ID: 960826183

View in Genome Browser
Species Human (GRCh38)
Location 3:121787116-121787138
Sequence CTGAAGAAGGAGTAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 501}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960826183 Original CRISPR CTGAAGAAGGAGTAGGAGAC AGG Intronic
900141591 1:1141278-1141300 GTGAAGAAGGGGTAGGGGATGGG - Intergenic
901776838 1:11565890-11565912 ATGAAGATGGAGGCGGAGACGGG + Intergenic
902908465 1:19577105-19577127 ATGAACAAGGAGTAGCAGAGTGG - Intergenic
903790439 1:25889436-25889458 CTGGAGAAGGAGTAGGTGTGGGG - Intronic
903926102 1:26831809-26831831 CTGAAGAATGAGTAGAGGGCTGG - Intronic
904273629 1:29366477-29366499 CTGAAGAATGAGGAGGGGTCAGG + Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907490789 1:54807583-54807605 CTGATGAAGGAGGTGGACACAGG + Exonic
908045812 1:60167318-60167340 CTGGAGAAGGAGTTGAAGACAGG - Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
909787645 1:79635823-79635845 GTGGAGAAAGAGGAGGAGACAGG + Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
911502332 1:98703483-98703505 CTGTAGACAGAGTAGGAGAAAGG + Intronic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
911709547 1:101054298-101054320 GTGAAGAAGGAAGACGAGACTGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915333819 1:155129279-155129301 CTGGAGGAGGAGGAGGGGACAGG + Intronic
915369646 1:155337785-155337807 TGGAATAAGGAGTAGGAGATTGG - Intronic
915608568 1:156971707-156971729 CTGAAGATCCAGCAGGAGACTGG - Exonic
916015943 1:160750128-160750150 CTGAAGAAGGTGTAGGACCTGGG - Intronic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917293207 1:173492745-173492767 ATGAAGAAGAAGTAGGCTACAGG + Intergenic
917367112 1:174244344-174244366 CTGAAGCAGGAGTAGCAGCATGG + Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918792351 1:188845436-188845458 CTCAAGAAGAATTCGGAGACAGG + Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
923908047 1:238407864-238407886 GTGAAGAAAGAGGAAGAGACAGG + Intergenic
924209901 1:241754004-241754026 CTGAAGAAGGGTTAGGAACCAGG + Intronic
1063231290 10:4067872-4067894 CTGATGAATGAGGAGGAGCCGGG - Intergenic
1063307841 10:4922191-4922213 CTAAAGAAGGAGCTGGTGACAGG - Intergenic
1063322262 10:5061270-5061292 CTGAAGAAGGAGCTGGTGACAGG + Intronic
1063326405 10:5107901-5107923 CTAGAGAAGGAGCAGGTGACAGG + Intronic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1064252252 10:13715604-13715626 CTGAAGAAATAATATGAGACTGG + Intronic
1067770116 10:49116562-49116584 CTGTAGGAGGAGGAGGAGACAGG + Intergenic
1068265815 10:54647875-54647897 GGGAAGAAGGAGTAAGAAACAGG - Intronic
1068621619 10:59189810-59189832 CAGAAGAAAAAGTAGGAGAGGGG + Intronic
1068652987 10:59543000-59543022 GTGAAGATGGAGGTGGAGACTGG - Intergenic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070128701 10:73641757-73641779 CTGAAGACTGAGAGGGAGACAGG + Exonic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1071090162 10:81909168-81909190 GTGAAGAAGGAGGTGGAGATTGG - Intronic
1071676407 10:87659790-87659812 CGGGAGGAGGAGTAGGAGAAGGG + Exonic
1073491336 10:103855319-103855341 CTGGAGAAGGAGCCGGAGCCCGG - Exonic
1073643409 10:105275683-105275705 GTGAAGATGGAGGTGGAGACTGG - Intergenic
1074306742 10:112286143-112286165 CAGGAGAAGGAGTAGTTGACAGG - Exonic
1075067469 10:119299041-119299063 CTGAAGATGAAAGAGGAGACAGG - Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075899910 10:126033156-126033178 CTGAATGAGGAGTAGGGAACTGG - Intronic
1076202476 10:128569483-128569505 CTGGGGAAGGAGGAGGAGAGAGG + Intergenic
1077872018 11:6270523-6270545 CTGAAGTAGGAGTAGGATTTGGG - Intronic
1077992247 11:7422426-7422448 CTTGAGAAGGAGCTGGAGACTGG + Intronic
1078385830 11:10891713-10891735 TTGAAGAAGGAGAAGAAGATGGG + Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1079157822 11:17964939-17964961 CTGTACAAGGAGCAGGAAACAGG + Intronic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1080039719 11:27746871-27746893 ATGAAGAAAGAGAAGCAGACAGG + Intergenic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080859627 11:36142072-36142094 GTGAAGAAGGGGGAGGCGACTGG - Intronic
1080929084 11:36788535-36788557 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1081560089 11:44205704-44205726 CTGAAGAAGAAGTATGATAGAGG - Intronic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1085651023 11:78268806-78268828 CTGAAGGAGGAAAAGGAGACAGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086558532 11:88140619-88140641 CTGAAGGAAGAGTGAGAGACAGG + Intronic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1088672182 11:112153023-112153045 GTAGAGTAGGAGTAGGAGACTGG - Intronic
1088792251 11:113236117-113236139 CTGTAGAAGGAAGATGAGACAGG - Intronic
1088922762 11:114273286-114273308 CTGAACAAGAGGTTGGAGACTGG + Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089522124 11:119071932-119071954 CCGGAGTAGGAGTAGGAGATTGG - Intronic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090256938 11:125291120-125291142 CTGCAGAAAGAATAGGGGACAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090602462 11:128387298-128387320 CTGGAGAAGCAGTGGGTGACAGG - Intergenic
1090947359 11:131443086-131443108 CTGAAGACGGAGATGGAAACAGG - Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1092143541 12:6200129-6200151 TTGAAGAAGGAGTGGGTGGCGGG + Intronic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1095111970 12:38305574-38305596 CTGATGAAGGAGTAGGTTCCTGG - Intergenic
1095594120 12:43939579-43939601 CTGAAGTGGCAGTAGGAGAAGGG - Intronic
1095785378 12:46103076-46103098 CTGAAAAAGGAGGACGAGAGAGG - Intergenic
1097861259 12:64521034-64521056 CTGTAGAAGGATGTGGAGACTGG + Intergenic
1097915212 12:65013984-65014006 CCAAAGAAGGAGAAGGAGAAGGG - Intergenic
1097957000 12:65496478-65496500 AAGAAGAAGGAGTAACAGACAGG + Intergenic
1098065714 12:66614092-66614114 CTGAAAAAGGAAGAGGAGAAAGG - Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1099536307 12:83849291-83849313 ATGAAGAAGGAGTAAGAGTTTGG - Intergenic
1100133440 12:91524189-91524211 CAGAAGAAAAAGTGGGAGACAGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100809155 12:98320593-98320615 CAAATGAAGGAGTAGGAGAAAGG + Intergenic
1101969699 12:109304528-109304550 CTGATGAAGGGGCAGGGGACTGG - Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102413788 12:112743022-112743044 CAGAAGAGGAAGTAGGACACGGG - Intronic
1102512011 12:113422288-113422310 GTGAAGACGGAGGAGGAGAGGGG - Exonic
1102622001 12:114203504-114203526 CTGAGGAAGGAGGAGGACATGGG - Intergenic
1102707153 12:114891982-114892004 GTGAAGAAGGGCCAGGAGACAGG + Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1104065843 12:125305158-125305180 CTGAAGAAGTTGTAGGAGACGGG - Intronic
1104335862 12:127894378-127894400 CTGGCTTAGGAGTAGGAGACTGG - Intergenic
1104356989 12:128095547-128095569 CTAAAGATGGAAGAGGAGACTGG - Intergenic
1105347753 13:19589502-19589524 TTGAAGCAGGAGTAGGAGTTAGG - Intergenic
1105538832 13:21297195-21297217 CTGAAGATGGAGGCGGGGACTGG - Intergenic
1105799420 13:23890369-23890391 CTGAAGATGGAGGCGGGGACTGG + Intergenic
1105849628 13:24322669-24322691 CTGAAGATGGAGGCGGGGACTGG - Intergenic
1106076266 13:26464005-26464027 TTCAAGAAGGAGGAGGAAACAGG - Intergenic
1106433671 13:29705647-29705669 CTGAAGAAGGAAGCAGAGACTGG + Intergenic
1106607762 13:31247030-31247052 CTGATGAAGGAGGAGGACACTGG - Exonic
1106679972 13:31999475-31999497 CTGGAGAGGGAGAGGGAGACGGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107426172 13:40295162-40295184 CTGAAGAATGGGGAGGAAACTGG + Intergenic
1108292176 13:48972948-48972970 CTGAAGGATGAGTAAGAGATAGG + Intergenic
1108357810 13:49643123-49643145 CAGAAGAAAGAGTACCAGACTGG + Intergenic
1108623078 13:52202892-52202914 TTGAAGTAGGAGTAGGAGTTAGG - Intergenic
1108663647 13:52608150-52608172 TTGAAGTAGGAGTAGGAGTTAGG + Intergenic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1111159974 13:84382356-84382378 CTGAAGTAGTGGCAGGAGACAGG - Intergenic
1112048443 13:95621154-95621176 CTAAAGAATGAGTAAAAGACAGG + Intronic
1112745318 13:102521002-102521024 TTGAAGACTGAGTAGGAGAAAGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116072507 14:40066783-40066805 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118019678 14:61697172-61697194 TTGAAGAAGGACCAGGAGAAGGG - Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1119647880 14:76361544-76361566 CTGAAAAATGTGTAGGAGAAGGG + Intronic
1119651283 14:76385451-76385473 TTTAAGAAGGATTAGGAGAAAGG + Intronic
1120067897 14:80066126-80066148 CTAAAAAAGGATTAGGAGAGTGG + Intergenic
1120198021 14:81507508-81507530 CTAAAGGAGGAGTAGGTTACTGG + Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120502642 14:85316010-85316032 CTGATGAAGTAAAAGGAGACAGG - Intergenic
1120855791 14:89211506-89211528 CTGAAGAAAGAACAGGAAACAGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121789538 14:96688715-96688737 CTGAAGGAGGAGGTAGAGACAGG - Intergenic
1121920777 14:97879003-97879025 ATCAAGAAGGAGAGGGAGACAGG + Intergenic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1123216172 14:106811055-106811077 CTGAAGAAAGAGCAGGACCCAGG + Intergenic
1124013498 15:25858435-25858457 ACGGAGAAGGAGTAGGAGAGGGG + Intronic
1124154638 15:27215203-27215225 CTGAAGGAGGAAGAGGAGTCAGG + Intronic
1124188927 15:27554543-27554565 ATGAAGAAGGCTTAGGAGAAAGG + Intergenic
1125315717 15:38429076-38429098 CTGAAGTAGGATTAGGAAAGTGG - Intergenic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126896358 15:53261230-53261252 CTGGAGTAGGAGAAGCAGACTGG + Intergenic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1127992444 15:64130682-64130704 ATGCAGAAGGATTAGGAGACAGG - Intronic
1129053174 15:72799184-72799206 CTGGAGAATGAGAAGGGGACAGG - Intergenic
1129708306 15:77807119-77807141 TTGAAGAAGGGGTAGGAGATGGG - Intronic
1129816692 15:78561669-78561691 CTGAAGGAGGAGTAGGAGTTAGG + Intergenic
1130543502 15:84838957-84838979 CTGAGAAAGAAGCAGGAGACTGG - Intronic
1130773016 15:86944055-86944077 CTGAAGGAAGAGTAAGAGTCAGG + Intronic
1131673276 15:94645092-94645114 ATGAAGAAGAAGGAAGAGACTGG + Intergenic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1133791792 16:9014711-9014733 CTGAAGAAAGAAGAGGAGAATGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1136230177 16:28881083-28881105 GTGATGGAGGAGGAGGAGACTGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136618722 16:31413824-31413846 CTGGAGAATGAGCAGGAGCCAGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1138153944 16:54685793-54685815 AGGAAGAAGGAGGAGGAGAAAGG - Intergenic
1138191006 16:55014186-55014208 CAGAGGAAGGAGTAGAAGATTGG + Intergenic
1138574992 16:57901830-57901852 CTGAAGAATGAGTAGGAGTTTGG - Intronic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139478658 16:67216142-67216164 CTGAAGAAGGAGCAGTGGAAAGG - Intronic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1140006260 16:71078864-71078886 CTGAAGAAGGAAAAGGATAGTGG - Intronic
1140692103 16:77494415-77494437 GTGATGAAGGAGGCGGAGACTGG - Intergenic
1141334588 16:83142579-83142601 CTGGAGAAGGACTAGGCGAACGG - Intronic
1141725690 16:85786993-85787015 CTGCAGAAGGGAGAGGAGACTGG - Intronic
1141855428 16:86677900-86677922 CTGCTGAAGGAGGAGGAAACTGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1141981256 16:87551748-87551770 GTGAAGATGGAGGAGGAGACTGG + Intergenic
1142529640 17:571211-571233 CTGAAGTAGGAGGAGGGGAAGGG + Intronic
1142917947 17:3158453-3158475 GTGAAAAAGAGGTAGGAGACGGG + Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1144235668 17:13258079-13258101 GGGAAGAAGGAGAAGGAGAAGGG - Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1146090839 17:29875796-29875818 TTGAAGAATAAGTAGGAGCCAGG - Intronic
1146112197 17:30100130-30100152 ATGAAGAAGTGGTAGCAGACAGG - Intronic
1147864475 17:43543645-43543667 CAGAAGAAGGATGGGGAGACGGG + Intronic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148260940 17:46183130-46183152 CTAAAGAATGAGTAGGAGCTGGG + Intronic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1151171519 17:72250326-72250348 CAGAAGATGGAGTCTGAGACTGG - Intergenic
1151947184 17:77326089-77326111 TGGAAGAAGGGGTAGGAGGCGGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1153118368 18:1688872-1688894 CAGAAAAAGAAATAGGAGACAGG - Intergenic
1154072227 18:11163014-11163036 TTGAAGAATGAGAAGAAGACAGG - Intergenic
1155356821 18:24961183-24961205 CAGAAGAAGGAGCAAGACACAGG + Intergenic
1156103701 18:33630494-33630516 ATAAAGAAGGAGGAGGAGAGAGG + Intronic
1156469205 18:37367000-37367022 CTTGAAAAGGAGTGGGAGACTGG + Intronic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1157620877 18:49016928-49016950 CTGAGGAGGAACTAGGAGACAGG - Intergenic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1158140028 18:54245723-54245745 CTGGAGAAGGGGTTGGAGGCAGG - Intergenic
1158536949 18:58316748-58316770 CTGAAGCTGGAATAGGAGATGGG - Intronic
1158602169 18:58864237-58864259 TTGGAGGAGGAGGAGGAGACTGG + Intronic
1159075250 18:63674028-63674050 ATGGAGAAGGAGTTGAAGACCGG - Intronic
1159392440 18:67810364-67810386 ATAAGGAAGGATTAGGAGACAGG - Intergenic
1159540305 18:69766247-69766269 CTGAAGAAGGAGGAGGGCAAGGG + Intronic
1160051009 18:75433357-75433379 CTGGGGAAGGAGGAGGACACGGG + Intergenic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160232292 18:77057558-77057580 GTGAAGAAGGACAAGGAGAGAGG + Intronic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1162252914 19:9461352-9461374 CTCAAGAAGGAGTTGGTTACCGG + Intergenic
1162264076 19:9555916-9555938 CCGAAGCAGGAGCAGGAGAGAGG + Intergenic
1162560954 19:11418192-11418214 CGGGAGAGGGAGTAGGGGACAGG - Intronic
1163758392 19:19120288-19120310 CTGGAGATGGAGTCTGAGACAGG - Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1165740981 19:38205166-38205188 CGGAAGGATGAGGAGGAGACTGG + Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165931461 19:39361945-39361967 CTAAAGAAGGGCTTGGAGACAGG - Intronic
1166211459 19:41309235-41309257 CTGAAGAACGAGTAGGAGCTGGG - Intronic
1166549776 19:43657539-43657561 CTGAAGAATGAGTAGGAGTTAGG - Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167887761 19:52516147-52516169 CTGAAGGAGGAGAAAGGGACAGG - Intergenic
1167910878 19:52700778-52700800 CTGAAGGAGGAGAAAGTGACAGG + Intergenic
1167937661 19:52921090-52921112 CTGAAGGAGGAGAAAGGGACAGG + Intergenic
1168148071 19:54430527-54430549 CTGAAGTGGGAGGAGGAGAGGGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925282657 2:2695616-2695638 CTCAAGAAGGAATAAGAGGCAGG + Intergenic
927134811 2:20089025-20089047 AGGAAGAGGGAGTTGGAGACAGG - Intergenic
927558718 2:24053860-24053882 CAGATGAAGGAGTAGGATATTGG - Intronic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
927882221 2:26696866-26696888 AAGTAGAAGGAGTAGGGGACTGG - Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
929033912 2:37672647-37672669 CTGGGGAAGGAGTAGGCGACAGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929611277 2:43272568-43272590 CTTAAGTAGGAGTAAGAGAAGGG + Intronic
929675487 2:43923035-43923057 CGCAAGAAGGAATTGGAGACAGG + Intronic
929688835 2:44057934-44057956 CTGAAGAATGAATAGGAGTTAGG + Intergenic
930017167 2:46978897-46978919 CTGAAGAAGGGGTAGGTCACTGG + Exonic
930781452 2:55228031-55228053 CTGAAGAAAGAGTAAAAGCCAGG - Exonic
930941046 2:57014520-57014542 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
930949362 2:57119237-57119259 CTGATGAAGGAATTGGAGATGGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932690298 2:73907434-73907456 CTGAAGAAGGAACTGGACACAGG + Intronic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932811699 2:74831617-74831639 AGGAAGAATGAGTTGGAGACAGG + Intergenic
933250923 2:80027603-80027625 GTGAAGAAGTAGGAGCAGACTGG + Intronic
933841603 2:86291225-86291247 ATGAATGAGGAGTAGGAGAGTGG + Intronic
933847323 2:86336842-86336864 CTGCAAAAGGAGTCGGAGCCGGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935269233 2:101419420-101419442 CTGTGGAAGGAAAAGGAGACTGG + Intronic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
936377826 2:111957412-111957434 CTGAGGAAAGAGTAGGAGTGAGG - Intronic
936732407 2:115400025-115400047 CTGGAGCAGGAGCAAGAGACGGG + Intronic
936919516 2:117673425-117673447 TTGAAGAAGGAGCAGGCAACAGG + Intergenic
936920749 2:117686165-117686187 GTACAGAAGGAGCAGGAGACTGG - Intergenic
937879607 2:126855697-126855719 CTGAAGGAGGAGGAGGACAAGGG - Intergenic
938483754 2:131682569-131682591 GTGATGGTGGAGTAGGAGACAGG + Intergenic
939170935 2:138694470-138694492 CTGAAGATGGAGTCAGAGATTGG + Intronic
939684199 2:145177573-145177595 ATGAAGGTGGGGTAGGAGACAGG + Intergenic
940006869 2:149016324-149016346 CTGAAGAAGGGGTAGGAATGGGG + Intronic
940076851 2:149751413-149751435 CTGAACAAGGAGTTGGAGTGGGG - Intergenic
940269299 2:151874001-151874023 CTGGAGCAGGAGGAAGAGACGGG - Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942985402 2:182134740-182134762 ATGATGAAGGAGGAGGAGAAAGG + Intergenic
943550081 2:189327502-189327524 CTGAAGAAGAATTAGAAGAGGGG + Intergenic
945196895 2:207245333-207245355 CTGAAGAGGGAGTGGGAGTTAGG - Intergenic
946076911 2:217081821-217081843 ATCAAGAAGGAGCAAGAGACGGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947502415 2:230681022-230681044 CTGAAGAACGAGCAGAAGCCAGG + Intergenic
948502398 2:238405126-238405148 CTGGGAAGGGAGTAGGAGACAGG + Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1170466575 20:16627842-16627864 CTGGAGAAGGAGCAAGAGAGAGG + Intergenic
1170981116 20:21213799-21213821 CTGAGCAAGGAGGAGGACACAGG - Intronic
1172254765 20:33507939-33507961 GTGAAGAATGGGTAGGAGATGGG + Intronic
1172555226 20:35834978-35835000 CTCAAGAAGAGGTAGGAGGCCGG + Intronic
1173358304 20:42316242-42316264 ATGTAGAAGGAGGAGCAGACAGG - Intronic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1175030339 20:55947280-55947302 CTCAAGAAGGAGGAGGGGACGGG + Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175829191 20:61952778-61952800 GTGAAGATGGAGGTGGAGACGGG - Intergenic
1176176497 20:63728831-63728853 CTGACTCAGGAGTAGGAGCCAGG + Intronic
1176378405 21:6098764-6098786 CTGAAGATGGTGGCGGAGACTGG + Intergenic
1176759742 21:10769949-10769971 CTCAGGAAGGACTAGGAGTCAGG + Intergenic
1177240034 21:18444124-18444146 CTGAAGTAGGACTACGAGGCTGG - Intronic
1177412555 21:20749245-20749267 CTGAGGGAAGGGTAGGAGACAGG - Intergenic
1177470301 21:21552658-21552680 CTGGAGAAGGAGGAAGAGAGTGG - Intergenic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1179745068 21:43439468-43439490 CTGAAGATGGTGGCGGAGACTGG - Intergenic
1180840782 22:18957920-18957942 CTGAAGACAGTGCAGGAGACCGG - Intergenic
1181060704 22:20280854-20280876 CTGAAGACAGCGCAGGAGACCGG + Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182493653 22:30691427-30691449 GTGAAGAAGGAGTCAGAGAAGGG - Intergenic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183524676 22:38316373-38316395 CTGGAGAAGGATTTGGAGAGAGG - Intronic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
951056669 3:18154721-18154743 CAGAAGAAGCAGTAGAATACAGG - Intronic
953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG + Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
955021679 3:55127758-55127780 CGGAAGGAAGAGTAGGAGAGAGG + Intergenic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
956376844 3:68622243-68622265 CTGAAGAAGGAGTATGTGAATGG - Intergenic
956710060 3:72031059-72031081 AAGTAGAAGGAGTAAGAGACAGG + Intergenic
959744359 3:109759408-109759430 GAGAAGGAGGAGGAGGAGACGGG - Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962134342 3:132718510-132718532 CTGAAGAAAGAAGAGGAGAATGG - Intronic
963224907 3:142852575-142852597 CTGAGGAAGGAGGAGGAAATGGG - Intronic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963591149 3:147261310-147261332 ATGAAAGAGGAGGAGGAGACTGG - Intergenic
964767314 3:160191387-160191409 CTAAGGAAGGAAGAGGAGACTGG + Intergenic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966915414 3:184581815-184581837 TTGAAGATGGATTAGGAGAGGGG + Exonic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967570893 3:191027160-191027182 CTGAAGTGGCAGTAGCAGACAGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968751239 4:2390156-2390178 GTGAAGATGGAGGTGGAGACTGG + Intronic
968912001 4:3481113-3481135 GTGGAGGAGGAGGAGGAGACAGG + Intronic
969689038 4:8694278-8694300 CTGAAGGAGAAGTAGGACCCGGG + Intergenic
969696829 4:8739839-8739861 CTGCAGAAGGAAGAGGAGCCTGG + Intergenic
970275202 4:14392171-14392193 CTGAAGAAGGAGCAGGGGCCAGG - Intergenic
970734440 4:19149640-19149662 CTGAAGAATCAATAGGAGTCAGG - Intergenic
971226825 4:24761825-24761847 CTGAAGAAGGAGAAAGATAAAGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971317893 4:25582608-25582630 ATGAAGAAGGAAAAGAAGACGGG - Intergenic
971364879 4:25969654-25969676 CATATGAAGGAATAGGAGACAGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
973849600 4:54948053-54948075 AGGAAGAAGCAGTAGGAGATAGG + Intergenic
974421819 4:61685528-61685550 CTGAAGAATGAGAACGAGATAGG + Intronic
975077855 4:70235297-70235319 CTGAAGAAGGAAGAGGTGGCAGG + Intergenic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
975577270 4:75875770-75875792 CGGAAGAAGGAAGAGGAGAATGG - Intronic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
978387772 4:108192765-108192787 CTGCAGAAGGAGGTGGAGAGGGG + Intergenic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
979198121 4:117944061-117944083 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
979640685 4:123010240-123010262 ATGAAGAATGAGTAGGAGTTAGG - Intronic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
982865910 4:160511664-160511686 CTGAACAAGGAATATGTGACAGG - Intergenic
983653101 4:170053114-170053136 CTGTAGGATGAGTAGGAGTCAGG + Intergenic
983973662 4:173904863-173904885 CTGTAGAATAAGTAGGAGAGGGG - Intergenic
985386560 4:189453721-189453743 CTGAAGAAGGAGAAGGGAATTGG + Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986245019 5:5999208-5999230 CAGAAGAAAGAGTAGGCAACAGG + Intergenic
986310006 5:6544690-6544712 ATGAAGATGGAGGTGGAGACCGG + Intergenic
986392674 5:7300654-7300676 CGGAAGCAGGAGGAGCAGACGGG - Intergenic
986539306 5:8827357-8827379 CTGAAGAAAGAGTATTAGAATGG + Intergenic
986788147 5:11134124-11134146 CTGAGGAGGGAGCAGGAGAAAGG + Intronic
987202267 5:15589406-15589428 CTGGAGAAGGAGGAAGAGAGAGG - Intronic
987472491 5:18350551-18350573 CTGACGAAGGATTAGGAGGCAGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
990716354 5:58641569-58641591 CTGAGTAAGGAGTAGAAGAGAGG - Intronic
990774935 5:59295761-59295783 CTGAGGTAGGAGGAGGAGAATGG - Intronic
991018920 5:61959798-61959820 CTGAAGTAAGAGTAGGAGGCAGG - Intergenic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
996617778 5:125461683-125461705 CTGATGGGGGAGTAGGAGAAGGG + Intergenic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
999495126 5:152089318-152089340 CTGATGAAGAATTAGGAGGCTGG - Intergenic
1000744992 5:165021380-165021402 CTAAAGAAGAGGAAGGAGACTGG + Intergenic
1001573308 5:172744890-172744912 CTGAAGGATGAGTAGGAGTTTGG - Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1001877307 5:175212776-175212798 CGTAAGAAGGAGTTGGAGGCCGG + Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002579758 5:180200768-180200790 CTCCAGCATGAGTAGGAGACAGG + Intronic
1002671842 5:180873749-180873771 ATGAGGGCGGAGTAGGAGACGGG + Intergenic
1002689727 5:181042342-181042364 CTGGGGAAGGAGTAAGGGACTGG - Intronic
1002854305 6:1023702-1023724 CTGCAGAAGGAAAAGGAGTCTGG - Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1003955509 6:11161831-11161853 CTGAAGGAGGAGTGTGAAACAGG + Intergenic
1004069921 6:12288612-12288634 CTGAAGCAAGAGTTGGAGATGGG - Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1005015403 6:21370728-21370750 CTGAAAAGGCAGTGGGAGACTGG - Intergenic
1005930924 6:30483229-30483251 GTGAAGAAGGAGGCAGAGACTGG - Intergenic
1006027400 6:31156192-31156214 ATGAAGAAGGAATACTAGACTGG - Intronic
1006130396 6:31865661-31865683 CTGGAGTCGGAGTAGGAGTCAGG - Intronic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006603292 6:35239729-35239751 CTGAAGAAGGAGGACAAAACAGG - Intronic
1006697369 6:35942326-35942348 CTGAAGGATGAGTAGGAGATAGG - Intergenic
1006823042 6:36913781-36913803 CTGAGGAGGGAGTAGAGGACAGG - Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1008547298 6:52594478-52594500 CTGAACAAGGGGTAGGGAACAGG + Intergenic
1009559681 6:65222924-65222946 ATGAAGAAGAAGTAAGAGTCAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010289216 6:74115964-74115986 CTGAAGAAGGAAAAAGAGATTGG - Intergenic
1011003718 6:82620585-82620607 GGGAGGAAGGAGCAGGAGACAGG + Intergenic
1012967921 6:105695621-105695643 CTGAAGGAGGTGTGGGAGTCAGG + Intergenic
1012985113 6:105867365-105867387 CTGAAGGAGGAATAGGAGTCTGG + Intergenic
1013298836 6:108783812-108783834 CTGAAGGACCTGTAGGAGACAGG + Intergenic
1014246859 6:119078663-119078685 CTGCGGAGGGAGGAGGAGACGGG + Exonic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1016454604 6:144217357-144217379 CGGAAGAAGCCGAAGGAGACAGG - Intergenic
1016799420 6:148153610-148153632 CTAAAGAAGGAGGAGGGGAATGG + Intergenic
1017437443 6:154429713-154429735 GAGAAGGAGGAGGAGGAGACGGG - Intronic
1018096804 6:160394730-160394752 CTGAAGAAGAAGGAGAGGACAGG + Intronic
1018287454 6:162256134-162256156 ATGAAGAAGGTGTAGGAGTTTGG + Intronic
1018327728 6:162691841-162691863 CTGAAGCAGCAGTAGCAGCCTGG + Intronic
1018674367 6:166206221-166206243 GTGAAGACGGAGGTGGAGACCGG - Intergenic
1018755145 6:166842354-166842376 GTGAAGATGGAGGTGGAGACTGG + Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1019882080 7:3870467-3870489 TTGAAGGAGCAGTGGGAGACAGG - Intronic
1020401673 7:7785564-7785586 GTTAAGAAAGAGTAGGAGAATGG + Intronic
1020795297 7:12671573-12671595 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1021785308 7:24145603-24145625 CTGCACGAGGAGTAAGAGACTGG - Intergenic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1024031195 7:45461177-45461199 CTGAGGTAGGAGCGGGAGACAGG - Intergenic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1024195577 7:47055395-47055417 AAGATGAAGGAGTAGGAGAAGGG - Intergenic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026465234 7:70647975-70647997 CTGATGTAGTGGTAGGAGACTGG + Intronic
1027244631 7:76358829-76358851 CCGGAGAAGGAGGAGGACACTGG + Exonic
1027616185 7:80427472-80427494 CGTAACAAGGAGTAAGAGACCGG + Intronic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1028923891 7:96336756-96336778 ATGAAGATGAAGTAGTAGACAGG - Intergenic
1028979705 7:96953956-96953978 TGGGAGAAGGAGTAGGAGAGAGG + Intergenic
1029422096 7:100477178-100477200 ATGGAGAAGGAGGAGGAGAGGGG + Intronic
1029426148 7:100495111-100495133 CTGTTGAAGGAGTAAGAGAGGGG + Intergenic
1029651129 7:101892897-101892919 CTGAAGAAGGAAAAAGAGAAAGG - Intronic
1030262398 7:107579880-107579902 ATGAAGAGAGAGTAGGTGACCGG + Intergenic
1030319672 7:108152189-108152211 CTGCAGAAGGTGTTGGAGAAGGG + Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1032691750 7:134294394-134294416 CTGAAGAAGGAAAAGGTGATGGG + Exonic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1034244608 7:149634940-149634962 CTGAAGAAGGAGGAGGAATTAGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034562386 7:151889465-151889487 CTGCAGAAGAAGTAGGGGCCAGG + Intergenic
1034885664 7:154796581-154796603 CTTAGGAAGGATAAGGAGACAGG - Intronic
1034967582 7:155400729-155400751 CTGCAGAGGGAGTGGGGGACAGG - Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035643383 8:1200338-1200360 CTGAAGATGAATTAGGAGCCGGG - Intergenic
1035705244 8:1670030-1670052 CTGGAGACGGAGACGGAGACGGG - Intronic
1035774025 8:2173624-2173646 CTAAAGATGGAGGAGGAGAGGGG + Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036560049 8:9894098-9894120 CTGAGGTAGGAGTAGAAGGCTGG + Intergenic
1040607714 8:48951035-48951057 GTTAAGTAGGAGCAGGAGACTGG - Intergenic
1040805858 8:51395685-51395707 CTGAAAAAGCAGTAGAAGACTGG + Intronic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1044394620 8:91696187-91696209 TGGAAGAAGAAGTAGGAGAAGGG - Intergenic
1045305596 8:100953374-100953396 CGGAAGAAGGGGAAGGAGAAAGG + Intronic
1045476214 8:102555132-102555154 CAGAAGAGGGAGGAAGAGACAGG - Intronic
1045629695 8:104104013-104104035 CTGAAGATGGAGGAGGAGATGGG + Intronic
1045830741 8:106457622-106457644 CTGATGAAGGCATAGAAGACAGG + Intronic
1046814232 8:118566327-118566349 ATAAAGATGGAGTAGAAGACAGG - Intronic
1047713097 8:127571189-127571211 ATGAAGAAAGAGGAGGAGATGGG - Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048650098 8:136466470-136466492 CTGCCTAAGGAGTAGGAAACAGG - Intergenic
1049802637 8:144525277-144525299 GTGGAGAAGGAGAAGGTGACAGG - Intronic
1050353456 9:4761756-4761778 CTAAAGATGGAGAAGCAGACTGG - Intergenic
1051058303 9:13014605-13014627 GTGAAGAAGGAGGTGGAGATTGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051276607 9:15404960-15404982 CTGAACCAGGAGCAGGACACAGG - Intergenic
1052426728 9:28314453-28314475 TTGAAGAAGGAACAGGAGACAGG - Intronic
1052789455 9:32861236-32861258 CTGAAGAAAAAGTAGAAGACTGG - Intergenic
1054825806 9:69572412-69572434 CTGGGGAAGGAGTAGGAGTGAGG - Intronic
1057494484 9:95550106-95550128 CTGGGGATGGAGTAGGAGATGGG + Intergenic
1058872320 9:109213280-109213302 ATACAGAAGGAGAAGGAGACAGG - Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059248275 9:112866666-112866688 CTGAGGAGGGAGGAGGAGAGAGG - Intronic
1059421743 9:114196533-114196555 CAGAAGCAGGAGTAGGACCCAGG - Intronic
1059700357 9:116769945-116769967 CTGAAGAAGGAGTTTGAGTTTGG + Intronic
1060586650 9:124790730-124790752 CGGCAGAGGCAGTAGGAGACAGG + Intronic
1061117900 9:128626233-128626255 TTGAAGGGGGAGCAGGAGACAGG + Intronic
1061551075 9:131335025-131335047 CTGGAGAAGGAGTAGGGGTGGGG - Intergenic
1061858519 9:133456046-133456068 CTGAAAAGGGAGCAGGAGACAGG - Intronic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1187992930 X:24895569-24895591 CTAAAGAAGGAAGAGTAGACTGG + Intronic
1188113373 X:26217044-26217066 CAGGAGAATGAGTAGGAGAACGG - Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1190473135 X:50802488-50802510 ATGAAGAAGAGGTAGGAGTCAGG - Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1193332110 X:80246314-80246336 GTGGAGAAGGAGTGGGAGATTGG - Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195693982 X:107653196-107653218 CTAAAGCAGGGGTAGGAGGCTGG + Intergenic
1196349544 X:114710021-114710043 CTGGAAAAGAAGCAGGAGACTGG + Intronic
1196465996 X:115972190-115972212 TTTAAGAAGAAATAGGAGACTGG + Intergenic
1197846647 X:130810716-130810738 CTGAAGAAGCAGTGGGCCACAGG - Intronic
1197883731 X:131195983-131196005 CTGTAGAAGGTGTAGGAAACTGG + Intergenic
1197916262 X:131539308-131539330 GTGGAGAAAGAGTAGGAAACTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199971989 X:152868008-152868030 CTGAGGAATGAGTGGGAGAAAGG - Intronic
1200081458 X:153578807-153578829 TGGAAGATGGAGGAGGAGACGGG + Intronic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic