ID: 960864382

View in Genome Browser
Species Human (GRCh38)
Location 3:122184606-122184628
Sequence CAAGGGCTCCGGGCCGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960864376_960864382 -3 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864382 3:122184606-122184628 CAAGGGCTCCGGGCCGAACGAGG 0: 1
1: 0
2: 0
3: 5
4: 43
960864368_960864382 13 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864382 3:122184606-122184628 CAAGGGCTCCGGGCCGAACGAGG 0: 1
1: 0
2: 0
3: 5
4: 43
960864365_960864382 15 Left 960864365 3:122184568-122184590 CCCCTGGTGGGGGAGGGGCCGTG 0: 1
1: 0
2: 3
3: 46
4: 399
Right 960864382 3:122184606-122184628 CAAGGGCTCCGGGCCGAACGAGG 0: 1
1: 0
2: 0
3: 5
4: 43
960864366_960864382 14 Left 960864366 3:122184569-122184591 CCCTGGTGGGGGAGGGGCCGTGG 0: 1
1: 0
2: 3
3: 101
4: 487
Right 960864382 3:122184606-122184628 CAAGGGCTCCGGGCCGAACGAGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960864382 Original CRISPR CAAGGGCTCCGGGCCGAACG AGG Intronic