ID: 960886066

View in Genome Browser
Species Human (GRCh38)
Location 3:122396223-122396245
Sequence TGAAAAGATACCCATGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960886062_960886066 21 Left 960886062 3:122396179-122396201 CCAAATTAAATTTTTTTGTACTT 0: 1
1: 0
2: 21
3: 495
4: 4334
Right 960886066 3:122396223-122396245 TGAAAAGATACCCATGGAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 215
960886060_960886066 27 Left 960886060 3:122396173-122396195 CCTCACCCAAATTAAATTTTTTT 0: 1
1: 1
2: 10
3: 160
4: 1671
Right 960886066 3:122396223-122396245 TGAAAAGATACCCATGGAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 215
960886061_960886066 22 Left 960886061 3:122396178-122396200 CCCAAATTAAATTTTTTTGTACT 0: 1
1: 1
2: 7
3: 94
4: 1062
Right 960886066 3:122396223-122396245 TGAAAAGATACCCATGGAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960886066 Original CRISPR TGAAAAGATACCCATGGAGT GGG Intronic
906317087 1:44793390-44793412 TGACAATATAGCCAGGGAGTGGG - Intergenic
908623389 1:66011434-66011456 TAAAAAGATAGCCATGGTTTTGG - Intronic
909744976 1:79083647-79083669 TGATATGATACTCATGGAGTTGG - Intergenic
910738031 1:90483682-90483704 TGAAAGGAAACCTATGGAATGGG + Intergenic
911684034 1:100753261-100753283 TGAAAAGGCACCTATGGAATTGG - Intergenic
912579251 1:110705386-110705408 TGAAAAGATACCCAAAAATTTGG - Intergenic
913676151 1:121142577-121142599 TGAAAAGCAACCTATGGACTAGG - Intergenic
915845777 1:159263124-159263146 TGAACAGATAACCAGGGATTGGG - Intergenic
917712588 1:177701804-177701826 TGAAAGGATGCCCATGTAGTGGG + Intergenic
918017904 1:180655351-180655373 TGAAAAGCAACCCATTGAATGGG - Intronic
918623500 1:186632308-186632330 TGAATGGATACCCATATAGTTGG + Intergenic
918803513 1:189006127-189006149 TGCAAAGAAACCCACTGAGTAGG + Intergenic
919089794 1:192964425-192964447 TGAAGAGACACCTATGGAATAGG + Intergenic
919543195 1:198877032-198877054 TGAAAAAATTCACATGAAGTTGG - Intergenic
919867781 1:201795307-201795329 TGAATATAAACGCATGGAGTGGG - Intronic
920463519 1:206161415-206161437 TGAAAAGCAACCTATGGACTAGG - Intergenic
920963619 1:210684563-210684585 TGCAGAGATACTAATGGAGTAGG - Intronic
921420739 1:214945005-214945027 TGTAAACGTACCTATGGAGTTGG + Intergenic
921665652 1:217867774-217867796 TGTAAAGATACACATGGGATGGG - Exonic
921690608 1:218144868-218144890 TAAACAGAAACCCATAGAGTGGG + Intergenic
924143823 1:241053278-241053300 TGAACAGACACCCATGCTGTAGG + Intronic
924546032 1:245028934-245028956 TGGTATGATTCCCATGGAGTGGG + Intronic
1064963718 10:20994341-20994363 TTGAAAGATCCCCCTGGAGTTGG - Intronic
1065267431 10:23992396-23992418 TGAAAAGATGGCAATGGGGTAGG - Intronic
1065677069 10:28187652-28187674 TTATAAGATACTCATGGAATAGG - Intronic
1066685126 10:37974326-37974348 TGAAAAGACACCCAAAGAATAGG + Intronic
1068676950 10:59778468-59778490 TGAAAAGATACCCAAAAATTTGG - Intergenic
1069769180 10:70886976-70886998 TGAAAAGATACCCTTAGGGGTGG + Intronic
1073227207 10:101931962-101931984 TGAAAGGCAACCCATGGAATGGG + Intronic
1074048987 10:109865760-109865782 TCAAAAGACACCCATGGGCTTGG - Intronic
1075306024 10:121367999-121368021 CGAAAAAATAACCATGAAGTGGG + Intergenic
1077875128 11:6298309-6298331 TGACAAGATTTCCTTGGAGTGGG + Intergenic
1078152701 11:8772855-8772877 TGTAAGCATACCCAAGGAGTTGG - Intronic
1081007191 11:37759726-37759748 GGAAAAAATAGCCATGGTGTAGG - Intergenic
1081125101 11:39312114-39312136 TGGAAAGGAGCCCATGGAGTGGG - Intergenic
1081644349 11:44779210-44779232 TGAGAACACAGCCATGGAGTGGG - Intronic
1083108190 11:60378714-60378736 TGAAAAGACAGCCAGGGAATTGG + Intronic
1083121978 11:60521767-60521789 TGAAAAGATACCCAAAAATTTGG - Intronic
1084283512 11:68116102-68116124 TGAAAAGAAAACCATTGAGGAGG - Intronic
1088139641 11:106600157-106600179 TGAAAAGGCAACCATGGAATGGG + Intergenic
1088399861 11:109411700-109411722 TGAAAAGATTTCCTAGGAGTGGG + Intergenic
1090761718 11:129842851-129842873 AGTAAAGATACCCATAGAATGGG + Intronic
1091386733 12:100730-100752 TGAGAAGTTCCCCATGCAGTGGG + Intronic
1093138839 12:15483263-15483285 TGAAAAGTCATCCATGGAATTGG - Intronic
1096632421 12:52936921-52936943 TGAAAAGATAGCCACAGACTGGG + Intronic
1097291728 12:57922320-57922342 TGAAAAGTTAGCCATGGTGGTGG + Intergenic
1098022692 12:66172109-66172131 TGAAAAGGAAGCCATAGAGTAGG + Intergenic
1098544838 12:71700308-71700330 TGAAAAGAAATGCATGCAGTAGG + Intronic
1100054366 12:90491057-90491079 TGAAAAGATACCCAAAGATGTGG + Intergenic
1101224937 12:102678732-102678754 TGAAAATATTCCAATGGAATTGG - Intergenic
1102891211 12:116559803-116559825 TCAAAAGGTACCCATGGGGAGGG + Intergenic
1105941355 13:25150792-25150814 TGGAAAGAGAGCCAGGGAGTGGG - Intergenic
1106017940 13:25886653-25886675 GGAAGAGATTTCCATGGAGTGGG - Intronic
1108186927 13:47897362-47897384 TGGAAAGAAGCCCATGGTGTAGG + Intergenic
1108784099 13:53873417-53873439 AGAAAAGATAACCATGCAGTTGG - Intergenic
1111898725 13:94173990-94174012 TAAGAAGATATCAATGGAGTAGG - Intronic
1112044105 13:95578352-95578374 TGAAAAGAAACATAAGGAGTGGG - Exonic
1112118109 13:96379534-96379556 TGACAAGATACCCATAGATTGGG - Intronic
1114577942 14:23730300-23730322 TGGAAAGATTCCCTTGGAGAGGG - Intergenic
1115112474 14:29840513-29840535 TGAAAAGATACCCATAAATGTGG - Intronic
1119581369 14:75785023-75785045 TGAAAAGATAACCATCAAGTAGG - Intronic
1120858698 14:89235200-89235222 TGAAAACATCACCATGGAGAGGG + Intronic
1121276057 14:92668451-92668473 TGAAGAGAAACCCAGGGAGCTGG + Intronic
1121856170 14:97272166-97272188 TGAAAAGATCCCCAGGTAATTGG - Intergenic
1124341248 15:28890437-28890459 TGGAAAGATCCAGATGGAGTGGG - Intronic
1124955750 15:34359252-34359274 TGAAGAGTTTCCCATAGAGTGGG + Exonic
1124982485 15:34579368-34579390 TGGAAAGATCCAGATGGAGTGGG + Intronic
1126604942 15:50466756-50466778 TGGAAAAACACCCATGGAGCCGG + Intronic
1126780222 15:52133442-52133464 TGACAAGAAAGCCATGGTGTGGG - Exonic
1127648165 15:60978456-60978478 TGAAAAGCAACCCATAGAATAGG - Intronic
1129576814 15:76758031-76758053 TGAAAAGACAGCTATGGAATGGG - Intronic
1130693062 15:86103520-86103542 TGAAGACATACCAATGGTGTTGG + Intergenic
1130890025 15:88125810-88125832 TGAAAAGCTGCCCATGCAATGGG - Intronic
1131751812 15:95517672-95517694 TGAAGAAATACCCATGAATTTGG - Intergenic
1132824082 16:1894343-1894365 TGAAAAGATGGCCATCGAGGAGG + Intergenic
1133741267 16:8653338-8653360 TTGAAAGAGACCTATGGAGTTGG + Intergenic
1136252717 16:29016746-29016768 TGAAAAGCAACCTATGGAATGGG - Intergenic
1136483896 16:30558807-30558829 TGTAAAAAAACCAATGGAGTGGG + Intergenic
1137254851 16:46766350-46766372 TCAAAATATTCCCATGCAGTAGG - Intronic
1138638545 16:58364035-58364057 TGCACAGATACCTGTGGAGTGGG + Intronic
1138783941 16:59823193-59823215 TGAAAAGTTAAGCATGGAGTAGG + Intergenic
1139043704 16:63031440-63031462 TGATAAGATAGCCATGGTGGTGG + Intergenic
1144441615 17:15287600-15287622 TGAAAAGCAACCCAGGGAGTGGG - Intergenic
1146543503 17:33718477-33718499 TGAGAAGATGCCCTTGTAGTAGG + Intronic
1148102856 17:45103280-45103302 TGAAAAGATACCTCTGGATCTGG + Intronic
1151105992 17:71617981-71618003 TGAAAAGATACCCAAAGATGTGG + Intergenic
1152005646 17:77678684-77678706 TCACAACATCCCCATGGAGTGGG - Intergenic
1153233769 18:2966421-2966443 TTCACAGATACCCATGGATTTGG + Intronic
1153497352 18:5713067-5713089 TTAAAAGATACCCAAGCATTAGG + Intergenic
1153611972 18:6895281-6895303 GGAAAAGATACCGAGGGATTTGG - Intronic
1154130452 18:11732573-11732595 TGAACAGATACCCATGGGTGAGG - Intronic
1154404330 18:14074836-14074858 TGAAAAGATACCCAAAAATTTGG - Intronic
1158479668 18:57810369-57810391 TGAAAATATACACAAGAAGTTGG + Intergenic
1159962532 18:74566797-74566819 TGAAAAGATACCCAAAAATTTGG - Intronic
1160333966 18:78020381-78020403 TGAACAGATAACCATGGTTTGGG - Intergenic
1160449354 18:78951685-78951707 TGAAAACAGACCCATGCAGGTGG - Intergenic
1161371359 19:3913707-3913729 TGAAATGCAACCCATGGGGTGGG - Intronic
1161866612 19:6837121-6837143 TGGAAAGACACCCCCGGAGTTGG + Intronic
1162864273 19:13532340-13532362 TGAAAATAAACTTATGGAGTGGG + Intronic
1164014610 19:21242342-21242364 TGAACTGCTACCCATGGAGCTGG - Intronic
1165913335 19:39243442-39243464 GGAAAAGACACCCATGACGTGGG - Intergenic
1166356258 19:42229320-42229342 TGTAAAGATGCCCCTGGAGTGGG + Intergenic
1166581823 19:43907552-43907574 TGACAAGATACCCACTGAATGGG + Intergenic
1168578892 19:57536792-57536814 TGAAAACAAACCCATGGCCTGGG + Intronic
926893755 2:17661542-17661564 TGTAAAGTTACCCATCAAGTAGG + Intergenic
928190303 2:29159195-29159217 GGAAAATAAACCCATGGAGAAGG - Intronic
929197647 2:39202467-39202489 TGAAAAGCAACCCATGGAAAGGG - Intronic
930715055 2:54585891-54585913 TGAAAATATAACCGTGGATTGGG + Intronic
935107475 2:100058834-100058856 TGAAAAGATACACACAGAATGGG + Intronic
935284874 2:101555751-101555773 TGAAAAGATTTCCAGGGAGACGG - Intergenic
935468040 2:103422791-103422813 AGAAAAGGAACCCATGGAGAAGG - Intergenic
935599994 2:104913024-104913046 TGAAAAGAAAAACATGTAGTGGG + Intergenic
935840000 2:107098703-107098725 TCAAGAGATACCTAAGGAGTGGG + Intergenic
938099383 2:128487888-128487910 AGAGAAGAGACCCATGGGGTTGG - Intergenic
939168559 2:138666718-138666740 TGAAAGGATACCCATATAGCTGG + Intergenic
940407103 2:153317320-153317342 TTTAAAGATACAAATGGAGTGGG - Intergenic
941925184 2:170887239-170887261 TAAAAAGCTACCCATTGGGTTGG + Intergenic
943671556 2:190666912-190666934 TGAAAATATTCCCAAGCAGTTGG - Intronic
943805178 2:192115538-192115560 TGAAAAGCAACATATGGAGTGGG + Intronic
1169182998 20:3587164-3587186 TGAAAAGAAACCCATATAATGGG - Intronic
1169549728 20:6690142-6690164 TTAACAAATACCCATGTAGTAGG + Intergenic
1169602340 20:7275998-7276020 TAAAAAGAGACCCATGGGATGGG + Intergenic
1173440218 20:43068818-43068840 TGAAAAGATAGCCATGGAAAGGG + Intronic
1175519973 20:59596071-59596093 AGAATAGCTACCCATGGAGGAGG - Intronic
1178635985 21:34304284-34304306 TGAAGAGACACCCATAGAGTAGG + Intergenic
1178756721 21:35357124-35357146 AGAAAAGCTACCCTTTGAGTTGG + Intronic
1182523856 22:30903175-30903197 TGAAAGGAAACACCTGGAGTCGG - Intronic
1183611557 22:38910619-38910641 TGGAAACAAACCCATGGTGTTGG - Intergenic
949956513 3:9273532-9273554 TGAAAAGGCAATCATGGAGTGGG - Intronic
951107927 3:18767598-18767620 AGAAAAAATACCCAGGAAGTTGG - Intergenic
951378817 3:21957306-21957328 TGAAAAGATACCCATAAATGTGG + Intronic
953468185 3:43143017-43143039 TAAAAAGATACTAATTGAGTGGG + Intergenic
953650053 3:44794391-44794413 CAAAAAGATACCCATGCAGAAGG + Exonic
954264376 3:49461367-49461389 GGAAAGGAAACCCATGGACTGGG - Intergenic
955042274 3:55329275-55329297 TGAAAAGAAACACATGTGGTAGG - Intergenic
958860133 3:99436338-99436360 TGAATTGGTACCCATAGAGTGGG + Intergenic
958929540 3:100194294-100194316 TGAAAGGATAACCATTCAGTTGG - Intergenic
958985045 3:100770678-100770700 TAACAAGATACCCTGGGAGTGGG - Intronic
959011487 3:101082203-101082225 TGAAAAGTAAACCAAGGAGTTGG + Intergenic
960564516 3:119119127-119119149 TGAAAAGATACCCAAAAATTTGG - Intronic
960886066 3:122396223-122396245 TGAAAAGATACCCATGGAGTGGG + Intronic
961908619 3:130289766-130289788 TGAAAAGACACCCACAGAATAGG - Intergenic
963680258 3:148365478-148365500 TGTAAAAATACACATGAAGTTGG + Intergenic
964371776 3:156007905-156007927 AGCAAAGACACTCATGGAGTTGG + Intergenic
966135474 3:176693376-176693398 TGAAAAGATAGCACTTGAGTTGG - Intergenic
970034335 4:11715442-11715464 TCAAAACAAACCCATGGAGATGG - Intergenic
973068744 4:45830900-45830922 TAAACAGATACCCACTGAGTGGG - Intergenic
974481831 4:62454234-62454256 AGAAAAATTACCCATGGAGCTGG + Intergenic
974769803 4:66397331-66397353 TGAAGAGACAACCATGGAATGGG - Intergenic
975175053 4:71278900-71278922 TGAAAAGCAACCTATGGAATGGG - Intronic
977330218 4:95628368-95628390 TCAGAAGATCCCCATGGAATGGG + Intergenic
982439455 4:155418304-155418326 TGAAGAGATACCTCTTGAGTGGG - Intergenic
982712521 4:158771034-158771056 TGAAAATGTTCCCATGAAGTGGG - Intronic
984542687 4:181060317-181060339 TGAAGAGATATCCTTTGAGTTGG + Intergenic
988024546 5:25668335-25668357 TGAAATGATATACATGGATTAGG - Intergenic
988818072 5:34853745-34853767 TGAGGAGAGACCCATGGATTTGG + Intronic
989575556 5:42984580-42984602 TGAAAAGATATCCAGGAAGCAGG - Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991076723 5:62547764-62547786 TGTAAAGATTCCTATGGATTGGG + Intronic
993685701 5:90934571-90934593 TGACATGATACCCATGGACAAGG - Intronic
994687797 5:102977594-102977616 TGAAAGGAGACCCATCAAGTAGG + Intronic
995019229 5:107347979-107348001 TGAAAAGATACCCCTGGACTGGG + Intergenic
995268940 5:110199006-110199028 TGAAAAGACAACCATGAAATGGG + Intergenic
995537862 5:113155388-113155410 TGAACAAATACCCAAGTAGTGGG + Intronic
996005328 5:118414164-118414186 TGAAAAGACAACCATAGAATGGG + Intergenic
999963368 5:156781123-156781145 TGAAAATTTACCCTTGGAGGAGG + Intergenic
1000243402 5:159429192-159429214 AGATAAGGTAACCATGGAGTGGG + Intergenic
1003992760 6:11502943-11502965 TGAAAAAATTCCCAAGGATTTGG - Intergenic
1005304756 6:24503137-24503159 TATAACGATACCCATAGAGTGGG - Intronic
1005461505 6:26073759-26073781 GGAAAATATTCCCAGGGAGTGGG + Intergenic
1005911586 6:30314765-30314787 TGGACATATACCTATGGAGTTGG - Intergenic
1006045755 6:31296146-31296168 TGAAAAGAAACTCATTGAATGGG + Intronic
1007391768 6:41553505-41553527 TGGATGGATACCCATGGACTGGG + Intronic
1008035504 6:46741283-46741305 GTAAAGGATACCCATGGAGGTGG - Intergenic
1008171163 6:48207777-48207799 TGAAAAGTGACACATGGAGGGGG + Intergenic
1010370628 6:75103101-75103123 AGAAAAGATGCCCATGGATGAGG + Intronic
1011704703 6:89989440-89989462 TGAAAATAAACCCAGGGAGGTGG + Intronic
1012196107 6:96342862-96342884 TGAAAAGATACCCAAAAATTTGG - Intergenic
1015215113 6:130741111-130741133 TGAAAAGTTAACCATGAAGTGGG + Intergenic
1017025621 6:150178153-150178175 CGACAAGATACAGATGGAGTAGG - Intronic
1017037472 6:150279441-150279463 TAAAAAGAAACACATGGAGGGGG - Intergenic
1017857659 6:158365179-158365201 TGAAAAGAAACACATCTAGTAGG - Intronic
1021432527 7:20576814-20576836 TGATAAGATTCCCAAGGAATAGG - Intergenic
1021746262 7:23744614-23744636 TGAAGATGTACCCATGGTGTTGG + Intronic
1022054363 7:26714218-26714240 TGAAAAGAGGCCCATGCAGGAGG + Intronic
1022136929 7:27457752-27457774 TGAAAGGAAACTCCTGGAGTTGG + Intergenic
1022993065 7:35727264-35727286 TTAAAAGGTACCCATGGCGCAGG - Intergenic
1026926213 7:74195697-74195719 TGAAAGGAAACGCCTGGAGTTGG - Exonic
1027911065 7:84251570-84251592 TGAAAGGCTATTCATGGAGTGGG + Intronic
1029899970 7:104028851-104028873 TGAAAAGATAACAATGGCATGGG + Intergenic
1031148844 7:118029078-118029100 TGAAAACATCCCCATGAGGTAGG - Intergenic
1031889200 7:127274516-127274538 TTAAAAGAGACCCATGGATGTGG - Intergenic
1032665695 7:134034103-134034125 TGAAAAGGTAACCATGAAGCAGG + Intronic
1032737094 7:134702491-134702513 AGAAACAATACCCATGCAGTTGG + Intergenic
1033832962 7:145275695-145275717 TGAAAAGATACCCAAAGATGTGG + Intergenic
1033871612 7:145761526-145761548 TGAAAAGATACCCAAAAATTTGG + Intergenic
1035347339 7:158211414-158211436 TGAAGAGATACCCACAGAATAGG + Intronic
1036187024 8:6631382-6631404 TGAAAAGCAATCTATGGAGTAGG + Intronic
1038997745 8:32944959-32944981 TGAAAATGTATCCATGGTGTTGG + Intergenic
1039091645 8:33836140-33836162 CGAAAAGATACCCAGATAGTTGG + Intergenic
1041801198 8:61802078-61802100 TGACAAGAACCCCATGGGGTTGG + Intergenic
1042471571 8:69195595-69195617 TGAAAAGATGCCCTTGATGTGGG + Intergenic
1042600676 8:70496317-70496339 TGAATAAATACACATGGATTAGG + Intergenic
1044903117 8:96970414-96970436 TGAAAATAAACCCAAGCAGTAGG + Intronic
1046045344 8:108957129-108957151 TGAAAAGAAAACCATGGACTGGG + Intergenic
1047929796 8:129715742-129715764 TGAAAAAATACCCCTGGAAGTGG + Intergenic
1049438335 8:142597918-142597940 TGATAGGATAAGCATGGAGTTGG + Intergenic
1050655638 9:7825737-7825759 TGAAAAGAAAACCATGCACTTGG + Intronic
1051362324 9:16292150-16292172 TGCAAGGAGACCAATGGAGTTGG + Intergenic
1052227006 9:26101827-26101849 GGAAAAGATACATATGGAGTAGG + Intronic
1052276308 9:26680414-26680436 TGAAACAATTCCCATGGACTAGG - Intergenic
1052954274 9:34241199-34241221 GGAAAAGAAAACCATTGAGTGGG + Exonic
1052980271 9:34443348-34443370 GGAAGAGATTCCCATTGAGTGGG - Intronic
1055828150 9:80351346-80351368 TGTAAAGTTTCCAATGGAGTTGG + Intergenic
1056913426 9:90724669-90724691 TGAAAAGATGACCATGGTGGAGG + Intergenic
1057742476 9:97724003-97724025 TGAGAACCTACCCATAGAGTAGG + Intergenic
1186748741 X:12599028-12599050 TGAAAAGAACCCCATGGTTTTGG - Intronic
1186907029 X:14121907-14121929 TGCAAGTATACCCATGGAGGAGG + Intergenic
1187101786 X:16200293-16200315 TGACAAGATTCCCAAGGAATAGG + Intergenic
1187263686 X:17710907-17710929 TGCAAAGGTTCCCTTGGAGTGGG + Intronic
1189058655 X:37728120-37728142 TGAAAAGATACCACAGGAGGAGG - Exonic
1192797726 X:74438052-74438074 GGAAAAGATAGCCTTGGAGTGGG + Intronic
1193873612 X:86833219-86833241 TCAAAAGATAGGCAAGGAGTGGG - Intergenic
1193963898 X:87959775-87959797 TGAAAAACAACCTATGGAGTGGG + Intergenic
1194941403 X:100015581-100015603 TGAAAAGATACCCAAGAATGTGG + Intergenic
1195496672 X:105543358-105543380 TTAAATGATTCCTATGGAGTTGG + Intronic
1195903006 X:109818075-109818097 TGAAAGCATACCCTTGGAGCAGG - Intergenic
1199236104 X:145496124-145496146 TGAAAGGAAACCCAAGAAGTTGG - Intergenic
1199309759 X:146308926-146308948 GGAAAACATACCCATAGAGATGG + Intergenic
1201334641 Y:12867688-12867710 AGAAAAGTTAGACATGGAGTGGG + Intergenic
1201611749 Y:15851003-15851025 TGACAAGATACCAATGATGTGGG - Intergenic