ID: 960837842

View in Genome Browser
Species Human (GRCh38)
Location 3:121925906-121925928
Sequence GGTAAAGCATGTACAGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960837834_960837842 19 Left 960837834 3:121925864-121925886 CCTCCCCTGCCAAAGCCAACAGA 0: 1
1: 0
2: 2
3: 27
4: 304
Right 960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG 0: 1
1: 0
2: 2
3: 22
4: 178
960837836_960837842 15 Left 960837836 3:121925868-121925890 CCCTGCCAAAGCCAACAGATTTC 0: 1
1: 0
2: 2
3: 20
4: 309
Right 960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG 0: 1
1: 0
2: 2
3: 22
4: 178
960837837_960837842 14 Left 960837837 3:121925869-121925891 CCTGCCAAAGCCAACAGATTTCT 0: 1
1: 0
2: 1
3: 25
4: 202
Right 960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG 0: 1
1: 0
2: 2
3: 22
4: 178
960837840_960837842 4 Left 960837840 3:121925879-121925901 CCAACAGATTTCTGCAGAGGAAT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG 0: 1
1: 0
2: 2
3: 22
4: 178
960837833_960837842 20 Left 960837833 3:121925863-121925885 CCCTCCCCTGCCAAAGCCAACAG 0: 1
1: 0
2: 5
3: 55
4: 434
Right 960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG 0: 1
1: 0
2: 2
3: 22
4: 178
960837838_960837842 10 Left 960837838 3:121925873-121925895 CCAAAGCCAACAGATTTCTGCAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG 0: 1
1: 0
2: 2
3: 22
4: 178
960837835_960837842 16 Left 960837835 3:121925867-121925889 CCCCTGCCAAAGCCAACAGATTT 0: 1
1: 0
2: 2
3: 34
4: 365
Right 960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG 0: 1
1: 0
2: 2
3: 22
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960837842 Original CRISPR GGTAAAGCATGTACAGCACT TGG Intronic
901706078 1:11074165-11074187 GTAAAAGCATGTACAGCTGTAGG + Intronic
902320413 1:15659845-15659867 GGTAAAGAATCTACCTCACTGGG + Exonic
904089562 1:27935235-27935257 GCTGAACCAGGTACAGCACTGGG + Exonic
904396855 1:30228005-30228027 GCTAGAGCATCAACAGCACTAGG + Intergenic
905968996 1:42126553-42126575 GTTAAAGTATATACAGAACTTGG + Intergenic
906458462 1:46018913-46018935 GGTAAAGAATGTACTGCATTTGG - Intronic
908009841 1:59764786-59764808 GATAATGCATATAAAGCACTCGG + Intronic
908698842 1:66875704-66875726 GGTAAAGCTTGGACAGCTTTAGG + Intronic
911899244 1:103480606-103480628 GGTAGTCCATGTAGAGCACTTGG + Intergenic
911969350 1:104410711-104410733 GGAAAAAAATTTACAGCACTGGG - Intergenic
912339897 1:108903157-108903179 GGAAATGCATACACAGCACTAGG + Exonic
914317277 1:146525207-146525229 GAAAATGCATGTAAAGCACTTGG + Intergenic
914497079 1:148208153-148208175 GAAAATGCATGTAAAGCACTTGG - Intergenic
920333034 1:205225862-205225884 GGTAATATATGTAAAGCACTTGG - Intergenic
920449118 1:206044638-206044660 TGCAAAGATTGTACAGCACTTGG - Intronic
921154474 1:212428270-212428292 AGTAAAGCCTGTTCAGCACAGGG + Intergenic
923794806 1:237143443-237143465 GGCAAAGCAGCTACAGCATTTGG - Intronic
1064619962 10:17205268-17205290 GAAAAAGCATTTTCAGCACTTGG - Intergenic
1070386325 10:75927976-75927998 GAAAAAGCATGTAAAGCAGTTGG + Intronic
1071097414 10:81993935-81993957 TGGAAAGTAAGTACAGCACTGGG - Intronic
1071229958 10:83574245-83574267 AGTAATGTATGTATAGCACTTGG - Intergenic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1074767135 10:116707692-116707714 GGAAGAGCATCTACAGCCCTCGG + Intronic
1074876508 10:117617735-117617757 GGTAAAGCATCTTCACCACCTGG + Intergenic
1075125952 10:119699055-119699077 GGTAATGCAGGTAAAGCACTTGG - Intergenic
1075153759 10:119957145-119957167 GATGAAGCATGAATAGCACTCGG - Intergenic
1076084953 10:127619182-127619204 GGCAAAATATCTACAGCACTGGG + Intergenic
1076310421 10:129502336-129502358 GATAACGCATGTAAAGCACCTGG + Intronic
1078357699 11:10644720-10644742 GATAAAGCATGTAAAACACTTGG - Intronic
1078845026 11:15112842-15112864 GGTCAAGGATGTAAAGCACCTGG - Intronic
1079109672 11:17597958-17597980 GGCATTGCATGTACAGCACTTGG + Intronic
1079520038 11:21315445-21315467 GTTAAAGAATGGACAGAACTTGG + Intronic
1079523370 11:21355392-21355414 GGTAGTGCATGTAAAGCACTTGG - Intronic
1082700309 11:56421711-56421733 GGTAGAACATGAATAGCACTAGG - Intergenic
1084290175 11:68159603-68159625 CCTAAAGGAAGTACAGCACTTGG + Intronic
1086881157 11:92155197-92155219 GGTAATACATATAAAGCACTAGG - Intergenic
1087345412 11:96965208-96965230 CCTGAAGCAAGTACAGCACTGGG - Intergenic
1087686773 11:101274009-101274031 GGAAAAGCATGTTCAGGGCTTGG + Intergenic
1088773580 11:113059853-113059875 GGTCATGTATGTAAAGCACTTGG + Intronic
1089077779 11:115752227-115752249 GGTAAAGAATGACCACCACTGGG + Intergenic
1089813874 11:121154935-121154957 GGAAAAGCATGGTCAGCTCTTGG + Intronic
1091025589 11:132138045-132138067 GGTGCAGCATGTCCAGCAGTAGG - Intronic
1091119000 11:133041249-133041271 GATAACGCTTGTAAAGCACTTGG + Intronic
1092671955 12:10873291-10873313 GGTAAAATGTGCACAGCACTAGG - Intronic
1093961204 12:25274522-25274544 GGAAATACGTGTACAGCACTAGG - Intergenic
1093971552 12:25380786-25380808 GATAAAGACTGTAAAGCACTTGG + Intergenic
1101744608 12:107529555-107529577 TATAAAGCATTTAAAGCACTTGG - Intronic
1102554273 12:113716503-113716525 GAAAATGCATGTACAGCCCTTGG - Intergenic
1104249023 12:127072140-127072162 GGTAATAAATGTAAAGCACTTGG + Intergenic
1105892688 13:24692896-24692918 GGTAATGCTTCTGCAGCACTTGG + Exonic
1107375084 13:39795696-39795718 GGAAAAGCATGGAAAGCACATGG - Intergenic
1110132989 13:72029715-72029737 ACTAAAGCAGGTGCAGCACTGGG - Intergenic
1110829317 13:80012219-80012241 TATAATGCATGTACAGCACTTGG - Intergenic
1112209161 13:97357491-97357513 GGTAAAGGATGAAGAGCACCAGG - Exonic
1113191199 13:107748738-107748760 GGAAATGCATGTACTACACTGGG + Intronic
1114652648 14:24296029-24296051 GGGAGAGCAGGTACATCACTGGG - Intronic
1116522161 14:45862726-45862748 GGGAAATCATGTACAGAAATTGG + Intergenic
1118527157 14:66658799-66658821 GGTACTGCATGTTCAGTACTAGG - Intronic
1120761196 14:88287006-88287028 GTTAATGCATGTAAAGCACTTGG - Intronic
1123721152 15:23063069-23063091 GGTAGAGCATGTACTTCACATGG + Intergenic
1124690428 15:31817187-31817209 TGAAAAGCATGGACAGCAATGGG - Intronic
1125259238 15:37803053-37803075 GTTAAAGCATATACACCACATGG - Intergenic
1127266379 15:57365603-57365625 GGCATAGCAGGCACAGCACTTGG + Intergenic
1127567519 15:60206619-60206641 GGGAAAGCATGTGAAACACTGGG + Intergenic
1128152810 15:65373785-65373807 AGTAATTCATGTAAAGCACTTGG + Intronic
1128469058 15:67936796-67936818 GGTAAAGAATGTAAAGAACAGGG + Intergenic
1129112485 15:73345590-73345612 GGTAGAGCATGCACGGCTCTAGG - Intronic
1131798146 15:96041649-96041671 GGTAATGCATATACATCATTTGG - Intergenic
1132439060 15:101841086-101841108 CGTGAAGCTAGTACAGCACTGGG + Intergenic
1135741428 16:24978608-24978630 AGTTAAGCAGGAACAGCACTGGG - Intronic
1140925304 16:79576797-79576819 GGTAATGTATGTAAAGCACCTGG - Intergenic
1144460373 17:15453905-15453927 GATAATTCATATACAGCACTGGG + Intronic
1149239088 17:54627648-54627670 GGTAAAGCATTTACAGGCCAGGG + Intergenic
1151174395 17:72275228-72275250 GGAAAAACAAGTACAGCACTTGG + Intergenic
1151858434 17:76739264-76739286 GACAATGCATGTAAAGCACTTGG + Intronic
1153714933 18:7838613-7838635 CCTGAAGCCTGTACAGCACTGGG + Intronic
1154380330 18:13843836-13843858 GGTAATGCATTTAAAGCACTTGG + Intergenic
1155769518 18:29679248-29679270 CCTATAGAATGTACAGCACTAGG - Intergenic
1156634231 18:39008565-39008587 GTTCAAGCATGCACAGCACGAGG - Intergenic
1156894699 18:42232426-42232448 AATAATGCATGTAAAGCACTTGG - Intergenic
1158251839 18:55498212-55498234 GGTTAAGCAAGTACAGCACCTGG + Intronic
1159200397 18:65176020-65176042 GGTAAGGCATCTACATCATTGGG - Intergenic
1160617632 18:80144915-80144937 GCTAGAAAATGTACAGCACTGGG - Intronic
1162582471 19:11539560-11539582 GGTAAAGCAGGTACAGCGCTCGG + Intronic
1163956774 19:20649853-20649875 GAGAAAGCAGGTACAGCACAAGG + Intronic
1167127933 19:47563951-47563973 GTTAATGCATATAAAGCACTTGG - Intergenic
926386429 2:12339973-12339995 GGTAATGTATGTAGACCACTAGG + Intergenic
926932733 2:18056564-18056586 GATAATGCATGTAAAGCACCTGG + Intronic
929085080 2:38160033-38160055 GGTATAGAATGTAACGCACTAGG + Intergenic
931575417 2:63713294-63713316 GGTAAGGGAGGTACAGCCCTTGG - Intronic
932176941 2:69611440-69611462 GGTAAAACTTATACAGCACATGG + Intronic
932177053 2:69612663-69612685 GGTAAAACTTATACAGCACATGG - Intronic
932782809 2:74572749-74572771 GGTAAAGTATGCAAAACACTTGG + Intronic
933796849 2:85926853-85926875 GGTAATGCATGTAATGCACCTGG + Intergenic
937597499 2:123688498-123688520 AGTAAAGCCTCTACAGCACGAGG - Intergenic
938202442 2:129385775-129385797 GGTAATCCATGGACAGCAGTAGG - Intergenic
938937375 2:136138783-136138805 GGAAAAGCCTGGGCAGCACTGGG - Intergenic
939986034 2:148830713-148830735 GATAAATCATGTAAAGCTCTTGG - Intergenic
944489944 2:200248180-200248202 GATAATGCATGTAAAGCACTTGG + Intergenic
944595596 2:201257910-201257932 AATAAAGCATGTCCAGCGCTCGG + Intronic
947650930 2:231786040-231786062 GATAATGCATGTACAGCACCTGG + Intronic
1170225371 20:13986312-13986334 GGTAATGGCTGTACAACACTGGG - Intronic
1170835254 20:19878365-19878387 AATAAAGGATGCACAGCACTTGG + Intergenic
1172020463 20:31910189-31910211 GGTAACGCAGGTAAAGCACTTGG - Intronic
1173815523 20:45985233-45985255 AATAAAGTGTGTACAGCACTTGG - Intergenic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1182033593 22:27180280-27180302 GTTAAAACATGTACAGCACTTGG - Intergenic
1182947159 22:34334305-34334327 AGTAGAGCATGAACAGCAGTTGG - Intergenic
1183265349 22:36821574-36821596 GATAAAGCACATAAAGCACTAGG - Intergenic
1184175767 22:42788043-42788065 GGTAAGGCAAGTGCAGCACATGG + Intergenic
1184639973 22:45865569-45865591 GGTAATGCATGCACAGCCCATGG + Intergenic
949381565 3:3451890-3451912 GGTGATGCATGCACATCACTGGG + Intergenic
949939707 3:9145592-9145614 GGAAAAGAATGTACAACCCTGGG + Intronic
951258422 3:20478620-20478642 GAAAAAGCAAGTTCAGCACTTGG - Intergenic
952011368 3:28903866-28903888 TGTAAAGCATTTACCACACTTGG - Intergenic
952314811 3:32223465-32223487 GGGAAATCATGTACAACACATGG + Intergenic
953947345 3:47161225-47161247 GATAATGCATGAAGAGCACTTGG - Intronic
954684538 3:52363234-52363256 GGTAATGCCTGTAAAGCACCGGG - Intronic
955412401 3:58664209-58664231 GCTAATCCATGTACAGTACTTGG + Intronic
955689563 3:61578000-61578022 GGTAAACCATGTAAGGCATTTGG + Intronic
955996143 3:64682817-64682839 GATAAAGTATGAGCAGCACTAGG + Intronic
956773902 3:72549474-72549496 GACAATGCCTGTACAGCACTTGG + Intergenic
958153118 3:89717690-89717712 GGAAAAGCATGAAAAGAACTGGG + Intergenic
960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG + Intronic
961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG + Intronic
962705077 3:138035406-138035428 GTTAAAGTATATAAAGCACTAGG - Intergenic
963186615 3:142424973-142424995 GGCAAAGTATTCACAGCACTAGG + Intronic
963231346 3:142911376-142911398 GGGAATGCATGCAAAGCACTTGG + Intergenic
963686296 3:148439279-148439301 GGTAGAGCATGTGCTGCTCTTGG + Intergenic
964513208 3:157476455-157476477 AGCAAAGGATGTACAGCAGTAGG + Intronic
965881471 3:173393684-173393706 AATAATGCATGTAAAGCACTTGG - Intergenic
965910598 3:173770291-173770313 TGTAAAACATTTACAGAACTTGG + Intronic
966183391 3:177206901-177206923 GGAAAAGCAGATACTGCACTTGG - Intergenic
966209588 3:177439282-177439304 GGTAAAGCAAGTACATCTCTGGG - Intergenic
967891317 3:194366292-194366314 GTTAATGCATGTGAAGCACTTGG + Intronic
969201494 4:5609962-5609984 GGTAAAGCATGTAATGAACAAGG + Intronic
970504298 4:16711370-16711392 GGTAAAGCATGTGCACCATTGGG + Intronic
972022259 4:34330380-34330402 GGGAAAGCAGGTACATCACATGG - Intergenic
974352917 4:60773238-60773260 CCTAAAGCCAGTACAGCACTGGG + Intergenic
975327988 4:73081701-73081723 AAAAAATCATGTACAGCACTTGG + Intronic
975644319 4:76530934-76530956 GGGAAAGCAAGTACAGTCCTTGG - Intronic
976804352 4:89028936-89028958 GATAAAGCATGTAAAACATTTGG - Intronic
980422664 4:132584473-132584495 TGTAAAGCAGATACATCACTTGG - Intergenic
980845611 4:138320820-138320842 TGTAAAGGATGTCAAGCACTAGG + Intergenic
985495652 5:203523-203545 TGTAAAGCGTGTACAGCTCAGGG + Exonic
988907922 5:35809119-35809141 GGTCATGCATGTAAAGCACTTGG + Intronic
996391034 5:122962165-122962187 TGGAAAGCATGTAAATCACTGGG - Intronic
996391040 5:122962341-122962363 TGGAAAGCATGTAAATCACTGGG - Intronic
997465292 5:134084103-134084125 GAAAATGCATGTAGAGCACTTGG + Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999014510 5:148085824-148085846 GTTAATTCATGTATAGCACTTGG - Intronic
999229737 5:150054563-150054585 GGTAAAGCATGCCAAGGACTTGG - Intronic
1000447914 5:161347160-161347182 GGCAATGCATGTAAAGTACTTGG - Intronic
1001878523 5:175222094-175222116 GGGAAAACAGGTACAGCACAGGG - Intergenic
1004328390 6:14698687-14698709 AACAAAGCATGTAAAGCACTTGG + Intergenic
1004360640 6:14967819-14967841 GGTACAGCATGGACAGCACCTGG - Intergenic
1004889751 6:20089259-20089281 GGAAAAGCATGCTCAGCAGTTGG - Intergenic
1005356036 6:24984528-24984550 GATAATGCATTTAAAGCACTTGG + Intronic
1006396859 6:33793297-33793319 GGTTCAGCAACTACAGCACTGGG - Intergenic
1006428012 6:33978218-33978240 GGCAATGTATGTACAGCACTCGG - Intergenic
1008192459 6:48476185-48476207 CCTAAAGCTTGCACAGCACTGGG - Intergenic
1008962369 6:57278772-57278794 GGGAAAGCGTGTCCAGCAGTTGG + Intergenic
1010050035 6:71492573-71492595 GATAAAACATGTAAAGCACTTGG + Intergenic
1013354030 6:109331891-109331913 GGTGAAGCATGGCAAGCACTGGG - Intergenic
1013532169 6:111030054-111030076 AGTAAAGCACTTACAGCTCTGGG - Intergenic
1014752162 6:125268560-125268582 GGTAAATCATGAACAGCCATTGG + Intronic
1014897225 6:126917132-126917154 GGTAAAACATGTACACAAATTGG - Intergenic
1020726793 7:11825632-11825654 GGTAATGCATGTAACGTACTAGG - Intronic
1021031682 7:15744956-15744978 TGTAAAGCAAGGACAGCAATAGG + Intergenic
1022221800 7:28321119-28321141 GCTAGAGCATGTAAAGAACTTGG + Intronic
1022768973 7:33448562-33448584 GGTAAAGCTTGTGAAGCAATTGG + Intronic
1023858764 7:44203674-44203696 GGTAATACGTGTAAAGCACTTGG - Intronic
1023978555 7:45052026-45052048 GCTAAAGGAGGTACAGCAGTAGG - Intronic
1024676893 7:51645493-51645515 GTTAATGCATGAATAGCACTCGG - Intergenic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1028035886 7:85981511-85981533 GGTTAAGCATACACAGCACATGG - Intergenic
1028453674 7:91015297-91015319 AGTGAAGAATGTACAGAACTTGG - Intronic
1032578332 7:133079541-133079563 GGTAAGGTATGTAAAGCACCTGG - Intronic
1033251725 7:139766434-139766456 GGTGGTGAATGTACAGCACTTGG - Intronic
1034380799 7:150690506-150690528 GGTAATGCAGGTAAACCACTTGG + Intronic
1036054807 8:5239504-5239526 GGTCAAGCATCTGCTGCACTTGG - Intergenic
1038466958 8:27773059-27773081 TGTAAAGCTCCTACAGCACTTGG + Intronic
1041033572 8:53763650-53763672 GGTACAGCATGTAAAGAGCTTGG + Intronic
1042384246 8:68154247-68154269 GGTAATACCTGTACAGCATTTGG + Intronic
1045348096 8:101312878-101312900 AGTAAAGTATATAAAGCACTTGG + Intergenic
1048059958 8:130908759-130908781 TGTAAAGCATGCACAGCACCTGG - Intronic
1048073875 8:131047688-131047710 GGTAATTCATGCAAAGCACTTGG + Intergenic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1052275526 9:26671496-26671518 GGTAAAACTTGTAAAACACTTGG + Intergenic
1054824633 9:69560583-69560605 GGGAATGCATGTAAAGTACTTGG + Intronic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1058773270 9:108259626-108259648 GGTAAAGTATGAAAAACACTGGG - Intergenic
1059623140 9:116031213-116031235 GGTAAATCTTGTAAACCACTTGG + Intergenic
1061042208 9:128146709-128146731 GGTCATGCATGGACAGCACCGGG - Intergenic
1186210449 X:7244909-7244931 GGTAAAGCAGTTACAGTGCTTGG + Intronic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1189376218 X:40468189-40468211 GGTAATGCATATAAACCACTTGG - Intergenic
1191893896 X:65972919-65972941 GGTAAAACATGAACAGGACCTGG + Intergenic
1193508707 X:82373098-82373120 AGTAGAGCATGAACAGCACTTGG - Intergenic
1195720868 X:107866870-107866892 GATAATACATGTAAAGCACTTGG - Intronic
1197429530 X:126343087-126343109 CTTAAAGCAAGCACAGCACTGGG - Intergenic
1197752100 X:129971804-129971826 GGTAGTGGTTGTACAGCACTGGG + Intergenic
1198070160 X:133140253-133140275 ATTAATGCATGTGCAGCACTGGG - Intergenic