ID: 960864377

View in Genome Browser
Species Human (GRCh38)
Location 3:122184588-122184610
Sequence GTGGCGGGGTCTGGGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 663}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960864352_960864377 29 Left 960864352 3:122184536-122184558 CCGGGGAACCCAAGGAGGGCGGG 0: 1
1: 0
2: 3
3: 30
4: 292
Right 960864377 3:122184588-122184610 GTGGCGGGGTCTGGGGGCCAAGG 0: 1
1: 0
2: 5
3: 64
4: 663
960864355_960864377 21 Left 960864355 3:122184544-122184566 CCCAAGGAGGGCGGGAGGAAAGC 0: 1
1: 0
2: 2
3: 16
4: 198
Right 960864377 3:122184588-122184610 GTGGCGGGGTCTGGGGGCCAAGG 0: 1
1: 0
2: 5
3: 64
4: 663
960864356_960864377 20 Left 960864356 3:122184545-122184567 CCAAGGAGGGCGGGAGGAAAGCG 0: 1
1: 0
2: 1
3: 23
4: 200
Right 960864377 3:122184588-122184610 GTGGCGGGGTCTGGGGGCCAAGG 0: 1
1: 0
2: 5
3: 64
4: 663
960864365_960864377 -3 Left 960864365 3:122184568-122184590 CCCCTGGTGGGGGAGGGGCCGTG 0: 1
1: 0
2: 3
3: 46
4: 399
Right 960864377 3:122184588-122184610 GTGGCGGGGTCTGGGGGCCAAGG 0: 1
1: 0
2: 5
3: 64
4: 663
960864368_960864377 -5 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864377 3:122184588-122184610 GTGGCGGGGTCTGGGGGCCAAGG 0: 1
1: 0
2: 5
3: 64
4: 663
960864366_960864377 -4 Left 960864366 3:122184569-122184591 CCCTGGTGGGGGAGGGGCCGTGG 0: 1
1: 0
2: 3
3: 101
4: 487
Right 960864377 3:122184588-122184610 GTGGCGGGGTCTGGGGGCCAAGG 0: 1
1: 0
2: 5
3: 64
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960864377 Original CRISPR GTGGCGGGGTCTGGGGGCCA AGG Intronic