ID: 960864384

View in Genome Browser
Species Human (GRCh38)
Location 3:122184608-122184630
Sequence AGGGCTCCGGGCCGAACGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960864368_960864384 15 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864384 3:122184608-122184630 AGGGCTCCGGGCCGAACGAGGGG 0: 1
1: 0
2: 2
3: 3
4: 58
960864365_960864384 17 Left 960864365 3:122184568-122184590 CCCCTGGTGGGGGAGGGGCCGTG 0: 1
1: 0
2: 3
3: 46
4: 399
Right 960864384 3:122184608-122184630 AGGGCTCCGGGCCGAACGAGGGG 0: 1
1: 0
2: 2
3: 3
4: 58
960864376_960864384 -1 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864384 3:122184608-122184630 AGGGCTCCGGGCCGAACGAGGGG 0: 1
1: 0
2: 2
3: 3
4: 58
960864366_960864384 16 Left 960864366 3:122184569-122184591 CCCTGGTGGGGGAGGGGCCGTGG 0: 1
1: 0
2: 3
3: 101
4: 487
Right 960864384 3:122184608-122184630 AGGGCTCCGGGCCGAACGAGGGG 0: 1
1: 0
2: 2
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960864384 Original CRISPR AGGGCTCCGGGCCGAACGAG GGG Intronic