ID: 960879484

View in Genome Browser
Species Human (GRCh38)
Location 3:122330195-122330217
Sequence AAAACTAGCAAGTAAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960879484 Original CRISPR AAAACTAGCAAGTAAGTGAC AGG (reversed) Intronic
907192168 1:52658481-52658503 TTACCTAGCAAGTAAGTGACAGG - Intronic
909630592 1:77766037-77766059 CAAATTAGAAAGTGAGTGACGGG - Intergenic
910156615 1:84225886-84225908 AAATTTAGCAGGGAAGTGACAGG - Intronic
911479254 1:98416789-98416811 ATAACTGGCAAGTAACTAACTGG + Intergenic
911963454 1:104336634-104336656 AAAAAAAGAAAGAAAGTGACGGG - Intergenic
912841756 1:113045163-113045185 AAAACCAACAAGTAGGTGCCAGG - Intergenic
914698175 1:150104965-150104987 AGAACTAGCAATTAAGCCACAGG - Intronic
915145938 1:153795713-153795735 ACAGCTGGCAAGTAAGTGACAGG + Intergenic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
920122035 1:203665982-203666004 AATACTAGCCAGTAAGTTCCTGG - Intronic
923041849 1:230325298-230325320 AAATACAGCAAGTAAGTGGCTGG - Exonic
1063630540 10:7729808-7729830 AAAACTAGAAATTGAGTTACTGG + Intronic
1063694657 10:8322072-8322094 AAAACAAGCAAGAAGGAGACTGG + Intergenic
1067008072 10:42683470-42683492 AAAAGTAGTAAGAAAGTGAGTGG + Intergenic
1067522101 10:47015457-47015479 TAAACTAGAAAGTAAGTGAATGG - Intergenic
1069157383 10:65048017-65048039 AAAACTTTTAAGTAAGTCACAGG + Intergenic
1069433063 10:68354731-68354753 AGAACTAGTAAGTAATAGACTGG + Intronic
1069448177 10:68493727-68493749 AAAACAACCTAGTAAGTGAAGGG + Intronic
1070445520 10:76497133-76497155 ATAACAAGGAAGTAAGTGAAGGG - Intronic
1071703586 10:87971401-87971423 AAAAATAGCCAGTAAATGATAGG - Exonic
1071874784 10:89833458-89833480 AAAACCAGGGAGCAAGTGACAGG - Intergenic
1072226567 10:93375561-93375583 AGGACAAGGAAGTAAGTGACTGG - Intronic
1074042714 10:109808445-109808467 AAAACCTGCAAGTAACAGACTGG + Intergenic
1074390930 10:113057564-113057586 AAAACCAGTAAATAAGTAACAGG + Intronic
1074955749 10:118387263-118387285 AGAACTTGCAAATAAGTAACTGG - Intergenic
1074996566 10:118762172-118762194 AAAACAAGCAGGCAAGAGACGGG + Intergenic
1075876985 10:125815756-125815778 ACCTCTAGCAAGTAAGAGACAGG - Intronic
1080682088 11:34486653-34486675 ATAACTTGCAAGTAAGTGCAGGG - Intronic
1081156547 11:39699770-39699792 AATACTAGCTAAGAAGTGACTGG - Intergenic
1083028195 11:59568553-59568575 AACATAGGCAAGTAAGTGACCGG - Intergenic
1083582969 11:63837146-63837168 AAAGCTAGCAAGGAAGAGAAAGG + Intergenic
1084934269 11:72578707-72578729 AGACCTAGCAAGTCAGTGGCTGG - Intronic
1086433042 11:86754184-86754206 AAAAGTAGCAAGAAAGGGCCAGG - Intergenic
1087373319 11:97313324-97313346 AAAAGTAGATAGGAAGTGACAGG + Intergenic
1087585800 11:100120210-100120232 AAAAATTCCAAGTAAGTAACTGG - Intronic
1088159827 11:106855398-106855420 AAATTCAGCAAGGAAGTGACAGG - Intronic
1088715673 11:112547215-112547237 AAAACTAGCAAACATGTGCCAGG + Intergenic
1089078278 11:115756392-115756414 AAAACTACCAGGCAAGTTACAGG + Intergenic
1091598888 12:1904972-1904994 AAAACTAGCAAGCAAATCTCAGG + Intronic
1092127718 12:6086593-6086615 AAAACTGCCAATTAAGTGAATGG + Intronic
1092688748 12:11082692-11082714 AAAAATAGCAAGTAAATCACTGG - Intronic
1092692160 12:11125229-11125251 AAAAATAGCAAGTAAATCATTGG - Intronic
1093584884 12:20822663-20822685 AAAACTAGCAGGTAAGGGAATGG + Intronic
1093889115 12:24498320-24498342 AGAACTAGCAAATCAGTGATAGG + Intergenic
1094672800 12:32587287-32587309 TCACCTAGCTAGTAAGTGACGGG - Intronic
1095196121 12:39319658-39319680 ATAACTGGCAAGTAAGTAAGTGG + Intronic
1096085592 12:48863166-48863188 AAGACTAGCAAGTAAATAATGGG + Intronic
1097357237 12:58615305-58615327 AAACCTTGGAAGTATGTGACTGG - Intronic
1098429107 12:70400301-70400323 TAAAATAGCAAGTAAATGGCTGG - Exonic
1099553725 12:84081897-84081919 AAAACTAGGAAGAAACTGAAGGG + Intergenic
1099661015 12:85561861-85561883 AAAGATAGCAAGTAGGTCACTGG + Intergenic
1099723757 12:86398683-86398705 AAAAGGAGCAAGTAAAAGACGGG - Intronic
1099895896 12:88646115-88646137 AAAACTAGCAAGTAAATATGAGG + Intergenic
1103632503 12:122273587-122273609 AAATCTGGCAAGTGAGTGAGAGG - Intronic
1103697869 12:122831580-122831602 AAAAAAAGCCAGTCAGTGACAGG + Intergenic
1103785263 12:123428033-123428055 AAAACTAGAAAGAAAGTGTGTGG + Intronic
1105365190 13:19757788-19757810 AAAATAAATAAGTAAGTGACTGG + Intronic
1107242282 13:38250845-38250867 AAAACTAGCAAACAACTGAGAGG + Intergenic
1109020852 13:57090655-57090677 AAAAATAGCATGAAAGAGACAGG + Intergenic
1109120572 13:58451145-58451167 AAAACTAGCAATGAAGTAAATGG - Intergenic
1110466890 13:75812595-75812617 AAAACTAGCCAAAAAGTGACAGG + Intronic
1111411400 13:87881720-87881742 AAAAGTGGCAAGTAATTGCCTGG + Intergenic
1111901594 13:94206556-94206578 AAAAATAGCAAATAAGAGCCAGG + Intronic
1113285307 13:108840173-108840195 AATACTTGCAAGTAGGTGAGGGG - Intronic
1115581026 14:34758601-34758623 AAAACTAGACAGTGAGTAACAGG + Intronic
1115889407 14:38010485-38010507 ATAGCTAGTAAGTGAGTGACTGG - Intronic
1116072736 14:40069835-40069857 AAAAATAAGAAGTAAGTAACAGG + Intergenic
1116341942 14:43734535-43734557 AAAACTTGAAATTAAGAGACAGG + Intergenic
1116369474 14:44110834-44110856 AAAAGGAGCAAGCAAGTGGCAGG - Intergenic
1116475731 14:45336603-45336625 AAAACAATCAATAAAGTGACAGG - Intergenic
1116730446 14:48614619-48614641 GAAACTGTGAAGTAAGTGACAGG - Intergenic
1117203472 14:53416544-53416566 AAGACTGGCAAGTAAGAGCCAGG - Intergenic
1117677688 14:58171124-58171146 AAAACTGGCAAGAAAAGGACAGG + Intronic
1118205773 14:63722057-63722079 TAACCTAGCCAGTAAGTGTCAGG - Intronic
1118369285 14:65123374-65123396 AATATTAGCAAGTAAGGGCCGGG - Intergenic
1118675636 14:68181664-68181686 AATACTAGAAAGGAAGTTACGGG + Intronic
1119592705 14:75904951-75904973 ACAACTAGTAAGTAACTGCCAGG + Intronic
1120019024 14:79507328-79507350 AAAACTACCAAGTTGGTGAAAGG + Intronic
1122515822 14:102307708-102307730 GAAACTAACAAGCAAGAGACAGG - Intergenic
1123220159 14:106848455-106848477 CAAACTAGCAAATAAATCACTGG - Intergenic
1125514590 15:40310720-40310742 TAAACCAGCTAGTAAGTGGCTGG - Intergenic
1126424444 15:48511623-48511645 ATAACTGGGAAGTAAGTGAGGGG - Intronic
1126427368 15:48543207-48543229 AAAACTAGAAGGAAAGAGACTGG - Intronic
1127302467 15:57668831-57668853 AAAACAAAAAAGTAAGTCACAGG - Intronic
1130311242 15:82757310-82757332 GAAACTACCAAGTAAGAAACAGG - Exonic
1132931928 16:2463024-2463046 AAAACTAGCATGTGAGGGCCGGG + Intronic
1133388849 16:5392890-5392912 AAAATGAGCAGGTAAGTGCCAGG - Intergenic
1135417185 16:22277485-22277507 AAAAAAAGCAAGCAAGTGGCTGG - Intronic
1135431260 16:22385492-22385514 AATACTATCAAGAAGGTGACTGG + Intronic
1135687941 16:24513409-24513431 AAAACAAGGAAGTAAGTGCATGG - Intergenic
1137329233 16:47473843-47473865 AAAAATAGTAAGTATGTGAGGGG - Intronic
1138171535 16:54854581-54854603 AAAGCTAGCTAGTAAGTGGCAGG + Intergenic
1140340888 16:74160144-74160166 AAAACTAGAAAGAAAATTACTGG - Intergenic
1140946825 16:79776514-79776536 AAAACTAACAAGAAAGTATCAGG - Intergenic
1143405427 17:6674450-6674472 AAATCTAGCAAATAAGAGAGAGG + Intergenic
1143405709 17:6675901-6675923 AAAACTAGCAACAGAGAGACAGG - Intergenic
1146497347 17:33335001-33335023 AGAACTAGCAAATAACTGGCAGG - Intronic
1150125975 17:62635166-62635188 AAAAATAGCAATGAAGTAACAGG - Intronic
1154046757 18:10913226-10913248 AATCCTAGCAATTAAGAGACTGG + Intronic
1155307553 18:24493359-24493381 AACATTAGAAAGTAAGTTACAGG + Intergenic
1156467829 18:37359128-37359150 AAACCTGTCAAGTAAGTGAAAGG + Intronic
1156848502 18:41698199-41698221 AATAATAGCAAGTAAGTCATAGG + Intergenic
1158491874 18:57917309-57917331 AACACTACCAAGAAAGTGAAAGG - Intergenic
1158806628 18:60981278-60981300 AAAATTAGCAAGTAAGTGGTTGG - Intergenic
1159689921 18:71474666-71474688 AAAAGTAGCAAGTGAGACACAGG + Intergenic
1159987958 18:74867536-74867558 AAAAGCAGCTAGTAAGTGTCTGG - Intronic
1162957306 19:14106655-14106677 AAAAAAAGCAAGTGAGTGAACGG + Intronic
1163861174 19:19743661-19743683 AAAACCAACAAGTCAGAGACTGG + Intergenic
1166517305 19:43457055-43457077 AACACAAGCAAGTAACTGTCTGG + Intergenic
1166618582 19:44273937-44273959 ACAAATGGGAAGTAAGTGACAGG + Exonic
1167915727 19:52738865-52738887 CAAACAAGCAAATAAGTGAGAGG - Intergenic
1168329433 19:55558361-55558383 AAAACTTGAAAGTAACCGACTGG - Intergenic
926608592 2:14922769-14922791 AAAAATAGCTAGTAACTGAAAGG + Intergenic
927518157 2:23683772-23683794 AAAGCAAGCAAGCAAGGGACAGG - Intronic
928305690 2:30168632-30168654 AAAACTAACAAGGTAGTGAGGGG + Intergenic
928814256 2:35271647-35271669 AAAACTATCAACAAAGTGGCAGG - Intergenic
930259164 2:49124972-49124994 ACAACAAACAAGTTAGTGACAGG - Intronic
930754805 2:54963497-54963519 ACACCCAGCTAGTAAGTGACAGG + Intronic
931126554 2:59284906-59284928 AAAACTAACAAGTCATAGACAGG + Intergenic
932525187 2:72458539-72458561 CAAAGTAGGAAGTAACTGACAGG - Intronic
932772652 2:74509470-74509492 AAAAAGAGCAAGGAAGTGAAAGG - Intergenic
934871086 2:97866175-97866197 AAAACTTGCCAGAAAGTGGCTGG - Intronic
935383265 2:102475411-102475433 GCAACTAGCTAGTCAGTGACAGG - Intronic
937081328 2:119142033-119142055 AAGACTAGCAAGTGGGAGACTGG - Intergenic
937964445 2:127491738-127491760 AAAAATAGCAAGTAAGAGGCTGG - Intronic
938323740 2:130383293-130383315 AAAACTAGAAAGTGAGGGAGAGG + Intergenic
938852068 2:135271403-135271425 AACACAATCAAGTAAGTGAAGGG + Intronic
939371203 2:141302967-141302989 AATACTAGCAATTACGTGAATGG + Intronic
939614247 2:144344988-144345010 AAAATTAAAAAGTAAATGACTGG + Intergenic
941093095 2:161201475-161201497 AAACTTAGCAAGTTAGAGACAGG - Intronic
941150511 2:161908660-161908682 AAAACTAACAAGGAAGTGGGTGG + Intronic
941723044 2:168832723-168832745 AAAACTAAAAAGCAAATGACTGG - Intronic
943764266 2:191643938-191643960 TTATCCAGCAAGTAAGTGACTGG + Intergenic
946567335 2:220981283-220981305 AAAACCAGCAAGAAATTGACTGG + Intergenic
946782316 2:223204753-223204775 AAACTTAGCAGGAAAGTGACAGG + Intergenic
1173675525 20:44831722-44831744 TCAAGTAGCTAGTAAGTGACAGG + Intergenic
1175416176 20:58803093-58803115 AAAACCAGCAAGTCTGGGACAGG + Intergenic
1177877972 21:26657900-26657922 AAAAGTAGGAAGCCAGTGACTGG - Intergenic
1185035197 22:48471886-48471908 AAAACTACCAAGAAAGTTTCTGG - Intergenic
950216175 3:11161345-11161367 AAAGCTAGCAAGTAAATAAAAGG - Intronic
951300340 3:20988746-20988768 AAATGCAGCAAGAAAGTGACTGG + Intergenic
951680133 3:25286051-25286073 AAGACTAGCAATTAATTGAATGG - Intronic
951893091 3:27584990-27585012 CAAACTGGGAAGTAAGAGACTGG + Intergenic
953638439 3:44683696-44683718 AATACTAGGAAGTATGTGAGAGG - Intergenic
954851356 3:53603678-53603700 AAAACTGGCAAGTTATTGATGGG + Intronic
954932052 3:54292367-54292389 AACACTATCAAGAAAGTGAAAGG + Intronic
955924666 3:63993507-63993529 AAAACAAGCATGTAGGAGACAGG - Intronic
956966597 3:74468902-74468924 GAAACTAACAACTAAATGACAGG - Intronic
959310685 3:104732401-104732423 AAAACTTGCAAGAAAATTACTGG + Intergenic
959440314 3:106366139-106366161 AATACTAGGAACTAAGTGCCAGG - Intergenic
959527417 3:107392754-107392776 ATAACTAGCCAGAAAGTAACTGG - Intergenic
960217229 3:115056166-115056188 AAAACATGCAAGTAAGTGAATGG + Intronic
960879484 3:122330195-122330217 AAAACTAGCAAGTAAGTGACAGG - Intronic
961533928 3:127557714-127557736 AAAACTGGCAAGTAAGGGCCAGG + Intergenic
962411701 3:135146565-135146587 CAACCTAGAAAGTAAGTGATAGG - Intronic
964458002 3:156889909-156889931 ATTAGTAGCAAGTAAGTGTCAGG + Intronic
964861630 3:161208907-161208929 AAAATTAGCAAGAAAGGGAGAGG + Intronic
965461081 3:168964160-168964182 AACACTAGCAAGTAATTTTCTGG + Intergenic
965847770 3:172984716-172984738 AAGACTATCAAGTAATTGATGGG + Intronic
965939056 3:174153899-174153921 AAAAATAGCAACTAAGTCAAAGG - Intronic
966957705 3:184900597-184900619 AAAACTAGTAAGCAAGTGAAAGG - Intronic
967876906 3:194273665-194273687 AAAACCAGCAACCAAGTGTCAGG + Intergenic
968498878 4:935059-935081 AAACCTAGCAAATAACTCACTGG + Intronic
969066521 4:4486201-4486223 AAAAGTAGAAAGAAACTGACGGG - Intronic
969825580 4:9755610-9755632 AAAATCAGCAAATAACTGACAGG - Intergenic
969860271 4:10030230-10030252 AAAACTGGTAAGTAGGTGAGGGG + Intronic
972274468 4:37544129-37544151 CAAACTACCAATTAAGTGAGAGG - Intronic
972511767 4:39773623-39773645 AAAACTAACAAGAAGGTGGCTGG + Intronic
972871121 4:43299634-43299656 ATAACTAGAAAGTGAATGACTGG + Intergenic
973850349 4:54955602-54955624 AAAACTAGTATGTAAATGAATGG + Intergenic
974062957 4:57052217-57052239 AACACTACCCAGTAACTGACTGG + Intronic
974178216 4:58351938-58351960 AAATCTTGCAAGTAATTGGCAGG + Intergenic
975680694 4:76872994-76873016 AAAAATAGAAAGAAAGAGACAGG + Intergenic
975966501 4:79978709-79978731 AAAGCCAGCTAGTAAGTGACAGG + Intronic
976404599 4:84648931-84648953 AAACCTAGCAAGTAAGGGGAAGG - Exonic
977003229 4:91530223-91530245 AAAACTAGTGAATATGTGACAGG + Intronic
979701507 4:123673432-123673454 AAAAATAGGGAGTAGGTGACTGG + Intergenic
979957137 4:126968121-126968143 AAAACCCTAAAGTAAGTGACAGG + Intergenic
980089315 4:128425630-128425652 AAAAGTAGCAAGTAAATAATAGG + Intergenic
980238342 4:130137835-130137857 AACAATAGCAATTAAGTGAAAGG + Intergenic
980499147 4:133626339-133626361 AAAACTAGAAAATGTGTGACAGG - Intergenic
982639213 4:157936058-157936080 GAAACTAGCAAATAAATGACAGG - Intergenic
984500986 4:180558326-180558348 ATAATTATTAAGTAAGTGACAGG - Intergenic
986046919 5:4047354-4047376 AAAACAAGCAACAAAATGACAGG + Intergenic
986168902 5:5299648-5299670 AACACTACCCAGAAAGTGACAGG - Intronic
986440216 5:7774824-7774846 AAAATTAGGAAGTGAGAGACAGG - Intronic
987082504 5:14438319-14438341 AACATTAGCAAGTAAGTAAAGGG - Intronic
987316297 5:16727891-16727913 AAAACTAGCAAAGAAATGCCTGG + Intronic
988125192 5:27023754-27023776 AAAAATAGCATGTAAGGGCCAGG + Intronic
988334970 5:29895346-29895368 AAAACAAGCAAGGAATTTACTGG - Intergenic
990161819 5:52949525-52949547 ATTACTAGCTAGTAAATGACTGG + Intronic
990738970 5:58893068-58893090 AAAAATAAAAAGTAAGAGACAGG + Intergenic
992848362 5:80778034-80778056 ATAGCTAGTAAGTAAGTGGCAGG + Intronic
993615025 5:90100443-90100465 AATACAAGAAAGTAAGTGAAAGG + Intergenic
993617273 5:90129015-90129037 AAAAGTAACAAGTAAATTACAGG + Intergenic
995062146 5:107822637-107822659 AAAAGTAGCAAGCAAGTTAAAGG - Intergenic
996092887 5:119368086-119368108 AAAAGTAGCAAGTGTGTGCCAGG + Intronic
997095392 5:130904546-130904568 AAAAAAAGAAAGAAAGTGACTGG + Intergenic
998194974 5:140060921-140060943 TAAACTAACAAGAAAGTGACAGG - Intergenic
998529734 5:142873381-142873403 AAATCTAGCAAGAAAAAGACAGG - Exonic
999619311 5:153456404-153456426 AAAACTTGCAAATGATTGACAGG + Intergenic
1000183057 5:158831326-158831348 ATTACAAGCAAGTAAGTGATGGG - Intronic
1000930659 5:167247232-167247254 TCATCCAGCAAGTAAGTGACAGG + Intergenic
1001862912 5:175074674-175074696 AAAACCAGTAAGTAAGAGAGAGG + Intergenic
1003397752 6:5767592-5767614 ACAGCTAACAAGTAAGTGGCAGG - Intronic
1004633058 6:17439819-17439841 CAAGCCAGCAAGCAAGTGACTGG - Intronic
1004637296 6:17481139-17481161 AGAATTAGAAAGTAATTGACTGG - Intronic
1004674180 6:17825063-17825085 AAATCTAGCAATTAAGACACTGG + Intronic
1009553507 6:65131227-65131249 AAAACTATAAAGTAAGTAAGGGG + Intronic
1010332866 6:74645649-74645671 AACACTGGAAAGAAAGTGACCGG + Intergenic
1010735064 6:79435074-79435096 TAAAAGAGCAAGTAAGTGGCAGG + Intergenic
1011090695 6:83595624-83595646 AAGTCTAGCAGGTAAGTGACAGG - Intronic
1011897031 6:92241116-92241138 ATAACTAGCAAGATAGTGAAGGG + Intergenic
1011930838 6:92710375-92710397 AAAACTATAAATTAAATGACTGG + Intergenic
1012500293 6:99881012-99881034 AGAACTAGAAAGTAAATGAAAGG - Intergenic
1012677265 6:102132381-102132403 AAAACTAGAAAAAAAATGACAGG - Intergenic
1013878404 6:114863174-114863196 AAAACTAGAAAGTGATTGAGTGG + Intergenic
1016088246 6:139942761-139942783 AAAATTAGCAAGCATGTGAAGGG + Intergenic
1016575574 6:145566217-145566239 AAAATTAGCAAATATGTGAAGGG - Intronic
1016634190 6:146268517-146268539 AATACTATCAAGCATGTGACTGG - Intronic
1017680118 6:156854945-156854967 AAAACTGCCTAGTAATTGACTGG - Intronic
1021470994 7:21002490-21002512 AAATTCAGCAAGGAAGTGACAGG + Intergenic
1022557384 7:31311985-31312007 AAAAATAGCATGGAAGTGCCTGG - Intergenic
1022708394 7:32828389-32828411 AAATGTGGCACGTAAGTGACTGG + Intergenic
1022801283 7:33779765-33779787 AAAACGAATTAGTAAGTGACAGG + Intergenic
1022875702 7:34526741-34526763 AAAACAAGCAACTAAATGGCAGG - Intergenic
1022881988 7:34597534-34597556 AAACCTATCAAGTAAGAGAAAGG + Intergenic
1022914781 7:34937092-34937114 AAATGTGGCACGTAAGTGACTGG - Intronic
1028123557 7:87085225-87085247 AGAACTAGAAAGTACATGACTGG + Intergenic
1031149560 7:118037328-118037350 AAAGCAAGCAAGCAAATGACTGG + Intergenic
1032935277 7:136722446-136722468 AAAATTAGCATGCAAGTGACAGG + Intergenic
1034730977 7:153387464-153387486 AAAACAAGCAAGGAAGGGAAGGG - Intergenic
1035120423 7:156562077-156562099 AAAACTATGAAGTAAATGTCGGG - Intergenic
1036924991 8:12895832-12895854 ATAACCAGCAAGTGAGTGGCAGG - Intergenic
1037795978 8:21995358-21995380 AAGATTAGCAAGCAAGAGACAGG + Intronic
1039739999 8:40373678-40373700 AAAGTTACAAAGTAAGTGACCGG - Intergenic
1040017349 8:42710468-42710490 ATAAATAGAAAATAAGTGACTGG - Intronic
1041864296 8:62551706-62551728 AAAACTACCAACAAAGTGACTGG - Intronic
1044054954 8:87557099-87557121 CAAACAAACAAGTAAGTGAATGG + Intronic
1045228837 8:100280161-100280183 AAAACTAGCAATCAAGGGCCGGG - Intronic
1045890923 8:107156285-107156307 AAGTTTAGCAAGTAATTGACAGG + Intergenic
1046213323 8:111108769-111108791 AAGACCAGCATTTAAGTGACAGG + Intergenic
1046262289 8:111784614-111784636 AAAACTATTAAGTAAATGAATGG - Intergenic
1046879369 8:119291203-119291225 AAAAGTAGCAAATAAGTGGGCGG - Intergenic
1047339376 8:123966051-123966073 AAAATTATCAAGTAAGTGATTGG + Exonic
1053655633 9:40216046-40216068 AAAAGTAGTAAGAAAGTGAGTGG - Intergenic
1053905997 9:42845267-42845289 AAAAGTAGTAAGAAAGTGAGTGG - Intergenic
1054352029 9:64026080-64026102 AAAAGTAGTAAGAAAGTGAGTGG - Intergenic
1054367751 9:64362276-64362298 AAAAGTAGTAAGAAAGTGAGTGG - Intergenic
1054528972 9:66160240-66160262 AAAAGTAGTAAGAAAGTGAGTGG + Intergenic
1054675368 9:67852016-67852038 AAAAGTAGTAAGAAAGTGAGTGG - Intergenic
1054749825 9:68894061-68894083 AAAACAGGCAAGGAATTGACTGG - Intronic
1055271291 9:74562517-74562539 CAAACTAGCAAGACAGTGATTGG - Intronic
1059646078 9:116269362-116269384 AAAACTAACAAGTAAAGGAGTGG + Intronic
1061226350 9:129283152-129283174 AACCCTAGAAAGTAAGGGACTGG - Intergenic
1061386292 9:130291504-130291526 AAAAATAACAAGTATGCGACCGG - Intronic
1061942231 9:133890010-133890032 AAAATTAGCTAGTAACTAACAGG + Intronic
1061953074 9:133947194-133947216 AAAACAAGCAAGCAGGTGAAAGG + Intronic
1061999541 9:134208926-134208948 AAATCGAACAAGTAAGGGACTGG - Intergenic
1062199948 9:135297275-135297297 GAAACTAGCAAGTTAATGGCAGG - Intergenic
1185783873 X:2873021-2873043 AGAACTAGCAAGTGAGAGAGCGG - Intronic
1189718672 X:43892159-43892181 AAAACTGGCAAAACAGTGACAGG + Intergenic
1191790006 X:64960030-64960052 AAAAATAGCACTTAAGTCACTGG + Intronic
1194340950 X:92704880-92704902 TAACCCAGCTAGTAAGTGACAGG - Intergenic
1195388965 X:104341220-104341242 TAAACTACCTAGTATGTGACGGG - Intergenic
1196196473 X:112842112-112842134 ACAATTAGCTAGTAAGTGCCAGG - Intergenic
1199013117 X:142779962-142779984 TAAACTTGGAAGTGAGTGACTGG + Intergenic
1199087007 X:143639195-143639217 AGAAATAGCAAGTGTGTGACCGG - Intergenic
1199391932 X:147290298-147290320 ATAACTAAAAAGTAAGTGATAGG + Intergenic
1200649304 Y:5821599-5821621 TAACCCAGCTAGTAAGTGACAGG - Intergenic
1200736657 Y:6806320-6806342 AAAAATAGCAAGTAGGTTGCAGG + Intergenic
1200811187 Y:7486864-7486886 AAAACTAGTAAGTAAGTGAACGG + Intergenic
1201153689 Y:11110683-11110705 AAAACTAGTAAGAAATTGAATGG - Intergenic
1201778887 Y:17696535-17696557 AAAACTAGAAAGTAGGTATCTGG - Intergenic
1201822669 Y:18209457-18209479 AAAACTAGAAAGTAGGTATCTGG + Intergenic