ID: 960855975

View in Genome Browser
Species Human (GRCh38)
Location 3:122102588-122102610
Sequence CTATGGTTGTAAAATTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960855970_960855975 6 Left 960855970 3:122102559-122102581 CCTTTCTCTCAACCCTTCCAGCA 0: 1
1: 0
2: 6
3: 23
4: 434
Right 960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
960855973_960855975 -7 Left 960855973 3:122102572-122102594 CCTTCCAGCATGATGTCTATGGT 0: 1
1: 0
2: 0
3: 18
4: 121
Right 960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
960855968_960855975 30 Left 960855968 3:122102535-122102557 CCAAAGTGTCCTCAAGGACTAAA 0: 1
1: 0
2: 1
3: 12
4: 149
Right 960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
960855969_960855975 21 Left 960855969 3:122102544-122102566 CCTCAAGGACTAAAGCCTTTCTC 0: 1
1: 0
2: 2
3: 17
4: 244
Right 960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
960855971_960855975 -6 Left 960855971 3:122102571-122102593 CCCTTCCAGCATGATGTCTATGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960855975 Original CRISPR CTATGGTTGTAAAATTGTCC AGG Intronic
901912835 1:12474437-12474459 ATATTGTTGTGAGATTGTCCTGG - Intronic
920885212 1:209920657-209920679 CTATGCTTTTAAAATTCTGCAGG - Intergenic
1065826279 10:29574718-29574740 CCACTGTTGTAAACTTGTCCTGG + Intronic
1065951093 10:30651900-30651922 CCATTGTTGTAAACTTGTCCTGG - Intergenic
1067239649 10:44479435-44479457 CTATGGTAGTCTAGTTGTCCAGG - Intergenic
1068408323 10:56622859-56622881 CTGTGGTTCTGAAATTGTACTGG + Intergenic
1072324138 10:94280014-94280036 GGATGGTTGTAATATTGTCCAGG + Intronic
1074937301 10:118194495-118194517 ATATGGTTGTATAATTTTTCAGG + Intergenic
1075570038 10:123534939-123534961 CTAGGGTGGTAAAATTTTCTAGG + Intergenic
1075953321 10:126500903-126500925 CTCTGTTTGTAGAATTGCCCAGG + Intronic
1077203132 11:1323650-1323672 CTATGGTTTTAAATTTGTGAAGG - Intergenic
1082219007 11:49609891-49609913 CTATGGTTCTAAATTGGTTCTGG + Intergenic
1083525623 11:63361790-63361812 CCATGGTGGGAAACTTGTCCTGG + Intronic
1085564526 11:77501253-77501275 CTATGGATGTGAAACTCTCCTGG - Intergenic
1086830684 11:91559509-91559531 TTATGCTGGTAAAATAGTCCTGG - Intergenic
1086920464 11:92580916-92580938 CAATGGTTGGAAAAATTTCCTGG - Intronic
1090739773 11:129647539-129647561 CTATGGTTTTAAATTTGTTAAGG - Intergenic
1092448371 12:8579479-8579501 CTAGGGTTTTAAAGTTGTCATGG - Intergenic
1093202415 12:16204879-16204901 CTATGGTTGTATAATTTTAATGG - Intronic
1096901732 12:54890101-54890123 ATAGGGATGTAAAATTGTACAGG - Intergenic
1098159688 12:67638101-67638123 CAATTGTTCTTAAATTGTCCTGG - Intergenic
1099511889 12:83548924-83548946 CTATGTTTGGAAAGTTCTCCTGG + Intergenic
1100544901 12:95592365-95592387 CTATGGGTGCCAAATTGACCAGG + Intergenic
1103338278 12:120206599-120206621 CTCTGATTGTAAAGGTGTCCAGG - Intergenic
1106684005 13:32037631-32037653 CTCAGATTGTAAAATTATCCGGG - Intronic
1106844510 13:33723643-33723665 TTTTGGTTTTAAAATTTTCCAGG - Intergenic
1108496161 13:51027429-51027451 TTATAGGTGAAAAATTGTCCAGG + Intergenic
1111737535 13:92161073-92161095 TAATAGTTGTAAAATTGTCTAGG + Intronic
1112683547 13:101795697-101795719 CTATGGTTGAGTAATTGTCATGG - Intronic
1113513142 13:110871595-110871617 CAATGGTTTTAAAATTCTCTTGG - Intergenic
1114069889 14:19098155-19098177 CCCTGGTTTTAAAATTGTGCCGG + Intergenic
1114092372 14:19301847-19301869 CCCTGGTTTTAAAATTGTGCCGG - Intergenic
1114413586 14:22523454-22523476 CTTTGGTTCTCAAATTTTCCAGG + Intergenic
1116088481 14:40273294-40273316 CTATTGTTTTAAAATTGTTAAGG + Intergenic
1117746138 14:58871362-58871384 CTATTCTTCTAAAACTGTCCAGG + Intergenic
1121759914 14:96436117-96436139 CTTTGGTTGAAAAACTGTCTTGG + Intronic
1128581656 15:68814632-68814654 GAATGGTTATAAAATTGGCCAGG - Intronic
1134971112 16:18531732-18531754 TTGTGATTGTAAAATTGGCCTGG - Intronic
1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG + Intronic
1137244521 16:46691207-46691229 CTCTTGTTTTAGAATTGTCCTGG + Intronic
1142527417 17:553863-553885 ATAAGGTTGTAAGATTGGCCAGG - Intronic
1142934523 17:3317310-3317332 CTATGGTTGTAAAATCTTGGAGG + Intergenic
1146976054 17:37113004-37113026 CCATGGCTGTAACATTCTCCAGG + Intronic
1153046978 18:865204-865226 CTTTTTTTGAAAAATTGTCCAGG + Intergenic
1153991526 18:10404656-10404678 CTCTAGTTGTTAAATTGTACAGG + Intergenic
1157903765 18:51546817-51546839 TTATGGATATCAAATTGTCCTGG - Intergenic
1158280246 18:55817408-55817430 CTATGACTGGAAAATTCTCCAGG - Intergenic
1158584118 18:58715267-58715289 CTAAGATTCTAAAATTTTCCTGG + Intronic
1165118920 19:33546618-33546640 CTTTGGCTGTAGAATTGACCAGG + Intergenic
1165125909 19:33597080-33597102 CTGGGGTGATAAAATTGTCCTGG - Intergenic
927583141 2:24273406-24273428 CTAGGCTTGGAAAAGTGTCCCGG - Intronic
929205426 2:39286414-39286436 CTATAGTTAGAAATTTGTCCTGG + Intronic
930159895 2:48144279-48144301 ATATGGATGAAAAATTCTCCAGG - Intergenic
938667816 2:133557400-133557422 GTATGGTTATAAAGGTGTCCTGG - Intronic
940306233 2:152230185-152230207 GTATTGTTGAAAAATAGTCCAGG - Intergenic
940561688 2:155305030-155305052 CTACAGTTTTAAAATTGTTCTGG - Intergenic
941689644 2:168486541-168486563 CTATGGCTGTTTAATTGTTCCGG + Intronic
942876825 2:180810383-180810405 CTTTGCTTTTAAAATTGTTCGGG + Intergenic
944603841 2:201331443-201331465 CTTGGGTTCTAAAATTATCCTGG - Intronic
944930343 2:204511151-204511173 TTATGGTTATAAAATTGTGCAGG + Intergenic
946620923 2:221561722-221561744 TTTTGGTTGTAAAAATGTCAAGG + Intronic
1171373026 20:24673905-24673927 CAATGCTTGTGAAACTGTCCTGG - Intergenic
1175804908 20:61821771-61821793 AAATGGTTGTAAAATTGAGCTGG - Intronic
1177992635 21:28057359-28057381 CTAAGGTAGGAAAATTGTACAGG + Intergenic
1178122487 21:29483067-29483089 CTTTGTTTTTAAAATTGTGCTGG - Intronic
1180488356 22:15820719-15820741 CCCTGGTTTTAAAATTGTGCCGG + Intergenic
1185311415 22:50157571-50157593 CGTTGGTTGAAAAACTGTCCTGG + Intronic
951259571 3:20491047-20491069 CTGTGCTTTTAAAATTCTCCTGG + Intergenic
957173509 3:76772141-76772163 CTTTGTTTGTAAAATAGTCCTGG + Intronic
960450452 3:117800417-117800439 CTATGGTTTAAAAATAGTGCTGG - Intergenic
960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG + Intronic
965877643 3:173347063-173347085 CCATGGTGGTAATATTGTCTTGG + Intergenic
966231533 3:177657667-177657689 CTATTTTTGTCAGATTGTCCTGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
969689265 4:8695158-8695180 CTCTGGTTGTGAAGTGGTCCAGG + Intergenic
972107387 4:35506389-35506411 CCATGGTTGTAAAATTATTGAGG + Intergenic
974304973 4:60124458-60124480 TTACGGTGATAAAATTGTCCTGG + Intergenic
975497241 4:75048267-75048289 CTCTGGTTGTAAAATACTTCTGG - Exonic
975767941 4:77688607-77688629 CTATGATTGTGAGATTGCCCTGG - Intergenic
977692714 4:99933590-99933612 CTATAGTTTAAAAATTGGCCAGG - Intronic
978700668 4:111640972-111640994 CTATATTTGTAAAATAGTCTGGG - Intergenic
983835877 4:172383585-172383607 CTTTGCTTGCATAATTGTCCTGG + Intronic
986924972 5:12735592-12735614 CTATGGTGATAAAATTCTTCAGG + Intergenic
989557198 5:42811400-42811422 CTAGTGTTGTAGAAATGTCCAGG - Intronic
995043100 5:107611405-107611427 CTATGTTTGTAAAATTCCACGGG + Intronic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
996911936 5:128666298-128666320 GTATGGGTGTCAAATTGACCTGG - Intronic
998736219 5:145144366-145144388 CTATGGTGGTCTAATTGTCTAGG + Intergenic
1003560826 6:7178364-7178386 CTGTTGTTCCAAAATTGTCCAGG + Intronic
1006192244 6:32216781-32216803 CCATGGTTGTACAATTGTGCAGG + Intronic
1008810991 6:55498727-55498749 CTATTGCTGTAAAATTGTTCTGG + Intronic
1009321131 6:62289867-62289889 CTATGTTTCCAAAATTGTCCTGG + Intergenic
1011065363 6:83320361-83320383 CTGTCGTTGTGAAATTGTCTTGG + Intronic
1012874111 6:104705645-104705667 CTATGAATGTCAAATTGCCCAGG + Intergenic
1013841669 6:114403344-114403366 CTAAGAGAGTAAAATTGTCCAGG + Intergenic
1015097579 6:129433826-129433848 CATTGGTTTGAAAATTGTCCTGG - Intronic
1015772973 6:136787696-136787718 CTTTGCCTGTAAAATTGACCAGG - Intronic
1015787601 6:136933770-136933792 CATTGGTTGTAACATTTTCCAGG - Intergenic
1017096654 6:150811039-150811061 CTATGGGTGTAAAGCTGTGCTGG + Intronic
1022734895 7:33066370-33066392 ATATGGCTCTAAAATTATCCCGG - Intergenic
1024248641 7:47489711-47489733 CTATTGTTGGAACAATGTCCAGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027653875 7:80904759-80904781 CTAGTGTTGTAAAACTGTCCAGG - Intronic
1028675004 7:93449369-93449391 CTATGTTGGTTAAATTGGCCAGG + Intronic
1028871769 7:95778231-95778253 CTGTGGTTGTAGAATTATTCGGG - Intronic
1031957310 7:127955538-127955560 CTTTGGTGGTAAAATTATCTAGG + Intronic
1032125640 7:129190444-129190466 GTATGATTCTAAAACTGTCCTGG + Intronic
1035290221 7:157833251-157833273 ATATGATTGTAAACTCGTCCAGG + Intronic
1035549235 8:507475-507497 GTATGGTTTAAAAAATGTCCTGG - Intronic
1035657858 8:1324534-1324556 CTCAGGATGTAAAACTGTCCAGG + Intergenic
1039698925 8:39942839-39942861 CTATGGTTGTATAATATTACAGG + Intronic
1046984111 8:120368766-120368788 GTATGAGTGTGAAATTGTCCTGG - Intronic
1050164519 9:2750085-2750107 GTATGGATTTAAAATTTTCCAGG - Intronic
1050402859 9:5274670-5274692 CTAAAGTTAAAAAATTGTCCAGG - Intergenic
1052142754 9:25007351-25007373 CTATTTCTGTAAAATTTTCCAGG - Intergenic
1052393128 9:27904722-27904744 CTATGCTTCTAAACTTGTACAGG + Intergenic
1057993302 9:99795966-99795988 CTATGTTTGTTTGATTGTCCTGG - Intergenic
1060021717 9:120137247-120137269 CTATGAGTCTAAATTTGTCCAGG - Intergenic
1188606223 X:32033760-32033782 TTATGATTGTATAATTGTCAAGG + Intronic
1188811533 X:34657746-34657768 CTCAGGATGTGAAATTGTCCGGG - Intergenic
1193202631 X:78710007-78710029 CTATGGTACTAGAATTCTCCGGG + Intergenic
1193984625 X:88225393-88225415 CTATGGGTGTCAAGTTGACCAGG + Intergenic
1200795509 Y:7337819-7337841 CTAAGGTTGTATAAGTATCCAGG - Intergenic