ID: 960824655

View in Genome Browser
Species Human (GRCh38)
Location 3:121770265-121770287
Sequence CTAGTCTACCAGCATGCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960824650_960824655 6 Left 960824650 3:121770236-121770258 CCTCTGGAAAATAATAAGTTAGG 0: 1
1: 1
2: 2
3: 23
4: 205
Right 960824655 3:121770265-121770287 CTAGTCTACCAGCATGCCAGAGG 0: 2
1: 0
2: 0
3: 10
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960824655 Original CRISPR CTAGTCTACCAGCATGCCAG AGG Exonic
904609434 1:31716932-31716954 CTTGGCTACCAGCTTGCAAGTGG - Intergenic
913605979 1:120466351-120466373 CTATTCTCAGAGCATGCCAGTGG + Intergenic
914367722 1:146994705-146994727 CTATTCTCAGAGCATGCCAGTGG + Exonic
914485257 1:148103517-148103539 CTATTCTCAGAGCATGCCAGTGG - Exonic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915271054 1:154753791-154753813 CTGGTCTACCTGCTTCCCAGGGG - Intronic
922316472 1:224447179-224447201 CCACACTACCAGCATCCCAGGGG - Intronic
1066370041 10:34812938-34812960 CTAGCCACCCAGCATCCCAGAGG + Intronic
1066525095 10:36269282-36269304 TTAGTCTACCCACATGCCTGGGG + Intergenic
1066644437 10:37591369-37591391 CTGGTCTAAGAGCATGCCATAGG - Intergenic
1080371240 11:31646817-31646839 CTAATCTACCACCCTGTCAGGGG + Intronic
1081913221 11:46714127-46714149 GTACTCTACCAGAATGTCAGGGG + Intergenic
1083738141 11:64693503-64693525 CTTTTCTACCAGCATCCTAGGGG - Intronic
1084327911 11:68412311-68412333 CTAGTCTCCCAACTTGGCAGGGG - Intronic
1088300312 11:108351284-108351306 GAACTCTACCAGCATTCCAGAGG - Intronic
1090463480 11:126912103-126912125 CTAGGCTTCCAGACTGCCAGGGG - Intronic
1090542374 11:127722411-127722433 CTTATCTACCAGCATGCCGCAGG - Intergenic
1097484750 12:60182086-60182108 CTTGCCTACCAACATGCAAGTGG + Intergenic
1098808485 12:75052662-75052684 CTAGTCCTCAAGCATGCCATTGG + Intronic
1099997668 12:89796579-89796601 CTAGTCCTCCAGCATGCCTGGGG + Intergenic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1107723312 13:43272421-43272443 CCAGTCTACCTGCCTGTCAGTGG + Intronic
1109447946 13:62469948-62469970 CTATTCTACCAGGAGGCAAGAGG - Intergenic
1116732722 14:48644962-48644984 CTAGTCTACAAGGATCTCAGTGG - Intergenic
1120725472 14:87934846-87934868 CTTGTCATTCAGCATGCCAGAGG + Exonic
1125029249 15:35060010-35060032 CTACTATACCATCATGCCTGTGG - Intergenic
1125430087 15:39584891-39584913 CTAGCATCCCCGCATGCCAGTGG + Intronic
1132515670 16:364659-364681 CCAGGCTACCAGCTGGCCAGTGG - Intergenic
1134374810 16:13662040-13662062 CTAGTCAACCAGCACTCCACAGG + Intergenic
1137906751 16:52331262-52331284 CCAGGCTACCTCCATGCCAGGGG + Intergenic
1138166067 16:54802726-54802748 CAAGTCTAACAGAATACCAGGGG + Intergenic
1140034262 16:71360598-71360620 CTCATCTACCAGGAAGCCAGTGG - Intronic
1144319007 17:14095475-14095497 CTAGTCTACCAGCAACACAGAGG - Intronic
1148984134 17:51606812-51606834 CTGGTCTACCAGCACACCAATGG - Intergenic
1149538698 17:57452389-57452411 CTTGCCTGCAAGCATGCCAGTGG + Intronic
1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG + Intronic
1160973742 19:1782150-1782172 CAAGTCAACCAGCATGCAGGGGG - Exonic
926130843 2:10302578-10302600 CTTCTATACCAGCAGGCCAGAGG + Intergenic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
934919634 2:98332347-98332369 CAAGTCAACCTGCATTCCAGGGG + Intronic
935522425 2:104123924-104123946 CTGGACCACCAGCTTGCCAGAGG - Intergenic
936783428 2:116062705-116062727 CTAGTCTACCTGCATCCCACAGG + Intergenic
945959172 2:216114465-216114487 CTTCTCTAACAGCATACCAGGGG - Intronic
1170911488 20:20574923-20574945 CTACTCAAGCACCATGCCAGTGG - Intronic
1174409056 20:50321930-50321952 CAAGGCTACCAGCCAGCCAGTGG + Intergenic
949179564 3:1112365-1112387 CCAGGCTACCAGCATCCCAAGGG - Intronic
949636626 3:5989482-5989504 CAAGTCCACCAACATGCAAGGGG - Intergenic
960824655 3:121770265-121770287 CTAGTCTACCAGCATGCCAGAGG + Exonic
968481240 4:833956-833978 CTTGTCACCCAGCATGTCAGAGG - Intergenic
983972537 4:173892605-173892627 CTTATCTACCAGCATTCCACTGG - Intergenic
985877629 5:2612424-2612446 CTGGTCTCCTAGCAAGCCAGTGG + Intergenic
989491409 5:42060115-42060137 CCAGTAGACCAGCATACCAGAGG + Intergenic
991220189 5:64205285-64205307 CATGTCTTACAGCATGCCAGTGG - Intronic
997634799 5:135397350-135397372 CTAGTATACAACCATGCCACTGG - Intronic
1002326542 5:178413317-178413339 CTATTCTACAAGCATTCAAGGGG - Intronic
1005662433 6:28012402-28012424 CTAGTCTACCAGCATGCCAGAGG - Intergenic
1007367990 6:41408003-41408025 CTAGTCTACCAGCTCCCCAGGGG + Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1020709432 7:11588238-11588260 TCAGTATACCAGCATCCCAGGGG - Intronic
1026151259 7:67789887-67789909 CAATTCTTCCAGCATTCCAGCGG + Intergenic
1026844908 7:73693369-73693391 GTAGTCTACCACCATGCCACCGG - Exonic
1032505336 7:132430201-132430223 CTATTCTGGCATCATGCCAGAGG + Intronic
1032779449 7:135151983-135152005 CCAGGCTACCAGCCTGACAGTGG - Intronic
1033158752 7:138979106-138979128 CTAGTCTATGAGCCTGGCAGCGG + Intronic
1042956814 8:74259932-74259954 CTACTTCACCAGCATGCCAGTGG - Intronic
1043429016 8:80176536-80176558 CTAGTTTTCCAGAATGCCAATGG + Intronic
1044725258 8:95189674-95189696 CAAGTCCACCAGCATTCCTGTGG - Intergenic
1045884964 8:107084769-107084791 CTTGTTTACCAGAATGCCAATGG + Intergenic
1048640517 8:136353579-136353601 CTAGTGTACCAGCTCACCAGGGG + Intergenic
1050116141 9:2265447-2265469 CTCATCTAGCAGCCTGCCAGAGG - Intergenic
1051290625 9:15542063-15542085 CTAGTTTACTAGCATGCCACTGG + Intergenic
1052012204 9:23423714-23423736 AAAGTCATCCAGCATGCCAGAGG + Intergenic
1055852479 9:80649093-80649115 TTAGTCTCCTAGCAGGCCAGAGG + Intergenic
1056504753 9:87247624-87247646 CTAGTGTCCCAGAAGGCCAGGGG - Intergenic
1056869919 9:90267893-90267915 CTGGTCTACCAGCCTGCCTGGGG - Intergenic
1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG + Intergenic
1061223839 9:129268801-129268823 GTAGTCTAGCTGCATGTCAGAGG - Intergenic
1203782909 EBV:110822-110844 CAATACTACCATCATGCCAGTGG + Intergenic
1198071335 X:133151479-133151501 CAGGTCAACCAGCCTGCCAGTGG - Intergenic
1202090506 Y:21183561-21183583 CTGGGCTGCCAGCATGCCTGCGG + Intergenic