ID: 960875286

View in Genome Browser
Species Human (GRCh38)
Location 3:122289583-122289605
Sequence TGCCCGGCTTCCTGCCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960875286_960875293 11 Left 960875286 3:122289583-122289605 CCAACAGGGCAGGAAGCCGGGCA No data
Right 960875293 3:122289617-122289639 AAGGTGCCTCTGGGAACTGGAGG No data
960875286_960875290 2 Left 960875286 3:122289583-122289605 CCAACAGGGCAGGAAGCCGGGCA No data
Right 960875290 3:122289608-122289630 GCCAGCATGAAGGTGCCTCTGGG No data
960875286_960875294 12 Left 960875286 3:122289583-122289605 CCAACAGGGCAGGAAGCCGGGCA No data
Right 960875294 3:122289618-122289640 AGGTGCCTCTGGGAACTGGAGGG No data
960875286_960875287 -8 Left 960875286 3:122289583-122289605 CCAACAGGGCAGGAAGCCGGGCA No data
Right 960875287 3:122289598-122289620 GCCGGGCAGAGCCAGCATGAAGG No data
960875286_960875289 1 Left 960875286 3:122289583-122289605 CCAACAGGGCAGGAAGCCGGGCA No data
Right 960875289 3:122289607-122289629 AGCCAGCATGAAGGTGCCTCTGG No data
960875286_960875292 8 Left 960875286 3:122289583-122289605 CCAACAGGGCAGGAAGCCGGGCA No data
Right 960875292 3:122289614-122289636 ATGAAGGTGCCTCTGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960875286 Original CRISPR TGCCCGGCTTCCTGCCCTGT TGG (reversed) Intergenic
No off target data available for this crispr