ID: 960864386

View in Genome Browser
Species Human (GRCh38)
Location 3:122184618-122184640
Sequence GCCGAACGAGGGGCACACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960864381_960864386 -10 Left 960864381 3:122184605-122184627 CCAAGGGCTCCGGGCCGAACGAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 960864386 3:122184618-122184640 GCCGAACGAGGGGCACACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 33
960864368_960864386 25 Left 960864368 3:122184570-122184592 CCTGGTGGGGGAGGGGCCGTGGC 0: 1
1: 0
2: 3
3: 65
4: 610
Right 960864386 3:122184618-122184640 GCCGAACGAGGGGCACACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 33
960864376_960864386 9 Left 960864376 3:122184586-122184608 CCGTGGCGGGGTCTGGGGGCCAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 960864386 3:122184618-122184640 GCCGAACGAGGGGCACACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 33
960864365_960864386 27 Left 960864365 3:122184568-122184590 CCCCTGGTGGGGGAGGGGCCGTG 0: 1
1: 0
2: 3
3: 46
4: 399
Right 960864386 3:122184618-122184640 GCCGAACGAGGGGCACACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 33
960864366_960864386 26 Left 960864366 3:122184569-122184591 CCCTGGTGGGGGAGGGGCCGTGG 0: 1
1: 0
2: 3
3: 101
4: 487
Right 960864386 3:122184618-122184640 GCCGAACGAGGGGCACACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960864386 Original CRISPR GCCGAACGAGGGGCACACGC CGG Intronic