ID: 960862007

View in Genome Browser
Species Human (GRCh38)
Location 3:122164491-122164513
Sequence TCTCAGATGGGGCAGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960862007_960862017 16 Left 960862007 3:122164491-122164513 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 960862017 3:122164530-122164552 GCCCGGCAGCCACCCCATCTGGG 0: 236
1: 870
2: 3957
3: 4312
4: 3171
960862007_960862016 15 Left 960862007 3:122164491-122164513 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 960862016 3:122164529-122164551 CGCCCGGCAGCCACCCCATCTGG 0: 278
1: 1047
2: 1380
3: 2469
4: 3112
960862007_960862013 -1 Left 960862007 3:122164491-122164513 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 960862013 3:122164513-122164535 AAGTGAGGAGCCTCTCCGCCCGG 0: 275
1: 2694
2: 8362
3: 5948
4: 4283
960862007_960862020 24 Left 960862007 3:122164491-122164513 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 960862020 3:122164538-122164560 GCCACCCCATCTGGGAAGTGAGG 0: 532
1: 2666
2: 5168
3: 10303
4: 6855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960862007 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG (reversed) Intergenic
Too many off-targets to display for this crispr