ID: 960868791

View in Genome Browser
Species Human (GRCh38)
Location 3:122229011-122229033
Sequence ATCTGATGCTCAGATTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960868789_960868791 -6 Left 960868789 3:122228994-122229016 CCATCTTATTATAAATGATCTGA 0: 1
1: 0
2: 0
3: 23
4: 307
Right 960868791 3:122229011-122229033 ATCTGATGCTCAGATTCTTAGGG 0: 1
1: 0
2: 0
3: 13
4: 240
960868788_960868791 23 Left 960868788 3:122228965-122228987 CCTTTCAGGACTTCTCAATCATG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 960868791 3:122229011-122229033 ATCTGATGCTCAGATTCTTAGGG 0: 1
1: 0
2: 0
3: 13
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960868791 Original CRISPR ATCTGATGCTCAGATTCTTA GGG Intronic
900716280 1:4147006-4147028 ATTTGATCTTCAGATTCATAGGG - Intergenic
904217867 1:28938198-28938220 AACTGATGCTAAAATTCATATGG - Intronic
904575281 1:31501471-31501493 ATCTGCTGGGCAGATTCTTCTGG - Intergenic
906287825 1:44599115-44599137 AGCTGATGCTGAGCTTCTTGAGG - Intronic
909281389 1:73758914-73758936 ATCTGGTGTTAAGATTATTATGG + Intergenic
909375522 1:74937280-74937302 ATATTATGCTCAGATTCTCTTGG + Intergenic
909704894 1:78569698-78569720 AACTGTGGCTCAAATTCTTAAGG - Intergenic
913481369 1:119292661-119292683 AACTGATGCTCAGATTGCTTAGG + Intergenic
915046815 1:153024279-153024301 ATCTGGTGGTCAGCTTCTCAAGG - Intergenic
915047781 1:153033005-153033027 ATCTGATGCTCACATTAGGAGGG + Intergenic
915864390 1:159483249-159483271 AACTGATGCTGAAATTCTCATGG + Intergenic
916585541 1:166146677-166146699 AGCTGATGCTCAAATTCAGAAGG + Intronic
917027130 1:170656674-170656696 ACCTTATGCTCAGATTCTTCTGG - Intergenic
917322214 1:173795221-173795243 AGCTGATCCTAAAATTCTTATGG + Intergenic
918719956 1:187840199-187840221 CTCTGATCCTCGAATTCTTAGGG + Intergenic
919151371 1:193704326-193704348 ATCTGACCCTCATATACTTATGG + Intergenic
919587137 1:199452744-199452766 ATCTGTTGCCCAGATTGTTCAGG - Intergenic
921910345 1:220542063-220542085 ATCCAATGCTCTGATTTTTAGGG - Intronic
922057190 1:222052536-222052558 GTCTGATGCTCAGTTTCTAGTGG + Intergenic
922630694 1:227107048-227107070 AGCTGATCCTCAAATTCATATGG - Intronic
922938752 1:229442644-229442666 ATCTGATTTTGAGAATCTTATGG - Intronic
1064609207 10:17079735-17079757 ACCTGCTGCTCAGAGTCTCATGG - Intronic
1065380794 10:25087966-25087988 ATGTTATGCCCAGATTCTTATGG - Intergenic
1066349033 10:34619640-34619662 CTGTGATGCTCACATTGTTATGG + Intronic
1067161401 10:43827859-43827881 ATCTGAAGCTAAGAGTCTCAAGG - Intergenic
1068005482 10:51388515-51388537 TTCTGATTCTCATATTCATAGGG - Intronic
1068931244 10:62592709-62592731 TTCTGAGACCCAGATTCTTAGGG + Intronic
1070014177 10:72508776-72508798 TTCTGAAGCTAAGATTCTTGGGG - Intronic
1071116727 10:82230282-82230304 CACTGATGCTCAGGTTCTTTGGG + Intronic
1071257445 10:83884263-83884285 TTCTGATTCTAAGATTCTAAGGG - Intergenic
1073389315 10:103159905-103159927 AGCTGATCCTAAGATTCATATGG + Intronic
1076229176 10:128806095-128806117 ATCTGATGCTCAGCTTGTCTGGG - Intergenic
1076812595 10:132896760-132896782 AACTGATCCTCAAATTCATATGG + Intronic
1077403772 11:2372954-2372976 AGCTGATCCTCAAATTCATAAGG - Intergenic
1077608390 11:3627579-3627601 ATGAGATGCTGAGATTCTAAAGG - Intergenic
1079077001 11:17390232-17390254 GTCTGTGGCTCAGATCCTTATGG + Intergenic
1079482929 11:20901592-20901614 AGCTGATGCTAAAATTTTTAGGG + Intronic
1079487670 11:20952399-20952421 ATTTGATGCCAAGACTCTTAGGG - Intronic
1079509412 11:21193820-21193842 ATCTGATTTTTAGATTCCTAGGG + Intronic
1082213498 11:49536107-49536129 ATCTGATGCTCAGATGCTCCAGG - Intergenic
1084790018 11:71469074-71469096 ATTTCCTGTTCAGATTCTTATGG - Intronic
1085831953 11:79910954-79910976 ATCAGATGGTGAGCTTCTTAAGG + Intergenic
1085906142 11:80765483-80765505 ATCTGAGGCTCAGAAACGTATGG - Intergenic
1086636110 11:89088326-89088348 ATTTGATGCTCAGATGCTCCAGG + Intergenic
1087519916 11:99218886-99218908 TTCTGATGCTTAGATTATGAAGG + Intronic
1088275586 11:108081958-108081980 AGCTGATTCTCAAATTCATATGG - Intronic
1088702176 11:112423126-112423148 ATCTGAGGCTCAGACTTTTGAGG + Intergenic
1096301639 12:50433612-50433634 GTCTTATTTTCAGATTCTTAAGG + Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1097222712 12:57460257-57460279 AGGGGATGCTCAGCTTCTTAGGG + Intronic
1097397733 12:59096304-59096326 ATCTTTTGCTCAGATTTCTAAGG - Intergenic
1097681050 12:62649324-62649346 ATCTTATTTTCAAATTCTTAAGG - Intronic
1099280203 12:80634364-80634386 ATTTGATTCTCAGATTCATGTGG + Intronic
1100905720 12:99296315-99296337 AACTGATCCTCACATTCATATGG - Intronic
1102316963 12:111896251-111896273 AACTGATGCTCAGAGTCAAAGGG - Intronic
1105337537 13:19487464-19487486 ATCAGCTGCTCAGAGGCTTAGGG + Intronic
1105911135 13:24868957-24868979 ATCTGATATTTAGATTTTTAAGG + Intronic
1108632815 13:52302867-52302889 ATCAGCTGCTCAGAGGCTTAGGG + Intergenic
1108653883 13:52509730-52509752 ATCAGCTGCTCAGAGGCTTAGGG - Intergenic
1111517475 13:89353671-89353693 ATCTGATGATCAGATACCAAAGG + Intergenic
1111845601 13:93504833-93504855 TTCTGATGCTCAGTTTCCTGAGG - Intronic
1113077406 13:106480745-106480767 ATCTGATGAACAGTTTCTAAAGG - Intergenic
1113370571 13:109721524-109721546 ATGTTATGCTCAGATTGTAAGGG + Intergenic
1114143037 14:19938587-19938609 ATCTGATGCTAAGATTTTGATGG - Intergenic
1114353757 14:21884326-21884348 ATCTTATGCACAGATTATGATGG - Intergenic
1115419518 14:33177995-33178017 AGCTGATACTCAAATTCATATGG - Intronic
1115606036 14:35003186-35003208 TTCTTATACTCAGATGCTTATGG + Intronic
1117562187 14:56951985-56952007 ATCTGATGATCAGATCATCAGGG - Intergenic
1117600787 14:57372292-57372314 TTCAGATTCCCAGATTCTTAAGG + Intergenic
1118016353 14:61664996-61665018 ATCTGATGACCTGATTTTTAAGG - Intergenic
1118503965 14:66390428-66390450 TTCTACTGCTCAGATACTTAGGG + Intergenic
1118610902 14:67538954-67538976 AGCTGCTGCTCAGATTCTATTGG - Intronic
1119404335 14:74387774-74387796 AGCTTATCCTCAGATTTTTATGG + Intergenic
1120833535 14:89019886-89019908 AGCTGATACTAAAATTCTTAAGG - Intergenic
1120861223 14:89256558-89256580 ATCAGAGGCTCAGCTTCTTACGG - Intronic
1121181447 14:91932109-91932131 ATCTGGTGACCAGATTCTCAGGG - Intronic
1122948691 14:105028143-105028165 AACTGATTCTCACATTTTTATGG + Intergenic
1123687922 15:22812800-22812822 ATCTGATGCTCTCATTCTCCTGG + Intronic
1124393345 15:29279319-29279341 AGCTGATTCTCAAATTCATATGG - Intronic
1124988515 15:34647176-34647198 ATGTGAAGCTGAGATTGTTAGGG + Intergenic
1126324275 15:47459343-47459365 ATCTGATGCCCAGATCATTCAGG - Intronic
1128531945 15:68459557-68459579 AGCTGATTCTCAGATTTATATGG + Intergenic
1128626296 15:69208620-69208642 AGCTGATGCCAAGATTATTATGG - Intronic
1131086348 15:89578790-89578812 ATCTGATGGGCATTTTCTTAGGG - Intronic
1133083290 16:3340948-3340970 AGCTGATCTTCAGATTCATAAGG - Intergenic
1138941836 16:61800910-61800932 ATCTGATGTTCAAATATTTATGG - Intronic
1139235497 16:65334215-65334237 TGCTGATGCTCATATTTTTATGG - Intergenic
1144887875 17:18476368-18476390 AGCTGAGGCTCAGAGTCTGAGGG - Intergenic
1145144338 17:20467933-20467955 AGCTGAGGCTCAGAGTCTGAGGG + Intergenic
1145175789 17:20699336-20699358 AGCTGAGGCTCAGAGTCTAAGGG + Intergenic
1145791528 17:27630779-27630801 AGCTGAGGCTCAGAGTCTAAGGG - Exonic
1147128450 17:38390407-38390429 ATCTGATCCTAAAATTCATATGG - Intronic
1149208744 17:54279272-54279294 ATCTGATCCTTAGATTCTCTAGG + Intergenic
1149649234 17:58266404-58266426 ATCAGATGATCAGATCCTCAGGG - Intronic
1151220937 17:72612546-72612568 CTCTGATGCTCAGATGATGATGG + Intergenic
1152150735 17:78598891-78598913 ATCTGATTCTAAGATTGCTATGG - Intergenic
1158184102 18:54751779-54751801 ATGCGATGCTCAATTTCTTATGG - Intronic
1158869161 18:61667571-61667593 TTCTGTAGCTCAGATTCTCATGG - Intergenic
1159474824 18:68907297-68907319 AGCTGATTCTCAAATTCATATGG - Intronic
1160431446 18:78815726-78815748 CTCTGATGCTCGGACACTTATGG + Intergenic
1160570204 18:79811222-79811244 AGCTGATGCTAAAATTCATATGG + Intergenic
1167264824 19:48478301-48478323 CTCGGATGCTCAGATTCTCCAGG - Exonic
926576541 2:14588628-14588650 ATGAGATGGTCAGATTGTTAAGG - Intergenic
926698572 2:15787542-15787564 AGATGATGCTAAGATTCTAAGGG + Intergenic
927350108 2:22101090-22101112 ATCTGACGTTTAGATTCTTTTGG - Intergenic
929019743 2:37539814-37539836 TTCTGATTCTCAGCTTATTATGG + Intergenic
930049065 2:47199908-47199930 ATCTGATTCTCATCTTCTTTGGG - Intergenic
933910393 2:86935558-86935580 TTCTGATACTCATATTCTAAGGG + Intronic
934022334 2:87967851-87967873 TTCTGATACTCATATTCTAAGGG - Intergenic
936413956 2:112287159-112287181 TTCTGATACTCATATTCTAAGGG + Intronic
938220080 2:129558796-129558818 ATCTGATGCCCAGGTTGCTAAGG - Intergenic
939331085 2:140762011-140762033 ATCTGAGACTCAGATAGTTAGGG - Intronic
941828544 2:169927324-169927346 GTCTGATGATGAGATTCTCAGGG + Exonic
942858092 2:180576207-180576229 AACTCATGCTCAAATTCATATGG - Intergenic
944772318 2:202926595-202926617 ATCTGATCCTAAAATTCATACGG - Intronic
947045801 2:225982089-225982111 CTCTGATCCTCAAATTCTTGGGG - Intergenic
947885934 2:233571248-233571270 AACTGATTCTAAAATTCTTATGG + Intergenic
1171380512 20:24730810-24730832 CTCCAATGCTCAGATTCTTCAGG - Intergenic
1172530516 20:35627660-35627682 ATCTGATGCTCAAACTCTCCTGG - Intronic
1172773272 20:37393613-37393635 ATCTGAGGCTCAAATCCATAGGG - Intronic
1173560216 20:43999720-43999742 ATCTGATCCTCAAATTCATATGG + Intronic
1176667033 21:9697186-9697208 ATCTGAACCTCAGAGACTTAAGG - Intergenic
1176736038 21:10547928-10547950 ATCAGCTGCTCAGAGGCTTAGGG - Intronic
1177924412 21:27196163-27196185 ATCTGATTCTAAAATTCATATGG + Intergenic
1178090500 21:29158060-29158082 ATCTGATGTGTAGAGTCTTAGGG + Intronic
1181864285 22:25843083-25843105 AACTGATGCTCAGAGACTTACGG + Intronic
1182724284 22:32430193-32430215 ATCAGATGGTCAGAGTCTGAAGG + Intronic
1183533115 22:38374943-38374965 ATCAGCTGCTCAGAGGCTTAGGG + Intronic
951477882 3:23127597-23127619 GTCTTCTGCTGAGATTCTTAAGG + Intergenic
953550204 3:43896198-43896220 AACTGAGGCTCAGAGACTTAAGG + Intergenic
957159208 3:76586907-76586929 AGCTGATGCTCAGATGGTCAGGG + Intronic
957641372 3:82857841-82857863 ATCTTATGTTCTGATTCCTATGG - Intergenic
960340071 3:116463874-116463896 ATCTCATCTTCAAATTCTTAGGG + Intronic
960559812 3:119071826-119071848 AGCTGATTCTCAAATTCATATGG - Intronic
960868791 3:122229011-122229033 ATCTGATGCTCAGATTCTTAGGG + Intronic
961392828 3:126565841-126565863 AGCTGATCCTCAAATTCGTATGG + Intergenic
961670944 3:128529580-128529602 ATCTGGTTCTAAGATTCATATGG - Intergenic
962062676 3:131947184-131947206 AACTGATCCTCAAATTCATATGG - Intronic
963815183 3:149822141-149822163 AGCTGATTCTCAAATTCATATGG - Intronic
964291103 3:155181095-155181117 GACTGATGCTGAGATTCTTCAGG + Exonic
965800301 3:172485671-172485693 ACATGATGCTCAAATTCATATGG - Intergenic
965875156 3:173308297-173308319 ATCTCATGCTCACATTCATCAGG - Intergenic
965908304 3:173738736-173738758 ATCTGATCCTAAAATTCATATGG - Intronic
965989385 3:174798425-174798447 AGCTGATGCTGAAATTCATATGG - Intronic
966090214 3:176125210-176125232 AGCTGATCCTAAAATTCTTATGG - Intergenic
967995225 3:195161210-195161232 ACCTGATGCTCAGAGACTTTCGG + Intronic
971530357 4:27680180-27680202 ATGTGATGCTCTGACTCTGATGG + Intergenic
976683904 4:87789054-87789076 TTCTGATGTTCACATTCTCAGGG - Intergenic
977215111 4:94273191-94273213 ATCTCATGATTATATTCTTAAGG + Intronic
977320946 4:95515338-95515360 AACTGAGGCTCAGAATGTTAAGG + Intronic
977370038 4:96124132-96124154 AGAAGATGTTCAGATTCTTATGG + Intergenic
977862408 4:101979641-101979663 TTTTGATTCTCACATTCTTAAGG + Intronic
978130756 4:105193776-105193798 ATCAGATGCAGATATTCTTAAGG + Intronic
978583030 4:110251052-110251074 GTCTGAGGCTCAAATGCTTAGGG + Intergenic
978765556 4:112401627-112401649 TTCTGATGCCCAGGTTGTTATGG - Intronic
979827779 4:125260641-125260663 ATCTGATTATCACATTATTAGGG - Intergenic
981800521 4:148650005-148650027 AGCTTATGCTTAGATTCTCATGG - Intergenic
982611543 4:157580411-157580433 ATCTGCTGCTCATATGCTAATGG + Intergenic
983994933 4:174170457-174170479 ATCTCATCCTGGGATTCTTAAGG - Intergenic
984070912 4:175110515-175110537 ATCAGATGCACAGATTATCAAGG + Intergenic
985407980 4:189655151-189655173 ATCTGAACCTCAGAGACTTAAGG + Intergenic
985728936 5:1534603-1534625 AACTGATTCTAAGATTCATATGG - Intergenic
986773312 5:10992966-10992988 ATACGATGCTCAGAATGTTAGGG + Intronic
987248984 5:16079669-16079691 ATGTGATGCTCAGCTGCTGAGGG - Intronic
992983030 5:82196889-82196911 AACTGATGCTAAGATTCATATGG - Intronic
993450989 5:88071901-88071923 ATCTGATGATTAGAGTCTTGGGG - Intergenic
993654195 5:90558234-90558256 AATTTATGCTCAAATTCTTATGG + Intronic
994287014 5:97981512-97981534 ACCTGAAGATCAAATTCTTATGG + Intergenic
996208452 5:120774094-120774116 ATCAGTTTCTCAGTTTCTTAAGG + Intergenic
998812409 5:145979308-145979330 CACTGATTCTCAGATTTTTAGGG - Intronic
999139409 5:149348004-149348026 AACTGATGCTGAGAGGCTTAAGG - Intronic
999235529 5:150089691-150089713 AGCTGATTCTCAAATTCATATGG + Intronic
999533948 5:152496074-152496096 ATCAGAAGCTCAGAGGCTTATGG - Intergenic
999964552 5:156795145-156795167 CCCTGATGCTCAGTTTGTTATGG - Intergenic
1000038509 5:157467211-157467233 ATCTGAGGCCCAGATTCCCAGGG + Intronic
1000427043 5:161103566-161103588 ATCTGAAACTCAAATTCTCATGG - Intergenic
1002905215 6:1442955-1442977 CTCTGAGCCTCAGATTCTTCAGG + Intergenic
1008364606 6:50662825-50662847 ATCTGATGCTCTGAATATTTTGG - Intergenic
1008762573 6:54870575-54870597 ATGTGATGCCCGGACTCTTAGGG + Exonic
1010521209 6:76839834-76839856 ATCTGATACTTAGAATTTTACGG - Intergenic
1010549584 6:77204740-77204762 ATCTGATTTTCAGCTTCTCAGGG + Intergenic
1010764794 6:79766725-79766747 AGCTGATTCTCAAATTCATATGG + Intergenic
1011131238 6:84053772-84053794 AACTGAAGCTCAGATTTTTCAGG + Intronic
1013017249 6:106171069-106171091 ATTTGTTGCTCAGATTGTTCTGG - Intergenic
1013976108 6:116080676-116080698 ATCTCTTGCTCATTTTCTTATGG - Intergenic
1016080187 6:139846067-139846089 ATTTGATGATCAGATTTTTGGGG + Intergenic
1018697955 6:166405424-166405446 ATCTGCTGCTCAGATCTCTAGGG - Intergenic
1018935267 6:168269872-168269894 CACTGATGCTCACATTCTTAAGG - Intergenic
1019105007 6:169660550-169660572 ATCTCATCCTCAGATTCACACGG + Intronic
1019232730 6:170582215-170582237 GTCAGATGCTCACAGTCTTATGG - Intronic
1022670487 7:32450781-32450803 ACCTTATGATCAGATTCTTCGGG - Intergenic
1023273936 7:38497764-38497786 ATCTTTTTCTTAGATTCTTAAGG + Intronic
1023694741 7:42833466-42833488 ATGTGATGCCCAGTATCTTAGGG - Intergenic
1025919288 7:65895708-65895730 ATCTGATGCTCAAATTGGTTTGG - Intronic
1029094505 7:98074301-98074323 TTCTGATGCTCAGATCTTGAGGG + Intergenic
1029097494 7:98100414-98100436 AGCTGATCCTAAGATTCATATGG - Intergenic
1029134090 7:98356191-98356213 ATCTGTCACTCACATTCTTAGGG - Intronic
1030111077 7:106027422-106027444 ATTTGATTCCCAGATTCTAATGG + Intronic
1030598359 7:111565088-111565110 ATATGAAGCACAGATTTTTAGGG + Intergenic
1031678453 7:124640410-124640432 ATCTTCTGCTCAGCTTCTGATGG + Intergenic
1032731861 7:134650942-134650964 ATCTGGGGCTCAGTTCCTTAAGG - Intronic
1033472296 7:141661080-141661102 ATCTCAAGATAAGATTCTTAGGG - Exonic
1034704877 7:153132282-153132304 ATCTGATTCTAAAATTCATATGG - Intergenic
1035984578 8:4412652-4412674 TTCTGATGCTAAGATTTTCAGGG + Intronic
1037776912 8:21841556-21841578 ATCTGATGATGAGATTCCTAGGG - Intergenic
1038134764 8:24773356-24773378 ATCTCATGCATAGACTCTTAAGG - Intergenic
1039155510 8:34552275-34552297 ATCTAATATTCAGATTCTTCAGG - Intergenic
1042901096 8:73728428-73728450 AGCTGATCCTCATATTCATATGG - Intronic
1043037589 8:75217496-75217518 ATCTAGTGCTCACATTATTATGG - Intergenic
1043108219 8:76142310-76142332 TTCTGGTGCTCAAATTCATATGG + Intergenic
1044437380 8:92180008-92180030 ATCTGGAGCACAGATTTTTAGGG - Intergenic
1044747656 8:95386309-95386331 ATCTGGAGCTAAGATTTTTATGG + Intergenic
1046083612 8:109403622-109403644 AGCTGATGAGCAGGTTCTTATGG + Intronic
1047786343 8:128157243-128157265 ATCATATGCTCAGATACTTCTGG - Intergenic
1048309008 8:133303901-133303923 ATCTGCTGCTAAGATTATGAGGG + Intergenic
1049078471 8:140420362-140420384 ATCTGATCCTAAAATTCATACGG + Intronic
1051175215 9:14353478-14353500 TCCTCATGCTCAGATTCTCAGGG - Intronic
1051968333 9:22857004-22857026 ATTAGATGCTCATATTATTATGG - Intergenic
1053476235 9:38383949-38383971 ATCTGATAATCTGATTCTAAAGG - Intergenic
1053567346 9:39267373-39267395 ATTTGATGCTTAGGTTCTTTAGG + Intronic
1053833071 9:42105106-42105128 ATTTGATGCTTAGGTTCTTTAGG + Intronic
1054129797 9:61351625-61351647 ATTTGATGCTTAGGTTCTTTAGG - Intergenic
1054597481 9:67082303-67082325 ATTTGATGCTTAGGTTCTTTAGG - Intergenic
1054996747 9:71399993-71400015 TTCTGATCCTCAGTTTCTTCAGG + Intronic
1057261096 9:93585214-93585236 ATCTGATGCAAAAATACTTATGG - Intronic
1057440669 9:95080882-95080904 ATCTGTTACAGAGATTCTTAAGG + Intronic
1058592978 9:106584843-106584865 GTCAGATGCTCAGATTTTCAGGG + Intergenic
1058737146 9:107904248-107904270 ACCTGATGAGCAGATTCTAAAGG - Intergenic
1059616400 9:115956167-115956189 ATCTGCTGCTCAGCTTCAGAAGG - Intergenic
1060284550 9:122237454-122237476 ATCTGAAGCCCAAGTTCTTACGG + Intergenic
1060565651 9:124588956-124588978 ATGTGATGGTCAGTTTCTTAAGG + Intronic
1062232847 9:135491754-135491776 ATCTGTCGCTCAGAATCTGAAGG + Intergenic
1203659063 Un_KI270753v1:24576-24598 ATCTGAACCTCAGAGACTTAAGG + Intergenic
1186121866 X:6371956-6371978 ATCCATTGCTCAGAATCTTATGG + Intergenic
1186174809 X:6914747-6914769 ATCTCATGCTCACATTATTATGG + Intergenic
1186382578 X:9076539-9076561 ACCTGCTACTCAGTTTCTTAAGG + Intronic
1187460243 X:19480279-19480301 AGCTGATCCTCAAATTCATATGG + Intronic
1187712337 X:22066862-22066884 GTCTGAAGCTCAGATTTTTTAGG + Intronic
1190725000 X:53183532-53183554 AGCTGATCCTCAAATTCATATGG - Intergenic
1193203181 X:78715881-78715903 AGCTGCTGTTCAGATTCTTTTGG - Intergenic
1193730813 X:85100698-85100720 AGCTGATCCTCACATTCATATGG + Intronic
1194085490 X:89522138-89522160 ATCTGGTCCTCAGCTTCTTTTGG + Intergenic
1194906284 X:99579842-99579864 AGCTGATTCTCAAATTCATATGG + Intergenic
1194979416 X:100425107-100425129 AACTGAAGCTCAGATGATTAAGG + Intergenic
1195334442 X:103836571-103836593 AGCTGATCCTAATATTCTTATGG + Intergenic
1196281349 X:113826636-113826658 AACTGATCCTAAGATTCATATGG + Intergenic
1196770679 X:119290257-119290279 CTCTGATACTCTGATTTTTAGGG + Intergenic
1197038955 X:121910997-121911019 AGCTGATCCTCACATTCATATGG - Intergenic
1198181233 X:134211478-134211500 AGCTGATCCTAAGATTCTTATGG + Intergenic
1198608362 X:138369566-138369588 ATCTCATGCTTACACTCTTACGG - Intergenic
1199867480 X:151865545-151865567 ATCTGATGCTAAAATTAATATGG - Intergenic
1200438134 Y:3178007-3178029 ATCTGGTCCTCAGCTTCTTTTGG + Intergenic
1200810895 Y:7483656-7483678 TTCTGATGGTCAGGTTCTGATGG + Intergenic
1202594325 Y:26521086-26521108 ATCAGCTGCTCAGAGGCTTAGGG - Intergenic