ID: 960868602

View in Genome Browser
Species Human (GRCh38)
Location 3:122227440-122227462
Sequence GCTGGCTGGCCCGCAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 2, 1: 3, 2: 16, 3: 38, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960868602_960868605 -7 Left 960868602 3:122227440-122227462 CCGGGGCTTGCGGGCCAGCCAGC 0: 2
1: 3
2: 16
3: 38
4: 262
Right 960868605 3:122227456-122227478 AGCCAGCTGCTCCAAGTGCAGGG 0: 1
1: 9
2: 34
3: 163
4: 680
960868602_960868604 -8 Left 960868602 3:122227440-122227462 CCGGGGCTTGCGGGCCAGCCAGC 0: 2
1: 3
2: 16
3: 38
4: 262
Right 960868604 3:122227455-122227477 CAGCCAGCTGCTCCAAGTGCAGG 0: 1
1: 21
2: 89
3: 403
4: 785
960868602_960868611 28 Left 960868602 3:122227440-122227462 CCGGGGCTTGCGGGCCAGCCAGC 0: 2
1: 3
2: 16
3: 38
4: 262
Right 960868611 3:122227491-122227513 CAGTCACCCAGAACTTGTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960868602 Original CRISPR GCTGGCTGGCCCGCAAGCCC CGG (reversed) Intronic
900156423 1:1205081-1205103 GCTGTCTGGCTCTCAGGCCCGGG - Intronic
900399323 1:2466575-2466597 GCAGGCAGGCACGCAGGCCCGGG - Intronic
901579274 1:10227322-10227344 CGTGCCTGGCCCACAAGCCCAGG + Intronic
901659326 1:10788816-10788838 GCTGGCTGGGCAGGAAGCCCTGG - Intronic
902192543 1:14773744-14773766 GATGGCAGCCCCGGAAGCCCAGG - Intronic
902580289 1:17403722-17403744 CCTGGCTGGCCTTGAAGCCCTGG - Intergenic
902776864 1:18680403-18680425 GCTGGCAGGCTGGCCAGCCCAGG + Intronic
903189908 1:21650731-21650753 GTTGGCTGGCCAGGAAGCTCAGG + Intronic
904256351 1:29257436-29257458 GTTGGCTGGCAGCCAAGCCCGGG + Intronic
904404204 1:30275419-30275441 TCTGGCTGGGCCTGAAGCCCGGG - Intergenic
904598042 1:31658936-31658958 CCTGGCTGGCCTGGAGGCCCTGG + Exonic
904676477 1:32201908-32201930 GCTGGCTGGGCCTCAGGCCTAGG - Exonic
905919739 1:41711449-41711471 ACTGTCTGGCCCCAAAGCCCAGG - Intronic
908445639 1:64196785-64196807 GCTGGCTGGACCCCAGGGCCTGG - Intergenic
909924509 1:81423346-81423368 GCTGGCAGGCAGGCATGCCCAGG + Intronic
910535401 1:88292091-88292113 GCTGGCTCCCCAGTAAGCCCTGG - Intergenic
911001446 1:93170364-93170386 GCCGGCCGGCCTGCAAGCCCTGG + Intronic
913321396 1:117591223-117591245 GCTGCCTGGCACACATGCCCAGG + Intergenic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
920260036 1:204683176-204683198 GCTGCCAGGCCCACCAGCCCAGG + Intronic
921046448 1:211481212-211481234 GCTGGCTGGCCAGCACACCCCGG - Exonic
922616034 1:226961666-226961688 GCTGGTGGGCCCTCAGGCCCTGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923623238 1:235594650-235594672 AGCGGCCGGCCCGCAAGCCCCGG - Intronic
924671277 1:246128637-246128659 TGGGGCTGGCCCTCAAGCCCAGG + Intronic
1063309317 10:4937646-4937668 GCCCCCCGGCCCGCAAGCCCCGG - Intronic
1063321055 10:5053364-5053386 GCTGGCCAGCCTGCAAGCCCAGG - Intronic
1063462079 10:6221428-6221450 GCTGGCTGGTCCACACGCGCAGG - Exonic
1063670743 10:8097739-8097761 GCTGGGTGGGTCGCAAGACCTGG + Intergenic
1064560794 10:16593867-16593889 GATGCTTGGCCCGAAAGCCCAGG + Intronic
1067069085 10:43119487-43119509 GCTGCCTGACCCGCACGCCCAGG + Intronic
1067183151 10:44005611-44005633 TCTCGCTGACCCGCATGCCCCGG + Intergenic
1067474905 10:46558486-46558508 GCTGGCTGGCCCTCACCCCAGGG + Intergenic
1069561818 10:69436012-69436034 CCTGGCAGGCCAGCAGGCCCAGG + Intergenic
1069918597 10:71802422-71802444 CCTGGCTGACCCCCCAGCCCAGG - Intronic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1073472633 10:103732550-103732572 ACTGGCTGGCCAGCAAGGGCAGG + Intronic
1074122705 10:110504978-110505000 GCTGTCTGACGCCCAAGCCCAGG + Intronic
1075717590 10:124566020-124566042 CCTGGGTGGCCCGCAAGGCCAGG + Intronic
1078561692 11:12377968-12377990 CCTCGATGGCCCGCGAGCCCCGG - Intronic
1079370428 11:19847507-19847529 CCTGGCTGGTCCCCAAGCTCAGG - Intronic
1079708684 11:23653413-23653435 GCCGGCCGGCCTGCAAACCCCGG - Intergenic
1079756818 11:24274504-24274526 ACCGGCCGGCCCACAAGCCCTGG - Intergenic
1081315193 11:41622972-41622994 GCTGGCCCGCCTGCAAGCCCCGG + Intergenic
1082284229 11:50301940-50301962 CCTGGCTGATCCTCAAGCCCTGG - Intergenic
1083916665 11:65749647-65749669 GCTGGCTTGACCCCAAGCCGGGG - Intergenic
1084176499 11:67424994-67425016 CCTGGCTGGGCCCCAAGCCTTGG + Exonic
1084593099 11:70101874-70101896 TCTGTCTGACCCCCAAGCCCCGG + Intronic
1085819720 11:79779551-79779573 GCTGTCTGCCCCCCAACCCCTGG - Intergenic
1086724638 11:90167285-90167307 GCCGGCCAGCCTGCAAGCCCGGG + Intronic
1089673262 11:120071906-120071928 GCTGGAAGGGCTGCAAGCCCCGG + Intergenic
1089966172 11:122656289-122656311 GCTGCCTGTCCCGCAGGCGCTGG - Intronic
1091680157 12:2521380-2521402 GCTGGCTAGCCAGCGATCCCAGG - Intronic
1092048041 12:5446578-5446600 CCTGGCTGTCCTGCAAGCCATGG - Intronic
1092609152 12:10153745-10153767 GCTGGCTGGGGCCAAAGCCCTGG - Intergenic
1093172345 12:15874725-15874747 GCTGGCCAGCCCACAAGCCCTGG + Intronic
1093743287 12:22712376-22712398 GCTGCCTGGCCCCAAAGCCTGGG - Intergenic
1094722050 12:33075442-33075464 GCCGGACGGCCCACAAGCCCGGG + Intergenic
1094807970 12:34109201-34109223 GCTGGCTGGACCGGGAGGCCAGG - Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095583407 12:43825331-43825353 GCTGGGTGGACCCCAAGCGCTGG + Intergenic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096492980 12:52023203-52023225 GCAGGCTGGCCTTCAAGGCCTGG + Intronic
1096673306 12:53213145-53213167 GCTGGCTGGGCCGCCGGCGCCGG + Exonic
1097043925 12:56173108-56173130 GCTGGGCGGCCCACAAGCTCTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1101539725 12:105653957-105653979 GCTGGCAGTCCCTCAAGCCCAGG + Intergenic
1102518071 12:113463390-113463412 GCTCGCCGGCCCGCACGCCGCGG - Exonic
1102534103 12:113568175-113568197 GCAGGCTGGCCATCAAGACCAGG + Intergenic
1102645805 12:114403190-114403212 GCTGGCTGGCGCGCCATCACCGG - Intronic
1102904010 12:116660822-116660844 GCCGGCCAGCCTGCAAGCCCCGG + Intergenic
1103561504 12:121795390-121795412 GCTGGCTGGCACACTAGGCCTGG + Intronic
1103590362 12:121987846-121987868 GCTGGCTGACCCCCAACTCCAGG + Intronic
1104458476 12:128934711-128934733 GCTGGCTCGCCAGCCTGCCCAGG - Intronic
1106180861 13:27368234-27368256 GTTGGCAGGGCAGCAAGCCCAGG - Intergenic
1108685468 13:52815482-52815504 GGCGGCCGGCCCACAAGCCCTGG - Intergenic
1113091047 13:106617909-106617931 GCTGGCTGGCAGTGAAGCCCCGG - Intergenic
1113460300 13:110478026-110478048 CCTGGCTGGCCCTTCAGCCCTGG - Exonic
1113657684 13:112078504-112078526 GCTCCCTGGCCCGCAGTCCCAGG - Intergenic
1113787240 13:113008909-113008931 GCTGCCTCGCCCACAAGACCTGG - Intronic
1113787257 13:113008964-113008986 GCCCGCCCGCCCGCAAGCCCTGG - Intronic
1115709724 14:36038247-36038269 GCTGGCTGTTCCACAACCCCAGG - Intergenic
1116426511 14:44798690-44798712 GCCGGCCGCCCCGCCAGCCCCGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1116900948 14:50362023-50362045 GCCCCCTGGCCCACAAGCCCCGG + Intronic
1118254876 14:64196908-64196930 GCTGGCTGGCTCGCAGGCACAGG - Intronic
1118932353 14:70254812-70254834 GCCGGCCAGCCCACAAGCCCAGG + Intergenic
1119159108 14:72438467-72438489 CATGGCTAGCACGCAAGCCCAGG + Intronic
1119303685 14:73590698-73590720 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1119480449 14:74954978-74955000 GCTGGCTGTCCCCCAGGTCCTGG - Intronic
1119614394 14:76089365-76089387 GCTGGCTGGCCAGCCCACCCAGG + Intergenic
1120229781 14:81829719-81829741 GCTGGCCGCCCCACCAGCCCCGG - Intergenic
1121127807 14:91418669-91418691 ACTGGCTGGAAGGCAAGCCCGGG + Intergenic
1121433814 14:93905832-93905854 GCAGGCAAGCCAGCAAGCCCTGG - Intergenic
1122067641 14:99184712-99184734 GCTGGCTTGCTGGCAATCCCAGG - Intronic
1122232724 14:100314898-100314920 GCTGGCAGGCCAGCAAGGACTGG - Intergenic
1122828741 14:104385079-104385101 GCTGGGAGGGCCTCAAGCCCAGG + Intergenic
1122882217 14:104695267-104695289 GCTGGCAGGCCCTCAGGCCCAGG + Intronic
1123039239 14:105483653-105483675 CCTGGCTGGCCTGCAGCCCCGGG + Intergenic
1123909678 15:24954921-24954943 GCAGGCTGGCGCGCATGCTCAGG + Intronic
1125300885 15:38252626-38252648 GCCGGCTGCCCCTCAACCCCCGG - Exonic
1125524843 15:40368323-40368345 GGTGGCTGGGCCGGAAGACCTGG - Exonic
1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1129704464 15:77786449-77786471 GCTGGATGGTCCCCAACCCCAGG + Intronic
1129850067 15:78788636-78788658 GCTGGCTGGCCCCCAGGCAGGGG - Intronic
1130076620 15:80695373-80695395 GCTGGCTGGCTGGCTGGCCCGGG - Exonic
1131250245 15:90825610-90825632 GCCGGCCAGCCCGCAAGCCCGGG + Intergenic
1132744438 16:1430843-1430865 GCTGGCTCGCCCCCGGGCCCCGG - Intergenic
1132787095 16:1663158-1663180 TCTGGCTGACCCACATGCCCTGG - Intronic
1133020051 16:2963345-2963367 GCTGGCCTCCCCCCAAGCCCTGG + Intergenic
1133038176 16:3046253-3046275 GCTGGCTGAGCCGAAGGCCCGGG + Intergenic
1133054961 16:3141351-3141373 GCTGGCTTGGCCGGAAACCCGGG + Exonic
1134123125 16:11598585-11598607 CCTGGCTGCACCGTAAGCCCCGG - Intronic
1138554676 16:57764563-57764585 GATGGCTGGCAGGCAGGCCCAGG - Intronic
1138560216 16:57796972-57796994 GCTACCTGGCCCAAAAGCCCAGG + Intronic
1139477644 16:67210652-67210674 CCTGGCTGGCCTGCGAGACCTGG - Exonic
1139676413 16:68526845-68526867 CCTGGCCAGCCCGCAAGCCCTGG + Intergenic
1140508703 16:75491974-75491996 TGTGCCTGGCCCCCAAGCCCTGG + Intronic
1141606881 16:85158859-85158881 GGTGGCTGGCACTCCAGCCCAGG - Intergenic
1142120269 16:88383456-88383478 GCTCGCTGCCCCGCACGTCCGGG - Intergenic
1142178859 16:88657557-88657579 GCTGCCTGGCCCGGAAGCGGAGG - Exonic
1142467494 17:144669-144691 GCTTACTGGCCAGCCAGCCCAGG - Intergenic
1143947401 17:10605350-10605372 GTTGGCTGTCCCGGGAGCCCTGG + Intergenic
1145060168 17:19728184-19728206 GCTGCCTGTCCTGCAAGGCCTGG + Intergenic
1146343443 17:32041453-32041475 ACTGGCTGTCCAGCATGCCCTGG - Intronic
1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG + Intergenic
1148153774 17:45411308-45411330 GCTGCCTGGCCCTTAAGCCTGGG - Intronic
1148736900 17:49870036-49870058 GCTGGCTGGGCCGCAGGCTCAGG + Intergenic
1148765935 17:50038200-50038222 GCTGGCTGGCCTGGAGGCCGGGG - Intergenic
1148896215 17:50840619-50840641 GCTGTCGGGCCTGCAAGCCTCGG + Exonic
1151679257 17:75615067-75615089 GCTGCCGGGCCCGGAGGCCCTGG - Intergenic
1151757238 17:76081940-76081962 GCTGGCTGGGCTGCTGGCCCGGG + Exonic
1152394732 17:80025548-80025570 GCAGGCGGGCCCCGAAGCCCAGG - Intronic
1152573594 17:81130824-81130846 CCTGGCCGGCCCCCAGGCCCAGG + Intronic
1153070364 18:1098322-1098344 GCTGGCCGGCCCGCCAGCCTCGG + Intergenic
1156610504 18:38718648-38718670 GCCCGCCAGCCCGCAAGCCCTGG - Intergenic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1157676577 18:49573059-49573081 GCTGGCTGGCAGGCAAGGCTGGG - Intronic
1159322214 18:66866802-66866824 GCGGGCCGGCCCGCAAGCCCGGG + Intergenic
1160975185 19:1789556-1789578 GCTGGCTGCACCGCCAGCCCAGG - Exonic
1161364768 19:3872031-3872053 GCTGGCCGGCCCGGAAGCTGGGG + Intergenic
1161772183 19:6236831-6236853 GGTGGCTGGCCAACCAGCCCAGG + Intronic
1162440043 19:10687239-10687261 GAAGGCTGACCCACAAGCCCGGG - Intronic
1163268389 19:16234758-16234780 GCTGGCTGGCTGGCAAGCGTTGG - Exonic
1163496572 19:17649404-17649426 CCTAGCTGGCCCCCAACCCCAGG + Intronic
1165021213 19:32925891-32925913 GCTGGCTGTCCAGAAAGCCATGG + Intronic
1165862283 19:38915616-38915638 GCAGGCTGGCCAGGCAGCCCAGG + Exonic
1167643627 19:50694853-50694875 GCGGGCCGGCCGGCAGGCCCCGG - Intronic
925318377 2:2942011-2942033 GCTGGCTGGCCTGGAAGTACAGG - Intergenic
926142140 2:10374028-10374050 GCTGGCTGGCCCTGGAGCTCGGG + Intronic
927705734 2:25295281-25295303 ACTGGCCAGCCCGCAGGCCCTGG + Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929298227 2:40272076-40272098 CCTGGCTGGCCCGGAACGCCTGG + Intronic
932191169 2:69742296-69742318 GCCGGCTTGCGGGCAAGCCCGGG + Intronic
932627364 2:73308347-73308369 GATGGCTGGCCCCCCAGCCTGGG + Intergenic
932771407 2:74502747-74502769 GCTTCCCGGCCCGCACGCCCGGG - Intronic
933060846 2:77735002-77735024 GCCGGCCGGCCCGCAAGCCCTGG - Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
934933936 2:98451190-98451212 GCTGGCTGGCTGGCAGGCCTGGG - Intronic
938190354 2:129274041-129274063 CCTGGCAGGCCAGCAAGCACAGG - Intergenic
938403752 2:131015767-131015789 CCTGGCTGGCCGGCAAGCTTTGG + Intronic
940112660 2:150171290-150171312 GCCGGCCGGCCCGGAAGCCCCGG - Intergenic
941686368 2:168452935-168452957 TCTGGCTGGCCCAGAAGGCCAGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942450853 2:176107329-176107351 GCTCGCTGGCGCGCACGCCGCGG + Exonic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
943520634 2:188944688-188944710 GCCGGCTGGCCCGCCAGCCTCGG - Intergenic
944197792 2:197073526-197073548 GCTGCCTGGCCAGCAAGTTCTGG + Intronic
944482793 2:200174880-200174902 GCCGGCCGGCCGGCAAGCCCGGG + Intergenic
945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG + Intergenic
945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG + Intergenic
945451497 2:210000836-210000858 GCCGGCTGGCCTGCTGGCCCCGG - Intergenic
946339338 2:219058067-219058089 GCTGGCTGGCCCTCCTGCCTTGG - Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948856868 2:240734319-240734341 GCTGGCTGGCCCGCTGCCCTTGG - Intronic
949027810 2:241774557-241774579 GCAGGCGGGCGGGCAAGCCCAGG - Intergenic
1171973443 20:31578824-31578846 GCTGGCCGGCCCGCCGCCCCAGG - Intergenic
1172446022 20:34993855-34993877 GCTAGCTGGCACGTCAGCCCAGG + Intronic
1173860237 20:46278253-46278275 GCTGAAGGGCCTGCAAGCCCAGG - Intronic
1175062775 20:56258841-56258863 ACTGGCTGGTCCACAAACCCTGG - Intergenic
1175270531 20:57730812-57730834 CCTGCCTCACCCGCAAGCCCCGG - Intergenic
1176381625 21:6116745-6116767 GCTGGCAGGCACGGAGGCCCCGG + Intronic
1177182404 21:17757850-17757872 GCGGGCTGGCAGGCCAGCCCGGG - Intergenic
1178264274 21:31127891-31127913 GGTGGCTGGGCCTAAAGCCCTGG + Intronic
1179150551 21:38805555-38805577 GCCGGCTGGCCCTGAGGCCCCGG - Exonic
1179741847 21:43421494-43421516 GCTGGCAGGCACGGAGGCCCCGG - Intronic
1179925532 21:44532080-44532102 GGCTGCTGGCCCCCAAGCCCTGG + Intronic
1180068615 21:45425048-45425070 ACTGACTGGCCCCCGAGCCCGGG - Intronic
1180799807 22:18626462-18626484 GCTGGCCTGGCCGCAAGCGCTGG - Intergenic
1181221908 22:21368804-21368826 GCTGGCCTGGCCGCAAGCGCTGG + Intergenic
1181637297 22:24180443-24180465 GCTGGCCTGGCCGCAAGCGCTGG + Intergenic
1181639959 22:24191124-24191146 GCTGCCCGTCCTGCAAGCCCTGG - Intergenic
1182338038 22:29598285-29598307 GCCGGCCCGCCGGCAAGCCCCGG - Intergenic
1183309726 22:37102912-37102934 GCTGGCTGGCTCACAAGAACTGG + Intronic
1184302676 22:43571609-43571631 GCTGGCTGGCTCGCTCGCTCAGG + Intronic
1184407026 22:44306100-44306122 GCTGGCTGGTCCCCAAGGCCTGG - Intronic
1185213863 22:49587468-49587490 GCTGGCTGGGCTGAGAGCCCTGG - Intronic
949558298 3:5178263-5178285 GTGGGGTGGCCCCCAAGCCCCGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
951429207 3:22586567-22586589 GCTGGTGAGCCCGCAAGGCCAGG - Intergenic
951909167 3:27731248-27731270 GCCGGCTGTCCCGCACCCCCCGG + Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953905986 3:46868492-46868514 GCGGGCTGGCAGGCAAACCCTGG + Intronic
956452240 3:69386162-69386184 GCTGGCGGGCACCCAATCCCAGG - Intronic
956468584 3:69542420-69542442 GCTGGCTGCCCAGAGAGCCCGGG - Intronic
956563624 3:70611953-70611975 GCTGGCTGGCCTGCCGGCCCCGG + Intergenic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960868602 3:122227440-122227462 GCTGGCTGGCCCGCAAGCCCCGG - Intronic
960872290 3:122261910-122261932 TCTGGCTGGCCAGCGAGGCCTGG + Exonic
961446172 3:126982836-126982858 GCGGGCTAGCCCGCGACCCCAGG - Intergenic
961465054 3:127076504-127076526 GCTGGCTGGCCCACAAGCCCCGG - Intergenic
961818007 3:129561255-129561277 GCTGCCAGGCCTGCGAGCCCGGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964037527 3:152217400-152217422 GCTGGCTGGCCCTGCCGCCCCGG + Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
966548972 3:181183250-181183272 GCTGGCTGGCTCACAAGCCCCGG - Intergenic
968583872 4:1406988-1407010 GCTCGCTGGCCCGCGCGCCCTGG - Intergenic
968671680 4:1855689-1855711 GCGGGCTGGGCCGCCAGCGCCGG - Intronic
969872801 4:10115455-10115477 TCTGGCTGGCCCAGAGGCCCGGG + Intronic
970108306 4:12609729-12609751 GCCGGCAGGCCTGCAAGCCCCGG + Intergenic
973146302 4:46831136-46831158 GCCGGCCGGCCTGCCAGCCCCGG + Intronic
977234949 4:94496715-94496737 GCAGACTGGAACGCAAGCCCAGG - Intronic
979445682 4:120808829-120808851 GCCGGCCAGCCCGCAAACCCTGG - Intronic
980827332 4:138088828-138088850 GCCGGCCAGCCCGCAAGCACCGG - Intergenic
980989924 4:139730547-139730569 GCTGGCTGCCCAGGAAGCCGGGG + Exonic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982720452 4:158854498-158854520 GGTGTCTGGGCTGCAAGCCCTGG + Intronic
984606630 4:181793186-181793208 GCTGGATCGCCGGCCAGCCCTGG - Intergenic
985145419 4:186890212-186890234 GCAGGCCGGCTCGCAAGTCCCGG + Intergenic
985565842 5:616763-616785 GCTGGCTGCTGCGCAAGGCCAGG + Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
992732884 5:79690081-79690103 GCTAGCTGCCCTGCAGGCCCTGG - Intronic
993662310 5:90653217-90653239 GCTAGCTGGCCCCCAGGACCTGG - Exonic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG + Intronic
997207324 5:132057365-132057387 GATGGCTGGCCGGCCAGCACAGG - Intergenic
997267089 5:132501253-132501275 GCTGTCTGCCCAGCAAGACCAGG + Intergenic
998054328 5:139061470-139061492 GCTGGCCATGCCGCAAGCCCTGG + Intronic
1000212352 5:159119271-159119293 GCGGGCCCGCCTGCAAGCCCTGG + Intergenic
1000889327 5:166784760-166784782 GCTGGCAGGCCCGCAAGCCCAGG - Intergenic
1001143577 5:169164924-169164946 GCTTGCTGGGCCTGAAGCCCAGG - Intronic
1001602743 5:172939643-172939665 GCAGTGTGGCCCACAAGCCCAGG - Intronic
1002074679 5:176701152-176701174 GCTGGCTGGCCCCAAGGGCCAGG - Intergenic
1002790740 6:435800-435822 GCCAGTTGGCCCGCAAGTCCCGG - Intergenic
1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG + Intergenic
1003284868 6:4725586-4725608 GCAGGTCCGCCCGCAAGCCCCGG - Intronic
1003489235 6:6606691-6606713 GCAGGTCCGCCCGCAAGCCCCGG - Intronic
1003506686 6:6745937-6745959 GCGGACCGGCCCGCAAGCCCCGG - Intergenic
1003836219 6:10074928-10074950 GCCGGCCGGCAGGCAAGCCCCGG - Intronic
1004234333 6:13860520-13860542 GATCGCGGGCCCGCAAGCCGCGG + Intergenic
1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1004338227 6:14783826-14783848 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1004914437 6:20319017-20319039 GCTGGCATACCTGCAAGCCCCGG + Intergenic
1006089975 6:31622711-31622733 GCTGTCTGGCCCACAGGCTCTGG + Exonic
1006127954 6:31852154-31852176 GCAGGCTGGCCCACAAGCCCCGG + Intergenic
1006174575 6:32114230-32114252 GCTGCCTGGGCCATAAGCCCAGG - Intronic
1010277957 6:73990888-73990910 GCGGGCCAGCCCGCAAGCCCCGG - Intergenic
1012733545 6:102910904-102910926 GCCGGCGGGCCCGCAAGCCCGGG - Intergenic
1016104745 6:140148383-140148405 GCTGGCCCGCCCGCAAGCCCCGG - Intergenic
1018033011 6:159858543-159858565 GCAGGCTGGCCCTCGGGCCCTGG + Intergenic
1018716248 6:166534835-166534857 GCTGCCTGACTCGCAAGCACAGG + Intronic
1019268711 7:133906-133928 GGGGGGTGGTCCGCAAGCCCAGG + Intergenic
1019279115 7:191495-191517 GCAGCCTCGCCAGCAAGCCCAGG - Intergenic
1019622977 7:2001633-2001655 GCTGAGTGGCGCCCAAGCCCCGG + Intronic
1020418244 7:7969560-7969582 GCTGGCTGCCCCGCAAGAGCTGG - Exonic
1021452766 7:20798037-20798059 GCTCGCCGGCCCGCAAGGCCCGG + Intergenic
1022443577 7:30452465-30452487 GCAGGTTGGCCAGCAAGACCAGG + Exonic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1024243530 7:47453211-47453233 GCAGGCTGGCCCTCAGCCCCGGG - Intronic
1025187276 7:56871088-56871110 TCTGGCTGATCCTCAAGCCCTGG + Intergenic
1025188693 7:56880897-56880919 CCTGGCTGATCCTCAAGCCCTGG + Intergenic
1025684649 7:63705832-63705854 TCTGGCTGATCCTCAAGCCCTGG - Intergenic
1026681137 7:72467436-72467458 GCTGGCTGGCCCAGGAGTCCTGG - Intergenic
1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG + Intergenic
1031966736 7:128032373-128032395 GCTCGCTCGCCCGCTCGCCCTGG - Intronic
1034253824 7:149713979-149714001 GCTGTCTGGGCCGCAAGGTCTGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035452366 7:158985724-158985746 GCTGGCTGGCCCCCAAGCTAAGG - Intergenic
1035833902 8:2727933-2727955 GCAGGCCGGCCCGCAAGCCCCGG + Intergenic
1036785082 8:11680558-11680580 GCTGGTGGGCCAGGAAGCCCAGG + Intronic
1036808395 8:11850833-11850855 GCTGGCTGGCGGGGAAGCGCTGG - Intronic
1038533782 8:28339387-28339409 GCTGGCTGGACTGCATGCTCAGG - Exonic
1042942849 8:74125072-74125094 GCTGGCTGTCCCTCAGGCCTTGG - Intergenic
1043705726 8:83347571-83347593 GCTAGCTGGCCTCCAAGCCCTGG + Intergenic
1044853550 8:96452364-96452386 TCTTGCTGGCCAGCAAGCGCCGG - Intergenic
1048524246 8:135186844-135186866 GCTCACCTGCCCGCAAGCCCAGG + Intergenic
1049595218 8:143480300-143480322 GCTCCCGGGCCTGCAAGCCCTGG + Intronic
1049679435 8:143911137-143911159 GCTGGCTGAGCCCCAGGCCCAGG + Intergenic
1049857925 8:144875268-144875290 GCTGGCCGGCCTGCAAGCCCTGG + Intergenic
1050358299 9:4804161-4804183 GCTGGGTGGCACAGAAGCCCAGG + Intronic
1051419721 9:16877316-16877338 GCCAGCAGGCCAGCAAGCCCCGG - Intergenic
1053153409 9:35757023-35757045 GGTGGCTGGCGCGCAGGTCCCGG + Exonic
1053475233 9:38377674-38377696 GCCCCGTGGCCCGCAAGCCCCGG + Intergenic
1059405820 9:114098057-114098079 GCTGGGTGGGCTGGAAGCCCTGG - Intronic
1060479677 9:124011034-124011056 GCTGGCTGGCCCCCCTCCCCGGG + Intronic
1060736834 9:126071423-126071445 GCTGGCTGGCCCCTAAGTTCAGG - Intergenic
1060992789 9:127858246-127858268 CCTGGCTGGCCAGGAAGGCCAGG + Intergenic
1061262091 9:129486091-129486113 GCAGCCTGGCCCGCCAGCTCTGG - Intergenic
1061857438 9:133449912-133449934 GCTGCCTCGCCCGGAACCCCAGG + Exonic
1061953620 9:133950133-133950155 TCTGGCTGCCCAGCAACCCCTGG + Intronic
1062227272 9:135459959-135459981 CCTGGCTGGCTGGGAAGCCCAGG + Intergenic
1062270014 9:135704054-135704076 CCTGCCTGGGCCGCAAGCCTTGG - Intronic
1062418102 9:136463790-136463812 GCTGGCAGGCCGGCCAACCCAGG + Intronic
1186480690 X:9894646-9894668 GCAGGGTGGCCGGCAGGCCCAGG + Exonic
1187447838 X:19373759-19373781 CCTGGCAGCCCCTCAAGCCCAGG + Intronic
1188242549 X:27809236-27809258 GCTGGCAGGCCCCCCGGCCCAGG + Intronic
1189332670 X:40153124-40153146 GCAGGCTGGCCCGGAATCGCAGG + Intronic
1191791489 X:64976521-64976543 CCTGGCTGGCCCTGAAGCTCCGG - Intronic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1194890496 X:99372299-99372321 GCAGGCCGGCCCGCAAGCCCCGG - Intergenic
1197533790 X:127663233-127663255 GCCGGCCTGCCCACAAGCCCCGG - Intergenic
1197607910 X:128606702-128606724 GCCGGCGGGCCCGCCAGCCCTGG + Intergenic
1198210299 X:134509931-134509953 GCTGGCTCCCCAGCAGGCCCCGG + Intronic
1199285109 X:146046419-146046441 GCCGGCGGGCCCGCAGGCCCCGG - Intergenic
1200108472 X:153726890-153726912 CCTGTCTGGCCCGCCGGCCCCGG - Intronic
1200443481 Y:3236902-3236924 GCTGGCTGGTCCACTAGTCCTGG + Intergenic
1201469098 Y:14314588-14314610 GCCGACTGGCCCACAAGCCCCGG + Intergenic