ID: 960864376

View in Genome Browser
Species Human (GRCh38)
Location 3:122184586-122184608
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960864376_960864384 -1 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864384 3:122184608-122184630 AGGGCTCCGGGCCGAACGAGGGG 0: 1
1: 0
2: 2
3: 3
4: 58
960864376_960864383 -2 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864383 3:122184607-122184629 AAGGGCTCCGGGCCGAACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 28
960864376_960864389 26 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864389 3:122184635-122184657 CGCCGGAGCAGCTCCAGCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 304
960864376_960864382 -3 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864382 3:122184606-122184628 CAAGGGCTCCGGGCCGAACGAGG 0: 1
1: 0
2: 0
3: 5
4: 43
960864376_960864388 25 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864388 3:122184634-122184656 ACGCCGGAGCAGCTCCAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 193
960864376_960864386 9 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864386 3:122184618-122184640 GCCGAACGAGGGGCACACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960864376 Original CRISPR TTGGCCCCCAGACCCCGCCA CGG (reversed) Intronic