ID: 960821722

View in Genome Browser
Species Human (GRCh38)
Location 3:121740346-121740368
Sequence GTAGAGTCACATGCAGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 2, 1: 6, 2: 16, 3: 32, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960821722 Original CRISPR GTAGAGTCACATGCAGTTGT AGG (reversed) Intronic