ID: 960846374

View in Genome Browser
Species Human (GRCh38)
Location 3:122007765-122007787
Sequence CTAATTATGATTCGTGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960846364_960846374 28 Left 960846364 3:122007714-122007736 CCTGGAGCACTCTTCCACATCAC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 77
960846365_960846374 14 Left 960846365 3:122007728-122007750 CCACATCACCTGCCACTGCTCCA 0: 1
1: 0
2: 6
3: 53
4: 497
Right 960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 77
960846367_960846374 2 Left 960846367 3:122007740-122007762 CCACTGCTCCACTCTCTTCCCTG 0: 1
1: 0
2: 3
3: 108
4: 953
Right 960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 77
960846366_960846374 6 Left 960846366 3:122007736-122007758 CCTGCCACTGCTCCACTCTCTTC 0: 1
1: 0
2: 1
3: 47
4: 504
Right 960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 77
960846370_960846374 -6 Left 960846370 3:122007748-122007770 CCACTCTCTTCCCTGGGCTAATT 0: 1
1: 0
2: 2
3: 35
4: 292
Right 960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960846374 Original CRISPR CTAATTATGATTCGTGCCTT GGG Intronic
901646617 1:10720350-10720372 GTAACTAGGAATCGTGCCTTTGG + Intronic
903317941 1:22523611-22523633 CTACTTTTGATTCCTGCTTTGGG + Intronic
906157221 1:43620793-43620815 ATGATTAGAATTCGTGCCTTAGG - Intronic
911188973 1:94928723-94928745 CTAATTATCATTACTCCCTTTGG - Intergenic
911639642 1:100274012-100274034 TTAAATATGCTTTGTGCCTTTGG + Intronic
916860291 1:168796571-168796593 ATTTTTATGATTTGTGCCTTTGG + Intergenic
922230929 1:223685271-223685293 CTAATAATGCTTCTTGCCTCAGG - Intergenic
924751032 1:246890314-246890336 CAAATTATTATTTGTGCCTAAGG - Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1067275614 10:44830603-44830625 CTAATGATTATCCGAGCCTTCGG + Intergenic
1068294452 10:55051889-55051911 CTCATTATGTTTCTGGCCTTGGG + Intronic
1070415825 10:76188412-76188434 CTAATAAAGATTCATGTCTTTGG - Intronic
1072552438 10:96489062-96489084 CTAATTGTGATGTGTGCCATGGG + Intronic
1073871251 10:107867448-107867470 CTAATTGTTTTTCCTGCCTTGGG - Intergenic
1078505142 11:11933469-11933491 GTAATTATGATTATTTCCTTAGG - Intronic
1080073503 11:28118673-28118695 CTAATTTAGCTTGGTGCCTTGGG + Intronic
1080760541 11:35244874-35244896 CTAATTATGCTTGGGGCTTTAGG - Intergenic
1088394362 11:109350292-109350314 CCATTTATGATTCATTCCTTTGG - Intergenic
1094023470 12:25939149-25939171 CAAATTAGAATTGGTGCCTTTGG - Intergenic
1099447994 12:82775008-82775030 CTAATTGTGAGTCTTGCCATTGG + Intronic
1100519083 12:95356460-95356482 CTAATTATAATTAATCCCTTAGG + Intergenic
1100772817 12:97942096-97942118 CCAATTATGACTCATCCCTTGGG + Intergenic
1110476985 13:75927856-75927878 CTAATTAAGATTCTAGCTTTAGG - Intergenic
1113883405 13:113642497-113642519 CTCATTATGATCCTTGCATTTGG - Intergenic
1115726994 14:36227859-36227881 TTAATTATTGTTTGTGCCTTTGG - Intergenic
1120631532 14:86897721-86897743 CTACTGATGATTCTTTCCTTTGG + Intergenic
1128658431 15:69479544-69479566 CTAATAGTCATTCATGCCTTAGG - Intergenic
1131480837 15:92780330-92780352 CTAATTATCATTGGGGCCATAGG - Intronic
1132422992 15:101690015-101690037 CTAAATCTGAATCGTGCCATTGG - Intronic
1134293023 16:12918643-12918665 TTATTTATGATTCTTGCGTTTGG + Intronic
1158534855 18:58298503-58298525 CTAATAATGGTTTCTGCCTTAGG + Intronic
1160231218 18:77050961-77050983 CTAATTATAATATTTGCCTTTGG + Intronic
1160278789 18:77466671-77466693 CTTTTTATGAATCGTGCTTTTGG + Intergenic
927437439 2:23079972-23079994 TTAATTATGATAAGTGCCTATGG + Intergenic
935288831 2:101591515-101591537 CTAATGATCATCTGTGCCTTTGG + Intergenic
940884433 2:158976363-158976385 CTCATTCTTATTCTTGCCTTTGG + Intronic
941818372 2:169821109-169821131 GTAATTATGAATCCTCCCTTTGG - Exonic
942563880 2:177247794-177247816 CTAATTTTCATTTGTGCCTTTGG + Intronic
1178316778 21:31573376-31573398 CCAATCATGATTCATCCCTTGGG - Intergenic
1185178267 22:49343710-49343732 CTAATGATCATTTGAGCCTTTGG - Intergenic
952815677 3:37445389-37445411 CTAACTTTGATTAGTGACTTTGG + Intergenic
956128194 3:66030895-66030917 CTAATTTTGCTACATGCCTTCGG + Intronic
957735293 3:84194776-84194798 CAAATTGTGTTTTGTGCCTTTGG - Intergenic
959043687 3:101448038-101448060 CTAATTAATATTTTTGCCTTTGG - Intronic
959134858 3:102405147-102405169 CTTATTATGACTCTTGCTTTGGG - Intronic
960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG + Intronic
962967705 3:140369963-140369985 CTAATTAGGATTCTTTCCATTGG + Intronic
964574824 3:158154237-158154259 CTAATGATCATTTGAGCCTTCGG + Intronic
972439329 4:39070504-39070526 CTATTGATGATTCTTTCCTTTGG + Intronic
972804652 4:42516413-42516435 CTTATTATGATGCGTGGATTGGG - Intronic
979617835 4:122764183-122764205 ATATTTATGATTTGTGCTTTGGG + Intergenic
979778557 4:124621081-124621103 CTAATTATGAGTTGTACATTGGG - Intergenic
980603386 4:135056946-135056968 CTAAATAAAATTTGTGCCTTTGG + Intergenic
980781023 4:137492580-137492602 GTAGTTATGATTTGTGTCTTAGG + Intergenic
988195184 5:27996146-27996168 CCAATTATGATTTGGGGCTTAGG - Intergenic
996887868 5:128380182-128380204 CTCATTTTGCTTCGTTCCTTTGG - Intronic
1004113540 6:12745371-12745393 CTAAATATGACTCCTGACTTGGG - Intronic
1009789025 6:68376338-68376360 CTAATTATGATAGTTTCCTTAGG - Intergenic
1012139805 6:95611897-95611919 CTAATTATGATACTTGCTGTAGG - Intergenic
1012390032 6:98728138-98728160 CAAATCATGATTGTTGCCTTAGG + Intergenic
1014262336 6:119233581-119233603 CTAATTAAGAGTCCTGCATTTGG - Intronic
1016806151 6:148214195-148214217 CTAATTCTGATTTGTGCATTTGG + Intergenic
1020623816 7:10552511-10552533 CTAATTATGATTCTTTTCCTAGG - Intergenic
1021711811 7:23423224-23423246 ATGATTATAATTCATGCCTTTGG - Intronic
1021715594 7:23459259-23459281 CCAATTATGAATCCTGTCTTTGG - Intronic
1022726198 7:32984081-32984103 CTCATTATGGTTCCTGTCTTTGG + Intronic
1024439725 7:49403320-49403342 CTAGTTATGATTTTTGCCATTGG - Intergenic
1025047396 7:55703580-55703602 CTCATTATGGTTCCTGGCTTTGG - Intergenic
1028727051 7:94099904-94099926 ATAATTATGGTTTCTGCCTTTGG - Intergenic
1028905761 7:96152368-96152390 CTAATTGTGATCCCTGCCTCAGG - Intronic
1030582959 7:111383216-111383238 ATAACTATGACTCTTGCCTTGGG - Intronic
1030609388 7:111672113-111672135 CTCATTATCATTTGTGCATTTGG - Intergenic
1034226415 7:149487393-149487415 TTAAGTATGATTTTTGCCTTTGG - Intronic
1043099561 8:76024068-76024090 GTAATTATGATTGGTGAATTAGG - Intergenic
1043322156 8:79000940-79000962 GTGATTATGATTTGTGCCTCTGG + Intergenic
1059185885 9:112270538-112270560 TTAATTATGATTCTTATCTTGGG - Intronic
1059974832 9:119704723-119704745 TTAATTATGATTTCTGCATTGGG - Intergenic
1186719517 X:12288189-12288211 CCAATTGTGATACATGCCTTGGG + Intronic
1193298324 X:79858320-79858342 CAAATTTTTATTCCTGCCTTAGG + Intergenic
1199045758 X:143169543-143169565 CTGATCATGATTTGTCCCTTTGG - Intergenic