ID: 960875287

View in Genome Browser
Species Human (GRCh38)
Location 3:122289598-122289620
Sequence GCCGGGCAGAGCCAGCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960875286_960875287 -8 Left 960875286 3:122289583-122289605 CCAACAGGGCAGGAAGCCGGGCA No data
Right 960875287 3:122289598-122289620 GCCGGGCAGAGCCAGCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960875287 Original CRISPR GCCGGGCAGAGCCAGCATGA AGG Intergenic
No off target data available for this crispr