCACATGAATTTGTTGG - Intronic
974451106 4:62061300-62061322 GTAGATTCACATGCTGTTGTAGG + Intronic
977409048 4:96637965-96637987 GTAGAGTCAACTGCAGGAGTGGG + Intergenic
982746746 4:159111792-159111814 GTAGATTCACATACAATTGTAGG + Intronic
985951316 5:3223284-3223306 TTAGAGTCAGATGCAGGTGGGGG + Intergenic
987060902 5:14242977-14242999 GAACAGACACATGCAGTGGTTGG + Intronic
988723126 5:33898911-33898933 GTCCATTGACATGCAGTTGTTGG - Intergenic
989459811 5:41684309-41684331 ACAGAGTCAGATACAGTTGTAGG - Intergenic
991153564 5:63401117-63401139 ATAGATTCATATTCAGTTGTAGG + Intergenic
992920550 5:81512527-81512549 TTAGAGTCACATTCTGTCGTGGG - Intronic
993171913 5:84430476-84430498 GTAGAGACACGTGCAGTACTAGG - Intergenic
1005756742 6:28931800-28931822 GTAGATTCACATACAGTTATAGG - Intergenic
1012321302 6:97850105-97850127 GTAGGGTCACATCCAGATGCTGG + Intergenic
1013053745 6:106562964-106562986 GTATAGTGGCATGCACTTGTGGG - Intronic
1014494484 6:122103919-122103941 ATAGATTCACATGCAGTTGTAGG - Intergenic
1015906972 6:138127704-138127726 CAAGAGTCACATGGAGTTCTTGG - Intergenic
1016095967 6:140037566-140037588 GAACAGGCACATGCAGTTGTGGG - Intergenic
1016141345 6:140615121-140615143 GTAGATTCACATGCTATTGTAGG + Intergenic
1020607375 7:10356202-10356224 GTAGAGTAACAAGCAGCTCTTGG - Intergenic
1022332455 7:29392879-29392901 GTAGAGCCACATTAAGTTATGGG - Intronic
1024291490 7:47807618-47807640 GCAGCGTCCCATGCTGTTGTGGG + Intronic
1024636861 7:51298223-51298245 TTAGAGTCATATGCAGTGGCTGG - Intronic
1024735414 7:52299481-52299503 GTAGATTCACATGTATTTGTAGG + Intergenic
1026627239 7:72006092-72006114 GTAGACTCACATGCAGTTGTAGG - Intronic
1028313745 7:89373432-89373454 GTGGAGTGACCTGCAGTGGTTGG + Intergenic
1029604002 7:101587645-101587667 GTTCAATCACATGCAGTTCTCGG + Intergenic
1030521529 7:110603928-110603950 GGAGAGCCACATGCAGCTCTGGG + Intergenic
1033855502 7:145556502-145556524 GAAATGTCTCATGCAGTTGTGGG - Intergenic
1033936958 7:146597905-146597927 CTAGAGTCACATGCATCTTTTGG + Intronic
1037135233 8:15452071-15452093 CTAGAGTCACATGAAGGAGTTGG - Intronic
1041800409 8:61791873-61791895 GTTGATTCAAATGCACTTGTGGG + Intergenic
1042302061 8:67294717-67294739 GGAAAGTCACATACAGGTGTAGG + Intronic
1042894591 8:73652010-73652032 GTAGAGTCAAACGCAGAAGTGGG + Intronic
1043718952 8:83519834-83519856 TTAAAGTCACATGCAGTTTTAGG + Intergenic
1047312333 8:123703040-123703062 GAACATTCACATGCAATTGTTGG - Intronic
1050051162 9:1603032-1603054 GTAGACTGACATGCCCTTGTAGG + Intergenic
1050575127 9:6986943-6986965 GTAGACTCGTATGCAGTTGTGGG + Intronic
1051448943 9:17173798-17173820 GTAGATTCACATGCAGTTACAGG + Intronic
1057025093 9:91728850-91728872 GTGGAGTGGCATGCAGCTGTGGG - Intronic
1058035060 9:100242739-100242761 GTAGATTCATATGTAGTTGTAGG + Intronic
1060387459 9:123245136-123245158 GTGGATTCACATGCTGTTGTAGG - Intronic
1060773359 9:126348765-126348787 GTAGACTCACATGCAGTTGTAGG + Intronic
1061191201 9:129083722-129083744 ATTGAGTCTCATGCAGCTGTAGG + Intronic
1185601367 X:1341939-1341961 GCAGAGTCTCATGCAGTGGTCGG + Intronic
1185855626 X:3532215-3532237 GTAGAGTGGCATCCAGTTGGTGG - Intergenic
1185911709 X:3987114-3987136 GTACATTCACATTCAGTGGTAGG + Intergenic
1186330185 X:8524142-8524164 GTAGATTCACATGCAATTGTAGG - Intergenic
1187445017 X:19353438-19353460 GTAGAGTCACATGCTGTGCAGGG + Intronic
1188402292 X:29760428-29760450 GTAGAATTGCATGCAGTTCTAGG - Intronic
1192150824 X:68711410-68711432 GTAGAGACAGATGCTGTGGTGGG + Intronic
1192387559 X:70687695-70687717 GTAGAGTTATGTGCAGTGGTTGG + Intronic
1193196537 X:78639112-78639134 GGAGAGTCACATGGGTTTGTGGG - Intergenic
1193896798 X:87124534-87124556 GTAGTTTCACATACAGTTGTAGG - Intergenic
1194022261 X:88705863-88705885 ACAGACACACATGCAGTTGTAGG - Intergenic
1195740200 X:108057538-108057560 GTAGATTCACATGCAGTTCTAGG - Intronic
1198309760 X:135419389-135419411 GTAGATTTACATGCAATTTTAGG - Intergenic
1199701569 X:150381243-150381265 GTAGAGTCACATACAGTTTTAGG + Intronic