ID: 960825610

View in Genome Browser
Species Human (GRCh38)
Location 3:121780454-121780476
Sequence CCTCTGTGATTACCATAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960825610_960825614 -7 Left 960825610 3:121780454-121780476 CCTCTTTATGGTAATCACAGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 960825614 3:121780470-121780492 ACAGAGGGCCTGATATAGAAGGG 0: 1
1: 1
2: 1
3: 18
4: 164
960825610_960825613 -8 Left 960825610 3:121780454-121780476 CCTCTTTATGGTAATCACAGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 960825613 3:121780469-121780491 CACAGAGGGCCTGATATAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960825610 Original CRISPR CCTCTGTGATTACCATAAAG AGG (reversed) Intronic
904453857 1:30635182-30635204 CCTCCTTGATCACCATAATGGGG - Intergenic
906879664 1:49576411-49576433 CCTCTGTGATTCACATATGGTGG - Intronic
907293399 1:53433216-53433238 CCTCTGTCTCTACCAGAAAGGGG - Intergenic
908962622 1:69717548-69717570 CATCTTAGATTGCCATAAAGTGG + Intronic
910781733 1:90943978-90944000 CCTCTGTGATTATAATAAGTGGG - Intronic
914831653 1:151174895-151174917 GCTCTGTGAGTACCACACAGTGG - Exonic
916049642 1:161027077-161027099 ACTCTTTCATTACCTTAAAGTGG - Intronic
917801360 1:178573426-178573448 CCTCTGTGAGTAACATGAAAAGG - Intergenic
919524046 1:198625222-198625244 CCAGTGTGCTGACCATAAAGTGG + Intergenic
919676814 1:200392209-200392231 CCTCTTTCATAAACATAAAGTGG - Intergenic
922021017 1:221705018-221705040 CAACTTTTATTACCATAAAGGGG - Intronic
923095670 1:230773458-230773480 CCTCTGTGAGTCCCAGAAAATGG - Intronic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1064735125 10:18374371-18374393 CCCCTGTGATGAGTATAAAGGGG + Intronic
1065159554 10:22905326-22905348 CCTCTGTGAAAAAAATAAAGAGG - Intergenic
1065379007 10:25070032-25070054 CTTCTGTGATTATCAAAAAATGG + Intergenic
1071152508 10:82651914-82651936 CCTCTGTGAGTCCCGTGAAGAGG - Intronic
1071976134 10:90957172-90957194 GCTCAGTGATAACCATAAATGGG - Intergenic
1072566074 10:96617779-96617801 CCTCTGTGATGAGCACAGAGAGG + Intronic
1074279712 10:112039336-112039358 CTTCTGGGATTACTAGAAAGTGG + Intergenic
1075801408 10:125156329-125156351 CCACTGTCATTTCCATAGAGAGG - Intronic
1076439239 10:130469036-130469058 ACTGTGTCATTACCATACAGGGG + Intergenic
1077382614 11:2251364-2251386 ACTTTGTGTTTACCATAGAGAGG - Intergenic
1077389151 11:2291478-2291500 CCTCTGTGAATATACTAAAGCGG - Intergenic
1077389248 11:2291961-2291983 CCTCTGTGAATATACTAAAGCGG - Intergenic
1077389292 11:2292175-2292197 CCTCTGTGAATATACTAAAGCGG - Intergenic
1077389368 11:2292561-2292583 CCTCTGTGAATATACTAAAGCGG - Intergenic
1080134622 11:28840310-28840332 ACTCTGTAATTACCTTCAAGGGG + Intergenic
1080929389 11:36792437-36792459 GCTCTGTAATTACAAAAAAGTGG + Intergenic
1083546540 11:63553165-63553187 CCTCTGTGATTCAAATGAAGAGG - Intronic
1089659825 11:119978589-119978611 CCTCTGTGTTTGCCACAATGGGG + Intergenic
1093424288 12:19010784-19010806 CCTCTGCGCTTGCCATAAGGCGG + Intergenic
1094086546 12:26599144-26599166 CCTCTGTCATTACCATATCCTGG + Exonic
1096150529 12:49308008-49308030 CCTCTATTATTATGATAAAGGGG + Intergenic
1096185357 12:49576886-49576908 CCTCAGTGACTACCCTAAATTGG - Intronic
1097358778 12:58632769-58632791 CCTCTGGGATTGCCATTGAGTGG - Intronic
1098171909 12:67755533-67755555 CCTCTGTGAATCCCCTGAAGTGG + Intergenic
1102004738 12:109581924-109581946 GCACTGTCATTACCATACAGAGG - Intronic
1103278660 12:119735345-119735367 GGTCTGTGATTACCTAAAAGAGG + Exonic
1105013818 12:132773879-132773901 CCTCTGTGGTTTATATAAAGGGG - Intronic
1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG + Intergenic
1106441586 13:29778206-29778228 CCTCAGTGATAACCCTAAGGGGG + Intronic
1109556228 13:63979351-63979373 CCTCTTTCATTACCATTAAATGG - Intergenic
1109567438 13:64135673-64135695 ACTCTGAAATTACCATAAAAGGG + Intergenic
1110119186 13:71862616-71862638 CATCTGTCATTACCACAAGGAGG - Intronic
1113330830 13:109325816-109325838 CCTCTGGGATGACCAGACAGAGG + Intergenic
1116289107 14:43008737-43008759 CATCTGTGTTTACCAAAAGGAGG - Intergenic
1119243639 14:73084481-73084503 CCTCTGTGTTTTCTGTAAAGTGG + Intronic
1119612404 14:76074712-76074734 CCTCTGTGGGTAACATAATGAGG + Intronic
1121088734 14:91166796-91166818 CCTCTGTGATTTTTTTAAAGTGG - Intronic
1130734846 15:86537250-86537272 CCTCTGTCTTCACCATAATGTGG - Intronic
1132319426 15:100914681-100914703 CCTCTGTGATCACAGAAAAGAGG - Exonic
1138056716 16:53842262-53842284 CATCACTGATTACCATGAAGGGG - Intronic
1144493064 17:15731373-15731395 CCTCTGTGCTCACCTCAAAGGGG - Intergenic
1147252418 17:39160934-39160956 CCTATGGGATTGTCATAAAGAGG - Intronic
1148062199 17:44844580-44844602 CCTGTGTGTTTATCCTAAAGGGG - Intergenic
1153265918 18:3269363-3269385 CCTCTGTCATCACCCTAAACTGG - Intronic
1155131985 18:22945237-22945259 GCAATGTGATTAACATAAAGGGG - Intronic
1155787242 18:29915782-29915804 CTTTTGTGAGTCCCATAAAGAGG + Intergenic
1156593113 18:38514219-38514241 CCTTTGTTATTTCCAAAAAGTGG - Intergenic
1157480284 18:48049664-48049686 CCTCTCTGATTACCATAACAGGG - Intronic
1158912067 18:62074288-62074310 CCTCTCTCATTAACAAAAAGAGG - Intronic
1162645520 19:12047170-12047192 CCTTTGTGATGACTAGAAAGTGG + Intronic
929135348 2:38618532-38618554 TCTTTGTCATTATCATAAAGAGG + Intergenic
931178125 2:59873789-59873811 CCTTAGTGGTTACCTTAAAGTGG - Intergenic
931632907 2:64317249-64317271 ACTCTGTAAGTTCCATAAAGGGG - Intergenic
932386554 2:71339008-71339030 TCTTTGTGCTAACCATAAAGAGG + Intronic
937849360 2:126619210-126619232 CCTCTCTGATTAACAGAATGTGG - Intergenic
938395602 2:130945441-130945463 CCACTGCCATTACCATAATGAGG + Intronic
939977769 2:148738963-148738985 CCCCTGTGCTTACCATGTAGTGG + Intronic
940173218 2:150850770-150850792 CTTCAGTGATTACCAAAAATAGG - Intergenic
943852906 2:192750410-192750432 CCTCTGTGAGTTCCCTAAAAGGG - Intergenic
944041908 2:195365406-195365428 CTCCTTTGATTACCATAAAATGG + Intergenic
944299555 2:198107406-198107428 CCTGTGTGATTACCTGATAGTGG + Intronic
947129450 2:226905976-226905998 CCTCTGCTGTTACCACAAAGGGG - Intronic
1171033612 20:21698846-21698868 CCTCTGTGAACACCTTACAGTGG - Intergenic
1177167128 21:17614978-17615000 CCTCTTTCAGTCCCATAAAGAGG - Intergenic
1179246024 21:39634915-39634937 GCTCTGTGATCACCCTAGAGAGG + Intronic
1181641765 22:24204538-24204560 CCTCTTGCATTACCAGAAAGAGG - Intergenic
952835986 3:37602406-37602428 CCTCTATTATTACAATACAGTGG - Intronic
954325274 3:49860022-49860044 CCACTGTGATTACCTTAAGTAGG - Intronic
955806045 3:62736006-62736028 TCTCCCTGATTACCATAAGGGGG + Intronic
956062410 3:65360950-65360972 TCTCTCTGATTATCAGAAAGGGG + Intronic
956358705 3:68422284-68422306 ACTCTGTAAATGCCATAAAGTGG - Intronic
958001925 3:87761699-87761721 CCTCTGTCTTTGCCATAAGGTGG - Intergenic
959208333 3:103342362-103342384 CCTCTGTTATTGCCAGACAGAGG - Intergenic
960038548 3:113126270-113126292 CCTCTGTGATGACAAGAAAAAGG - Intergenic
960825610 3:121780454-121780476 CCTCTGTGATTACCATAAAGAGG - Intronic
963118224 3:141752143-141752165 CCTCAGTGTTTACTATAAAAAGG + Intergenic
963358498 3:144240097-144240119 CCTCTGTGACAATAATAAAGAGG - Intergenic
966445682 3:179998480-179998502 CCTCTGTGATTCACCTATAGAGG - Intronic
967767362 3:193295985-193296007 CCTCTGCTATTACCATGAAGGGG - Intronic
971075845 4:23148375-23148397 CATCTGTGATAGCCATAAATAGG - Intergenic
971872391 4:32259973-32259995 CCTCAGTGCTTAGCATACAGTGG + Intergenic
977357927 4:95969737-95969759 CCTTTGTGAATCCCATGAAGGGG + Intergenic
978540187 4:109808414-109808436 CCTCTGTATTTCCCATAAACTGG - Intergenic
983821748 4:172202644-172202666 GGTCTGTGATTACCATCTAGTGG + Intronic
986058143 5:4160090-4160112 ACTCTGTAATTCCCACAAAGTGG - Intergenic
986335479 5:6752100-6752122 CCACTGTGATGACCATAAAAAGG - Intronic
986494357 5:8327881-8327903 CCTCTGTTGTTAACATAAATAGG + Intergenic
987005730 5:13707391-13707413 CCTCTGTCCTTGCGATAAAGAGG + Intronic
987490789 5:18578349-18578371 GCCCTGTGATTCCCATAAAAGGG + Intergenic
988847936 5:35148345-35148367 CCTGTGTGATGCCAATAAAGGGG + Intronic
990283549 5:54277226-54277248 CCTTTGTGATTACAGTAAAAAGG - Intronic
990718685 5:58668532-58668554 ACTCTGTGATCTCCATATAGGGG - Intronic
992956001 5:81908699-81908721 TTTCTGTGATTAACATTAAGGGG + Intergenic
996492505 5:124114731-124114753 CCTCACTGATTACCATGAGGAGG + Intergenic
998159958 5:139807859-139807881 CCTCTGTGATTCTTATAACGAGG - Intronic
998210083 5:140189242-140189264 ACTCATTCATTACCATAAAGAGG - Intronic
998653065 5:144142920-144142942 CTTCTGTGATAACAAAAAAGAGG + Intergenic
1004993280 6:21163038-21163060 TCACTGTGATTACCATAGAAGGG - Intronic
1005797007 6:29374960-29374982 CCTCTGTGCTTCCCAAAAAGTGG + Exonic
1007441663 6:41866311-41866333 ACTCTGAGATTCCCCTAAAGAGG + Intronic
1009948105 6:70363884-70363906 CCTTTGTGAGTCCCATGAAGGGG - Intergenic
1011353264 6:86446493-86446515 CCTTTGTGAATCCCATGAAGGGG - Intergenic
1013531204 6:111020349-111020371 CCTCTGTGTTAAACATAGAGGGG + Intronic
1013667495 6:112363411-112363433 CATCTGTGATTTCCATCATGTGG + Intergenic
1014083737 6:117317421-117317443 TCTTTGTGCTTACCTTAAAGAGG + Intronic
1020465641 7:8475539-8475561 CCTCTGTGAATTGCATAAAGTGG + Intronic
1025288898 7:57694415-57694437 CCTCTGTAATTTTCACAAAGGGG + Intergenic
1027719223 7:81717623-81717645 CCACTGGGATTACCAAATAGAGG - Intronic
1028922103 7:96320900-96320922 ACTCTGTGATAACCCTCAAGAGG - Intronic
1035161883 7:156956845-156956867 GCCCTGTGATTACCATAATCAGG + Intronic
1036017763 8:4804971-4804993 CCTATGTGTTTACCAGGAAGTGG - Intronic
1038009371 8:23462527-23462549 CCAATGTGATTAGCATTAAGGGG + Intergenic
1038067970 8:23983351-23983373 CCTCTGTGATGACCAAATGGTGG - Intergenic
1038451650 8:27643253-27643275 CCTCTGTGGTTACCAAGAACAGG + Intronic
1041456890 8:58070553-58070575 CCTTGGTGAATACCATAAACAGG - Intronic
1042057364 8:64779801-64779823 TCTATGTGATTACCAAAAACAGG + Intronic
1043013386 8:74908229-74908251 CCTCAGTGCTAACCATAAAGAGG + Intergenic
1043377968 8:79671230-79671252 ACTCTCTCATTACCATGAAGAGG + Intergenic
1045116188 8:98983367-98983389 CCTCCTTGATTAACATGAAGTGG + Intergenic
1046679880 8:117156881-117156903 TCTCTGGGATTAGCTTAAAGTGG + Intronic
1046901623 8:119529713-119529735 CATCTGTGATATCCATAAAATGG + Intergenic
1048059499 8:130903418-130903440 CCTCTGTTATTAAACTAAAGGGG - Intronic
1048340631 8:133536165-133536187 ACTCTGTGATTAGCAGAAGGTGG + Intronic
1048733807 8:137474815-137474837 CCTTTGTGATAACGATAAAGTGG + Intergenic
1058912290 9:109532611-109532633 CATTTGTTATTACCAAAAAGAGG + Intergenic
1186390652 X:9155425-9155447 CCTCTGTTATTACCCTCACGAGG - Intronic
1188488764 X:30713440-30713462 CCTCTGTGGTTAGAACAAAGGGG + Intronic
1190306523 X:49086116-49086138 CCTCCTTTATTACCACAAAGGGG + Intronic
1191945494 X:66530542-66530564 CCTTTGGGTTCACCATAAAGTGG + Intergenic
1193503941 X:82316771-82316793 CTTCTCTGATTTCCATCAAGGGG - Intergenic
1196051617 X:111311898-111311920 CTTCTCTGATTACCATACTGTGG - Intronic
1196197598 X:112852292-112852314 CCTCTATGATAAATATAAAGAGG - Intergenic
1197994093 X:132353707-132353729 CCTCTGTCATTACCTTATATAGG + Intergenic
1201529662 Y:14977972-14977994 CCTCTCTGATTAACCTACAGGGG + Intergenic