ID: 960827444

View in Genome Browser
Species Human (GRCh38)
Location 3:121805503-121805525
Sequence CTGCATGTGGTTATTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960827444_960827446 -10 Left 960827444 3:121805503-121805525 CCAGGTTCAATAACCACATGCAG 0: 1
1: 0
2: 1
3: 4
4: 106
Right 960827446 3:121805516-121805538 CCACATGCAGTTAAGTTACTTGG 0: 1
1: 0
2: 6
3: 21
4: 179
960827444_960827451 30 Left 960827444 3:121805503-121805525 CCAGGTTCAATAACCACATGCAG 0: 1
1: 0
2: 1
3: 4
4: 106
Right 960827451 3:121805556-121805578 TGGGTCTTGCTTTTATGATCTGG 0: 1
1: 0
2: 2
3: 34
4: 488
960827444_960827447 10 Left 960827444 3:121805503-121805525 CCAGGTTCAATAACCACATGCAG 0: 1
1: 0
2: 1
3: 4
4: 106
Right 960827447 3:121805536-121805558 TGGAAACAGTTTGACCCTTTTGG 0: 1
1: 10
2: 40
3: 109
4: 297
960827444_960827448 11 Left 960827444 3:121805503-121805525 CCAGGTTCAATAACCACATGCAG 0: 1
1: 0
2: 1
3: 4
4: 106
Right 960827448 3:121805537-121805559 GGAAACAGTTTGACCCTTTTGGG 0: 1
1: 8
2: 47
3: 98
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960827444 Original CRISPR CTGCATGTGGTTATTGAACC TGG (reversed) Intronic
903582018 1:24378102-24378124 TTGCATGTGGCTATTGGCCCTGG + Intronic
903642451 1:24869243-24869265 CTGAACGTGGTTATTGTTCCTGG + Intergenic
903756119 1:25662239-25662261 CTGCATTTGCTTATTCAACAAGG - Intronic
909419349 1:75446127-75446149 CTGCATGTAGAGAATGAACCAGG - Intronic
917810942 1:178657989-178658011 TTGTATGGGGTTATTGAATCTGG - Intergenic
918729536 1:187973721-187973743 CTGCATTTAGTTATTGCATCTGG - Intergenic
921104082 1:211958989-211959011 CTGCATGGGGATATCGCACCGGG + Intronic
1069885243 10:71619572-71619594 CTGCCTGTGGTCACTGGACCTGG - Intronic
1073525430 10:104177348-104177370 CTGGGAGTGGTTAATGAACCTGG + Intronic
1073527695 10:104200313-104200335 CTGCATCTCGTTATTGGGCCAGG + Intronic
1073966339 10:108994699-108994721 CTGGATGTGCTTTATGAACCTGG - Intergenic
1074144892 10:110709109-110709131 CTGCATGTTGCCTTTGAACCAGG + Intronic
1074166170 10:110877279-110877301 CTACATGTGGTTATTACTCCTGG + Intronic
1074973873 10:118565339-118565361 CTGAATGTGCGTATTGAACTTGG - Intergenic
1080119591 11:28661848-28661870 ATACATGTGGTTACTGAACAAGG + Intergenic
1088174293 11:107033709-107033731 CTGGATGTGTTTATTAAAACTGG - Intergenic
1093975167 12:25413578-25413600 CTGCATGTGTTATTTGTACCAGG + Intronic
1101290986 12:103368939-103368961 CTTCATGTGATTAATGAATCTGG + Exonic
1102339392 12:112109603-112109625 CTGCATCTCCTTACTGAACCAGG - Intergenic
1105958621 13:25307874-25307896 CTTCAAGTGGTTTTGGAACCGGG + Exonic
1107340512 13:39400353-39400375 CCACATGTGGCTATTGAACATGG - Intronic
1113112990 13:106844663-106844685 ATACATGTTGTTATAGAACCAGG + Intergenic
1118669629 14:68109687-68109709 CTGAATGTGGTGATTGGCCCAGG + Intronic
1120610427 14:86635105-86635127 GTGCATGTGTTTATAGAACTAGG + Intergenic
1131031662 15:89191278-89191300 TTGGATTTGTTTATTGAACCAGG + Intronic
1133469681 16:6062488-6062510 ATGTATGTGGTTGCTGAACCTGG - Intronic
1135299911 16:21317412-21317434 CTGGTTGTGCTTCTTGAACCTGG + Intergenic
1137672401 16:50286658-50286680 GTGAATGTGGTGATTGCACCAGG + Intronic
1137757275 16:50912691-50912713 CAGCATATAGTTATTGAGCCTGG - Intergenic
1140579336 16:76210683-76210705 CTGCGTGTTATTATTGAATCTGG + Intergenic
1141236600 16:82223950-82223972 TGGCATGTGGTTATTGAATCTGG - Intergenic
1147711908 17:42473283-42473305 CTGTATGTTTTTAATGAACCTGG + Intronic
1149869225 17:60167850-60167872 CTCCATGAGGCTATTGAATCGGG + Intronic
1150559013 17:66279166-66279188 CTGCATTTGGTTTTTGGACAGGG + Intergenic
1152893067 17:82893466-82893488 GTGGATGTGATTATTGAACTTGG + Intronic
1158325531 18:56309867-56309889 CTCCATGTGGTTATGCTACCTGG - Intergenic
1160429418 18:78801225-78801247 CTGCATCTGGTGAGTGAAGCTGG - Intergenic
1160753928 19:748031-748053 CTGCAGGTGGTGACTGGACCAGG - Exonic
1161110881 19:2469340-2469362 CTGCAGGTGGGATTTGAACCAGG + Intergenic
1162462140 19:10819584-10819606 CTGCCTGTGCTTATTGACCTAGG - Intronic
1164879727 19:31721811-31721833 CTAAACGTGGGTATTGAACCTGG + Intergenic
925399133 2:3558924-3558946 CTGCACGTGGGTGTTTAACCAGG + Intergenic
926700515 2:15800297-15800319 CTGCATGGGTTCAATGAACCCGG + Intergenic
927535311 2:23852454-23852476 CTGCATCTGGTTTTGGAATCAGG - Intronic
937803591 2:126110661-126110683 CTGCATGTGTTCATTGATACAGG + Intergenic
941382429 2:164811327-164811349 CTGCATGTGTTTATCAAAACTGG + Intronic
942075212 2:172351272-172351294 CTGCCTGTGGATAATGAGCCAGG + Intergenic
942784235 2:179682489-179682511 CTGAATGTGGTAAGTGAACACGG - Intronic
944153023 2:196582258-196582280 CAGCATCTGGTTATTGAATTTGG - Intronic
944478245 2:200128499-200128521 CTGCATGAGGTTATAAAACCTGG - Intergenic
945359664 2:208881920-208881942 CTGCATGTGGTTCTGGAAGGTGG - Intergenic
1174265905 20:49331948-49331970 CTGCCTGTGGTTATCAAAGCAGG - Intergenic
1178191087 21:30282011-30282033 CTGGCTGTGGTTAATAAACCTGG + Exonic
1180029305 21:45193104-45193126 CTTCATCTGGTTTTGGAACCAGG - Intronic
1184417841 22:44362491-44362513 CTCTATGTGGTTTTTCAACCAGG - Intergenic
949407517 3:3730401-3730423 CTGCATGGTGTTCTTGAAGCTGG - Intronic
949601479 3:5603347-5603369 TTGCAGGTGGTGATGGAACCAGG - Intergenic
953721855 3:45363227-45363249 CAGGATGTGGTAACTGAACCAGG + Intergenic
954109443 3:48425900-48425922 CTTCATGTGGTGTTTGAACATGG - Intronic
956675767 3:71730578-71730600 GTCCATGTGGTCATTGAGCCTGG + Intronic
960827444 3:121805503-121805525 CTGCATGTGGTTATTGAACCTGG - Intronic
962658562 3:137575904-137575926 CTACAGGTGCTTATTGCACCTGG - Intergenic
969381398 4:6801052-6801074 CAGCAGCTGGGTATTGAACCAGG + Intronic
972152050 4:36104912-36104934 ATGCATCTTGTTATTGTACCAGG - Intronic
976678439 4:87728746-87728768 CTGGATGTATTTATTGAACGTGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977840431 4:101696390-101696412 TTGCATTTGGTGATTGAACAGGG - Intronic
980185592 4:129457461-129457483 CTGCATCTTGTTATTGGACTGGG - Intergenic
983535609 4:168853796-168853818 TTCCATGTGGTTTTTGAAACTGG + Intronic
989812285 5:45693871-45693893 TTGCATGTTAATATTGAACCTGG + Intronic
990350802 5:54913975-54913997 TTGGATGTGGTTATTGAAAATGG - Intergenic
990995758 5:61730733-61730755 CTGCATTTGGATACTGAACTGGG + Intronic
991589000 5:68229534-68229556 CTGCATGTGGTTCCTAGACCTGG - Intronic
993552755 5:89294994-89295016 TTGTATGTGGTTATAGAACCTGG + Intergenic
996359270 5:122627660-122627682 CTTCATGTGGAGACTGAACCTGG + Intergenic
999151606 5:149430075-149430097 TTGCATGTGATTATGGAACCTGG + Intergenic
999524290 5:152385710-152385732 CTGCATGTCTGTATTGAATCAGG + Intergenic
1000941955 5:167372454-167372476 CTGCATGTGGTTTTTGGCCTGGG - Intronic
1004021753 6:11782306-11782328 ATGGATCTGGTTATTCAACCAGG - Intronic
1006672687 6:35739172-35739194 CTGCATCTCGTTATTGGGCCAGG - Intronic
1006864974 6:37202027-37202049 CTGCATGTGGAGAGTGAACTTGG - Intergenic
1007833078 6:44653727-44653749 CTGGATGTGAGTATTCAACCAGG + Intergenic
1007893799 6:45326032-45326054 CTGCATGTAATTTTTGGACCAGG - Intronic
1010311756 6:74394607-74394629 CTGAATGTGGTTAATAAAACTGG + Intergenic
1011336615 6:86268357-86268379 CTGCTTGTGATTTTTGCACCTGG + Intergenic
1021627390 7:22607769-22607791 CCACATGTGGCTATTGAACATGG - Intronic
1023154936 7:37239817-37239839 CAGCATTTAGTTATTGAACATGG - Intronic
1027522033 7:79221292-79221314 CTGGATGTGGTTGTAGAACACGG - Intronic
1029174400 7:98653906-98653928 CTGCATCTGGTGATTGAACCAGG - Intergenic
1030320795 7:108165108-108165130 CTGCATGTGGTTACTGGTTCTGG - Intronic
1030654347 7:112149880-112149902 AAGCATGTGGCAATTGAACCTGG - Intronic
1033000919 7:137503635-137503657 CTGAATGTAGTTATTGACCAAGG - Intronic
1033038156 7:137894459-137894481 CTGCATATGGAGTTTGAACCAGG - Intronic
1036195887 8:6714295-6714317 CTGCATTTGCTTATTTAAGCAGG + Intronic
1038301929 8:26359323-26359345 CTGCATTTGGAGATTTAACCAGG - Intronic
1038714332 8:29978640-29978662 CTGCATTTGGTTGATGAACTAGG + Intergenic
1042662044 8:71165249-71165271 CAACATGTTGTTATAGAACCAGG - Intergenic
1047730443 8:127723607-127723629 CTGCCTGTGGTCATTGCATCTGG - Intergenic
1050149799 9:2608148-2608170 CTGCGTGTGGTTCTTGGATCTGG - Intergenic
1052188171 9:25624135-25624157 CAGCATGTGAAGATTGAACCTGG - Intergenic
1054742820 9:68825972-68825994 TTGCATGTGATTATTGAGGCTGG + Intronic
1057211623 9:93203814-93203836 CTGTGTGTGGTGATTGAAGCCGG + Intronic
1058645183 9:107125453-107125475 CTGCATGTGGTGATTGGTTCAGG - Intergenic
1185537589 X:874747-874769 CTCCGTGTGGTTTTTGAACACGG - Intergenic
1187026613 X:15441841-15441863 CTGGACGTGGTTAATGAAGCCGG + Intronic
1187266928 X:17742513-17742535 CTGCATGTAGTTTTAAAACCAGG - Intronic
1188217042 X:27491317-27491339 CTGCATGTGGATATTCAAGTGGG + Intergenic
1188817592 X:34734477-34734499 CTGCCTGTAGTATTTGAACCAGG + Intergenic
1192959121 X:76108054-76108076 CTCCATGTAGCTATTAAACCAGG - Intergenic
1192972630 X:76250109-76250131 CTACCTGTGTTCATTGAACCTGG - Intergenic
1197075188 X:122344615-122344637 CTGCATGTGCTTATCTCACCAGG + Intergenic
1197869192 X:131049822-131049844 CTGCACTTGGTCCTTGAACCTGG + Intergenic