ID: 960886939

View in Genome Browser
Species Human (GRCh38)
Location 3:122405616-122405638
Sequence ACTATTAGGCAGACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2998
Summary {0: 1, 1: 0, 2: 6, 3: 124, 4: 2867}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960886939_960886950 28 Left 960886939 3:122405616-122405638 CCTTCCTCAGTCTGCCTAATAGT 0: 1
1: 0
2: 6
3: 124
4: 2867
Right 960886950 3:122405667-122405689 TACTACCTCACGAATCACTCTGG 0: 1
1: 0
2: 1
3: 3
4: 39
960886939_960886943 -2 Left 960886939 3:122405616-122405638 CCTTCCTCAGTCTGCCTAATAGT 0: 1
1: 0
2: 6
3: 124
4: 2867
Right 960886943 3:122405637-122405659 GTTGGTTCCAAGATCCCCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960886939 Original CRISPR ACTATTAGGCAGACTGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr