ID: 960882364

View in Genome Browser
Species Human (GRCh38)
Location 3:122357956-122357978
Sequence CCTCAACTAATGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960882364 Original CRISPR CCTCAACTAATGAAGGAAGA TGG (reversed) Intergenic
901777389 1:11569714-11569736 TCACACCTAATAAAGGAAGAAGG + Intergenic
902318291 1:15640730-15640752 CCAGAAATAATGAAGGAAAAGGG - Intronic
903630211 1:24763066-24763088 CCTCAAGTAAAGAAGTAGGAGGG - Intronic
905026015 1:34850047-34850069 CCACAACCCATGAAGGAAGAGGG + Intronic
906974677 1:50557139-50557161 CCTCAGCTAAGGAAGGAATGAGG - Intronic
908219222 1:61986848-61986870 CATCTACTAATGAATGAATATGG - Intronic
913134357 1:115873669-115873691 ACTCAGCTAATGAATGAGGAGGG + Intergenic
917352251 1:174090469-174090491 CCACACCTAATGCAGGAAGATGG - Intergenic
917740534 1:177958131-177958153 GCTCTACTATGGAAGGAAGAAGG - Exonic
918912916 1:190596589-190596611 CCACAACCAATCAAGGAAGAAGG - Intergenic
923198323 1:231688940-231688962 TCTGAATTATTGAAGGAAGATGG + Intronic
923537923 1:234867329-234867351 CCCCATCTGATGAAGGAAGGGGG - Intergenic
924083973 1:240429453-240429475 CCTCAACTAACCAAGAAAGGAGG - Intronic
1062772948 10:118802-118824 GATCAAATAATGAAGGCAGAGGG - Intergenic
1064460354 10:15529092-15529114 TCTCAAGAAAGGAAGGAAGAAGG - Intronic
1067775259 10:49159989-49160011 CCTCAACAAAAGAAGGAGAAAGG + Intronic
1072932665 10:99680387-99680409 CTTCCTCTAATGCAGGAAGAGGG - Intronic
1077979326 11:7284354-7284376 CTCCAACTAATTAAGGAAAAAGG - Intronic
1078714319 11:13825571-13825593 CCTCAGCAAATGGAGGCAGAAGG + Intergenic
1080496793 11:32828674-32828696 CATCAAGTAATGAAGGCAGCAGG - Intergenic
1080865203 11:36188200-36188222 CCTCAACTATTGAAGGCACCTGG - Intronic
1081006653 11:37752850-37752872 TCTCAAAAAATGAAAGAAGAAGG - Intergenic
1081194490 11:40144645-40144667 CCTCAACAAATATAGGAGGAAGG + Intronic
1084233893 11:67773682-67773704 CCTCAGCAAAGGAAGGATGAGGG - Intergenic
1085754744 11:79193110-79193132 CCTCAAATACTGAAAGAAAATGG - Intronic
1086332248 11:85765713-85765735 TCTCAAATTATGAATGAAGAGGG + Intronic
1087220092 11:95537459-95537481 CATGAAGTAGTGAAGGAAGACGG + Intergenic
1087735125 11:101824135-101824157 AGACAACTAGTGAAGGAAGATGG - Intronic
1087906534 11:103704053-103704075 CCTACACCTATGAAGGAAGACGG + Intergenic
1088393262 11:109339483-109339505 CCTCACATAATGAAGAAAGATGG - Intergenic
1090439403 11:126713468-126713490 CCTCAAGGTATGTAGGAAGATGG + Intronic
1093240904 12:16671956-16671978 CCTAAACTATTGTAGGCAGATGG + Intergenic
1093259691 12:16919916-16919938 CATCAACTGATGAATGAATAAGG + Intergenic
1094376907 12:29800364-29800386 CCTCAGCTAATGATGAAAGAGGG + Intergenic
1099233750 12:80057434-80057456 CCACATCTAATGAATGAACATGG - Intergenic
1100358835 12:93857689-93857711 CTTCCACTTATGACGGAAGAAGG + Intronic
1101778652 12:107816279-107816301 CTTCAACTCATGACAGAAGACGG - Intergenic
1101978311 12:109382046-109382068 TCTCATCTAATAAATGAAGATGG + Intronic
1104082141 12:125438668-125438690 CCTTAAGGAAGGAAGGAAGAAGG - Intronic
1104772701 12:131373485-131373507 CATCAACAACTGAAGGAAGTGGG - Intergenic
1104904846 12:132207654-132207676 CCTCAGCTAATGATGGAAGTTGG - Intronic
1105900574 13:24748250-24748272 CCTCTGCTAATGAGGGTAGAAGG + Intergenic
1106099192 13:26679857-26679879 CTTCAATTAAGGAAGGAAAAAGG + Intronic
1107781288 13:43905281-43905303 CTTCTAGTAAGGAAGGAAGAGGG - Intergenic
1107972610 13:45658472-45658494 CCTCTAGTGATGATGGAAGATGG - Intergenic
1108743360 13:53362297-53362319 CTTCAATGAAAGAAGGAAGATGG - Intergenic
1108805425 13:54149107-54149129 AATTAACTAATGAATGAAGAGGG - Intergenic
1108954103 13:56129604-56129626 CCTTAAATGATGAAGGATGATGG - Intergenic
1109313945 13:60727615-60727637 CCTCCACTAATGAGGGTAAAGGG + Intergenic
1113292735 13:108924054-108924076 CCTAAACTGATGGTGGAAGATGG - Intronic
1114059622 14:19007407-19007429 CCTCACCCACTGAAGGAAGTGGG + Intergenic
1114102924 14:19394344-19394366 CCTCACCCACTGAAGGAAGTGGG - Intergenic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1121760282 14:96439212-96439234 CATCAACTACTGAATGAATATGG + Intronic
1121851084 14:97221647-97221669 ACTAAACTAATAAAGGAAAATGG - Intergenic
1202837243 14_GL000009v2_random:87324-87346 CCTCAGCTACTCAAGGAAGGAGG + Intergenic
1202906632 14_GL000194v1_random:77454-77476 CCTCAGCTACTCAAGGAAGGAGG + Intergenic
1123553183 15:21401125-21401147 CCTCAGCTACTCAAGGAAGTAGG - Intergenic
1123589429 15:21838513-21838535 CCTCAGCTACTCAAGGAAGTAGG - Intergenic
1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG + Intronic
1127499551 15:59543613-59543635 ACTCCACTAATGATGGCAGAGGG + Intergenic
1130634007 15:85599080-85599102 TCAGCACTAATGAAGGAAGAGGG - Intronic
1131640761 15:94290465-94290487 CCTCAACAAATGAAGAAGGGCGG + Intronic
1132414450 15:101610478-101610500 CCTGTGCTAATGAGGGAAGAGGG + Intergenic
1202961532 15_KI270727v1_random:128345-128367 CCTCAGCTACTCAAGGAAGTAGG - Intergenic
1135729690 16:24883677-24883699 TCTAACCTAGTGAAGGAAGAGGG - Intronic
1136571269 16:31098373-31098395 CCTTAAAAAATGAAGGAGGATGG + Intergenic
1137389766 16:48071596-48071618 CCTCATCTAGTGAAGGAAAGTGG - Intergenic
1137586854 16:49668884-49668906 CCTCAACTATAAAATGAAGATGG + Intronic
1138769034 16:59639941-59639963 TTACAACTAAAGAAGGAAGAAGG - Intergenic
1139639984 16:68284511-68284533 GCTAAACTAATGAATAAAGAAGG - Intronic
1141270045 16:82531285-82531307 GCTCTACCATTGAAGGAAGAGGG + Intergenic
1141826573 16:86484866-86484888 GCAAAACTAATGCAGGAAGACGG - Intergenic
1143858412 17:9869892-9869914 CCTCCACTTTTGAAGGCAGAAGG + Intronic
1152311049 17:79550056-79550078 CCTCAGAAAATGGAGGAAGATGG - Intergenic
1153334231 18:3905563-3905585 CTTGAACTAAGGAAGAAAGAGGG - Intronic
1153463836 18:5366808-5366830 CCTCAACAAAAGAAGAAAGAGGG + Intergenic
1154191460 18:12234293-12234315 CCTCGACTAAGGAAGGTAGGAGG - Intergenic
1154453869 18:14503242-14503264 CCTCAGCTACTCAAGGAAGTAGG - Intergenic
1154931569 18:21002601-21002623 AATTAACAAATGAAGGAAGATGG + Intronic
1156035553 18:32763312-32763334 ACTCAACCAATGAAGAACGAGGG - Intronic
1157267956 18:46245230-46245252 CCTTAAAAAGTGAAGGAAGAGGG - Intronic
1157782884 18:50455943-50455965 CCTCAAGTATTGGAGGGAGATGG + Intergenic
1158516937 18:58138528-58138550 CCTCAGCCAAGGAGGGAAGAGGG - Intronic
1158975593 18:62708650-62708672 TCTCAACTAGTGCAGGATGAGGG - Intergenic
1159259084 18:65988414-65988436 CCTCAACAAATGAAAATAGATGG - Intergenic
1159709997 18:71746386-71746408 CCTCAAGTAATAAAACAAGATGG - Intronic
1163086077 19:14980198-14980220 CCTCCGCTAAACAAGGAAGATGG + Intronic
1163468621 19:17484136-17484158 CCTGAATGAATGAAGGAAGGAGG + Intronic
1163894622 19:20047406-20047428 TCTCAACAAATGAACAAAGAAGG - Intergenic
1164284176 19:23796825-23796847 GCTAGATTAATGAAGGAAGAAGG - Intronic
1164594376 19:29524390-29524412 CCTCAGCTTCTGAAGGGAGAGGG - Intergenic
1202635397 1_KI270706v1_random:40027-40049 CCTCAGCTACTCAAGGAAGGAGG - Intergenic
927507183 2:23622170-23622192 ACTCAAGTAATGAAGGAACAGGG + Intronic
928296787 2:30090632-30090654 CCTCCAGTGATGAAGGAAGGAGG - Intergenic
928454028 2:31403260-31403282 CCTCAACCAAGGAAGGCAGCAGG + Intronic
928590859 2:32813605-32813627 CCTCTACTTTGGAAGGAAGAGGG - Intronic
928789219 2:34931415-34931437 CATCAAATAAGGAAGGAAGCAGG + Intergenic
929907430 2:46058449-46058471 CTTCAACTAAAGAAGAAAAAGGG + Intronic
931609550 2:64083839-64083861 CTTCAACACATGAAGGATGAAGG + Intergenic
932887794 2:75562537-75562559 CCTAAACTAATCAGGGAACAAGG + Intronic
935929854 2:108112838-108112860 CCTCAAAGATTGAAGGTAGATGG - Intergenic
937402608 2:121597943-121597965 TCTCACCTGATGAGGGAAGAAGG + Intronic
938150675 2:128879804-128879826 CCTCCACCAACGAAGGCAGAGGG + Intergenic
938280402 2:130059997-130060019 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938280990 2:130063510-130063532 CCTCAGCTACTCAAGGAAGCTGG - Intergenic
938281118 2:130064327-130064349 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938281312 2:130065501-130065523 CCTCAGCTACTCAAGGAAGCTGG - Intergenic
938281417 2:130066141-130066163 CCTCAGCTACTCAAGGAAGCTGG - Intergenic
938281557 2:130067071-130067093 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938281685 2:130067881-130067903 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938331634 2:130452346-130452368 CCTCAGCTACTCAAGGAAGCTGG - Intergenic
938331986 2:130454439-130454461 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938357829 2:130666230-130666252 CCTCAGCTACTCAAGGAAGCTGG + Intergenic
938358025 2:130667400-130667422 CCTCACCCACTGAAGGAAGCAGG + Intergenic
938358161 2:130668216-130668238 CCTCAGCTACTCAAGGAAGCTGG + Intergenic
938358317 2:130669160-130669182 CCTCAGCTACTCAAGGAAGCTGG + Intergenic
938434067 2:131271840-131271862 CCTCAGCTACTCAAGGAAGCTGG + Intronic
938434385 2:131273829-131273851 CCTCAGCTACTCAAGGAAGCTGG + Intronic
938434707 2:131275819-131275841 CCTCAGCTACTCAAGGAAGCTGG + Intronic
938477977 2:131633671-131633693 CCTCACCCACTGAAGGAAGCAGG + Intergenic
941254328 2:163209199-163209221 ACCCAACTGATGAAGGCAGAAGG + Intergenic
941390924 2:164913895-164913917 TCTCAAGAAATGAAGAAAGATGG - Intronic
941763011 2:169265214-169265236 CCTTACCTCATGAAGGAAAATGG + Intronic
942074821 2:172347842-172347864 CCTGAAATAATTAAGGAATAAGG - Intergenic
942545867 2:177062978-177063000 GGTCCTCTAATGAAGGAAGAGGG + Intergenic
943441683 2:187933930-187933952 CCTCAAATAAGGGAGAAAGAGGG + Intergenic
944691695 2:202164495-202164517 ACTCAAGGAAAGAAGGAAGAAGG + Intronic
946890817 2:224274326-224274348 CACCAACTTATGCAGGAAGAAGG - Intergenic
947855345 2:233320238-233320260 TCTGGACGAATGAAGGAAGAAGG - Intronic
1170111620 20:12809846-12809868 CCTCATCAGATGAAGGAAGAAGG + Intergenic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1170962956 20:21041643-21041665 CCTCAGGAAATGAAGGGAGAGGG + Intergenic
1172987556 20:39004731-39004753 CCTCATCTAATGAAAGGAAAAGG - Intronic
1176205840 20:63887693-63887715 CCTCAATTAATCCAGGAATATGG - Intronic
1176625979 21:9092253-9092275 CCTCAGCTACTCAAGGAAGGAGG + Intergenic
1176820300 21:13650054-13650076 CCTCAGCTACTCAAGGAAGTAGG + Intergenic
1177897598 21:26872853-26872875 CCCCAAAAAATGAATGAAGAAGG + Intergenic
1178698264 21:34812698-34812720 CCTCATCTATTGAAGTATGAAGG - Intronic
1179077137 21:38133076-38133098 CCTCAATTATAGAAAGAAGAAGG + Intronic
1180365311 22:11933200-11933222 CCTCAGCTACTCAAGGAAGGAGG + Intergenic
1180478102 22:15730019-15730041 CCTCACCCACTGAAGGAAGTGGG + Intergenic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
952900882 3:38111157-38111179 CCTAATCTAGTGAAGCAAGAGGG + Intronic
953855378 3:46495740-46495762 TCTCAACTAGTGAGGGAAGAAGG - Intergenic
953868001 3:46600792-46600814 TGTCAACTAATAAATGAAGAGGG + Intronic
954946021 3:54425008-54425030 CCTCAGCTAGTGAAGGAACATGG + Intronic
955605458 3:60697215-60697237 TATCAATTAATGAAGGAAAATGG + Intronic
956743916 3:72296533-72296555 CCTCATCCAATCAAGGAGGAGGG - Intergenic
957680751 3:83430603-83430625 TCTCAAGTAAAGAAGGAAAAAGG + Intergenic
957853084 3:85836459-85836481 CCTCCACTATTGATTGAAGATGG - Intronic
959206081 3:103308812-103308834 CCTGTCCTCATGAAGGAAGATGG - Intergenic
960543274 3:118883918-118883940 CCACACAGAATGAAGGAAGATGG + Intergenic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
961218223 3:125178175-125178197 TCTCAACTAAAGAATGAAGGAGG + Intronic
961332078 3:126148337-126148359 CCTCAGCTCATGAAGGCATAGGG + Intronic
962828525 3:139120181-139120203 CCTCAACTCATGATGCAAAAGGG - Intronic
962910711 3:139847078-139847100 TCTCAACTATTGAAAGAAGGTGG - Intergenic
963110055 3:141681142-141681164 CCCCACCTAATGAAAGGAGAGGG - Intergenic
966212854 3:177470789-177470811 CATCAAACAGTGAAGGAAGATGG - Intergenic
966357996 3:179102684-179102706 CCACAAGTAATGTAAGAAGATGG + Intergenic
967588978 3:191249606-191249628 GCTCATCTAAAGAAGGATGATGG - Intronic
969380933 4:6797467-6797489 CCTCAACAAATGTATAAAGAGGG + Intronic
970084478 4:12331225-12331247 CATAAAATAATGAAGCAAGAAGG + Intergenic
970638863 4:18041103-18041125 CCTCACCTGATAAAGTAAGACGG + Intergenic
972443612 4:39121096-39121118 ACTAAATTAATAAAGGAAGACGG - Exonic
973056311 4:45663798-45663820 GCTCAACTAATGTGGGATGAAGG + Intergenic
974836579 4:67258493-67258515 TCTCAAATAATGAAGGATGATGG - Intergenic
974924865 4:68285036-68285058 CTTCTCCTAATGGAGGAAGAAGG - Intergenic
976538677 4:86247110-86247132 CTTAAAGTAAAGAAGGAAGAGGG + Intronic
976542993 4:86299450-86299472 CCTCACCTGATGAAGGAACAAGG - Intronic
977466227 4:97385144-97385166 CTTTAACTAAAGAGGGAAGAAGG + Intronic
978805237 4:112792741-112792763 ACTCAACTAAGCAGGGAAGATGG - Intergenic
979664544 4:123296012-123296034 TCCCAGCTAATGAATGAAGAAGG + Intronic
980177254 4:129361801-129361823 CATCAACTAAAGAAGAAAAATGG - Intergenic
1202762708 4_GL000008v2_random:125906-125928 CCTCAGCTACTCAAGGAAGGAGG - Intergenic
985766928 5:1785000-1785022 CCTCACCTCCTCAAGGAAGAAGG + Intergenic
987716101 5:21573612-21573634 GCTCATCAAATAAAGGAAGAGGG + Intergenic
990723160 5:58721578-58721600 CGTTTACTAATGATGGAAGAAGG - Intronic
990790653 5:59475039-59475061 CTTCAAGTCATGAAGGAAGAAGG + Intronic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
991056496 5:62326339-62326361 CCTCAAGGAATGAGGGAAGCTGG - Intronic
993184713 5:84602311-84602333 CCTCAACTAATGAAGTTGGACGG + Intergenic
993621326 5:90171420-90171442 CCTCAACTAATAAAAGCAAAGGG + Intergenic
993751247 5:91671087-91671109 ACTCCCATAATGAAGGAAGAGGG + Intergenic
994412961 5:99432383-99432405 TCTGAACTCATGAAGGAAGAGGG + Intergenic
994480878 5:100333336-100333358 TCTGAACTCATGAAGGAAGAGGG - Intergenic
995518182 5:112974836-112974858 CTTCAACCAATGAAGGAAGTTGG + Intergenic
997195565 5:131977022-131977044 CCTCTGCTCCTGAAGGAAGACGG - Intronic
997670715 5:135669604-135669626 CCTCAACTAATGACAGATGGTGG - Intergenic
997787443 5:136726416-136726438 GCTCAACTAATGTGGGAAAAAGG - Intergenic
999262289 5:150245436-150245458 CCTCAACCCATGAAGCCAGAGGG - Intronic
1000695450 5:164375588-164375610 CCTCAGCTAATGTGGAAAGAAGG - Intergenic
1003853560 6:10250013-10250035 CGTGAACTAATTAAGGGAGAAGG - Intergenic
1004867027 6:19863408-19863430 CCTCAATCAATTAAGGAAGGTGG - Intergenic
1005381375 6:25237493-25237515 ACTGAACTAATCAAGGAGGAAGG + Intergenic
1007105384 6:39280068-39280090 CCTGAATGAAGGAAGGAAGAAGG - Intergenic
1008410991 6:51179632-51179654 CATCAAATATTGAAAGAAGATGG - Intergenic
1009243009 6:61202552-61202574 CCTCCATTCATGAAGCAAGAGGG + Intergenic
1013916165 6:115339587-115339609 CCTCAGCTTATGAAGGTATATGG + Intergenic
1015911052 6:138168049-138168071 GCTGAATTAATGAAGTAAGAGGG - Intronic
1016524332 6:144984330-144984352 CATCAAACAATAAAGGAAGATGG - Intergenic
1017365790 6:153636071-153636093 CATCAACAAATGAATGAATAAGG - Intergenic
1020578784 7:9968753-9968775 CTTCAGCTTATGAAGGGAGAGGG - Intergenic
1021970576 7:25961822-25961844 GCTAAAATAATGAAAGAAGAGGG + Intergenic
1022024878 7:26438360-26438382 CTTCCACTCATGAAGCAAGAGGG + Intergenic
1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG + Intergenic
1022955561 7:35377031-35377053 CCATAACAAATAAAGGAAGACGG + Intergenic
1023119968 7:36899313-36899335 CCTCAACTAGAGCAGGAATAAGG - Intronic
1024003567 7:45208718-45208740 CATCAAATAATGAAGGACAATGG - Intergenic
1026641437 7:72129624-72129646 TCTCAAATAATATAGGAAGAAGG + Intronic
1026700387 7:72637138-72637160 TCTGAACTAATGAAGTGAGATGG + Intronic
1028610896 7:92710421-92710443 TCTCAACTAACCAAAGAAGAAGG + Intronic
1030063717 7:105643065-105643087 CCTAACCTAGTGAAGGCAGATGG - Exonic
1030361396 7:108598972-108598994 AAGCACCTAATGAAGGAAGAGGG - Intergenic
1031545342 7:123045376-123045398 CCACATCCCATGAAGGAAGAAGG - Intergenic
1032204240 7:129847795-129847817 CTTCACCTAATGAAGGGAGTAGG + Intronic
1034032145 7:147779272-147779294 CATCAACTAAGGATTGAAGACGG + Intronic
1035547351 8:493400-493422 CCTCTACAGATGAAGGATGAAGG + Intronic
1036214711 8:6869499-6869521 CCCCAACTAATAAATGAAAAAGG - Intergenic
1037411354 8:18601640-18601662 CCTCACCTAGTGGAGGCAGAAGG - Intronic
1038241201 8:25809228-25809250 CATCACCTGATGGAGGAAGATGG + Intergenic
1039327252 8:36499045-36499067 CCTCAACTCATGGTGGAAAATGG - Intergenic
1042498174 8:69479149-69479171 TCACATCTAATCAAGGAAGATGG - Intronic
1043477577 8:80620114-80620136 CCAGAACTAAGGAAGGAAGCAGG - Intergenic
1044989723 8:97785000-97785022 CCTCATCTAATAAAGGATCAAGG + Intronic
1046551776 8:115727374-115727396 CCCCAAATGATGAAGGCAGAAGG + Intronic
1049472361 8:142782219-142782241 ACTCCAGGAATGAAGGAAGAGGG - Intergenic
1051068598 9:13135407-13135429 CCTGAACTAAAGCTGGAAGAGGG - Intronic
1051486721 9:17616456-17616478 ACTGAGCTAATGAAGGAAGGTGG + Intronic
1052106380 9:24522119-24522141 CGTCAAAAAATGAAGGAACAAGG - Intergenic
1053091783 9:35285210-35285232 CCTGTGCTAATGGAGGAAGAAGG - Intronic
1053320157 9:37090865-37090887 CCACAACTTATTAAGAAAGAGGG - Intergenic
1054799035 9:69328420-69328442 ACTCAACAAATGTAGAAAGAAGG + Intronic
1055424162 9:76176263-76176285 CCTAAACTAATAAAAAAAGAAGG - Intronic
1055976705 9:81962627-81962649 CCTCAAATCATAAAGGAAGTTGG - Intergenic
1056020313 9:82432715-82432737 GCTCATCTAATGAAGGAAGTCGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057112590 9:92487520-92487542 TGTCAACTAATGAATGCAGAAGG + Intronic
1057597614 9:96428666-96428688 CCTCAGTTAGTGAAGGAACAAGG + Intergenic
1203527061 Un_GL000213v1:99497-99519 CCTCAGCTACTCAAGGAAGTAGG - Intergenic
1203749151 Un_GL000218v1:62674-62696 CCTCAGCTACTCAAGGAAGGAGG + Intergenic
1203543471 Un_KI270743v1:110787-110809 CCTCAGCTACTCAAGGAAGGAGG - Intergenic
1186322524 X:8444773-8444795 CTTCAACTTATAAAGCAAGATGG - Intergenic
1187814028 X:23211513-23211535 CCTCAGCAAAGGAAGGAACATGG + Intergenic
1187820729 X:23285190-23285212 CCTCAAGAAATGGAGGAACATGG - Intergenic
1187913077 X:24128534-24128556 CATCAACTAATGTATGCAGATGG - Intergenic
1188031197 X:25266134-25266156 CCTCACCGTATGAAGGTAGAGGG - Intergenic
1188365830 X:29313780-29313802 CCTCAAAGAATGAAGGGTGAGGG - Intronic
1189216360 X:39328166-39328188 TATTAGCTAATGAAGGAAGAAGG + Intergenic
1189888306 X:45572702-45572724 CATCAACAAATGAATGAATAAGG - Intergenic
1190053505 X:47169298-47169320 CCACCACTAGTGGAGGAAGAAGG - Exonic
1193078870 X:77384165-77384187 CTTCATCAAATGAAGGAATAAGG + Intergenic
1193339965 X:80335695-80335717 CCTTAACGGATGAAGGAAAAAGG + Exonic
1193444371 X:81581827-81581849 CCTCAACAAATCAAGAAAGCTGG + Intergenic
1194022836 X:88715119-88715141 GAGCAACTAATGAAGTAAGAGGG - Intergenic
1195345852 X:103950434-103950456 CCCAAACTAATGTAGGTAGAAGG + Intronic
1195447852 X:104974605-104974627 CATCAAATAAAGAAGGAAGCTGG + Intronic
1196134264 X:112189980-112190002 CCTCAATAAATGAAGAGAGAAGG - Intergenic
1197277628 X:124498270-124498292 ACTAAACTAATGTAGGAATAGGG - Intronic
1198438968 X:136643448-136643470 CCACAACTGATGAAGTAAGGAGG - Intergenic
1198751933 X:139944776-139944798 CCTCAACTCATAAGGGCAGAGGG - Intronic
1201162509 Y:11177687-11177709 CCTCAGCTACTCAAGGAAGGAGG + Intergenic