ID: 960864368

View in Genome Browser
Species Human (GRCh38)
Location 3:122184570-122184592
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 610}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960864368_960864377 -5 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864377 3:122184588-122184610 GTGGCGGGGTCTGGGGGCCAAGG 0: 1
1: 0
2: 5
3: 64
4: 663
960864368_960864386 25 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864386 3:122184618-122184640 GCCGAACGAGGGGCACACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 33
960864368_960864382 13 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864382 3:122184606-122184628 CAAGGGCTCCGGGCCGAACGAGG 0: 1
1: 0
2: 0
3: 5
4: 43
960864368_960864379 2 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864379 3:122184595-122184617 GGTCTGGGGGCCAAGGGCTCCGG 0: 1
1: 0
2: 2
3: 52
4: 486
960864368_960864383 14 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864383 3:122184607-122184629 AAGGGCTCCGGGCCGAACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 28
960864368_960864380 3 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864380 3:122184596-122184618 GTCTGGGGGCCAAGGGCTCCGGG 0: 1
1: 0
2: 0
3: 44
4: 321
960864368_960864384 15 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864384 3:122184608-122184630 AGGGCTCCGGGCCGAACGAGGGG 0: 1
1: 0
2: 2
3: 3
4: 58
960864368_960864378 -4 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864378 3:122184589-122184611 TGGCGGGGTCTGGGGGCCAAGGG 0: 1
1: 0
2: 2
3: 43
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960864368 Original CRISPR GCCACGGCCCCTCCCCCACC AGG (reversed) Intronic