ID: 960889018

View in Genome Browser
Species Human (GRCh38)
Location 3:122426664-122426686
Sequence ATGTGGCTCCCTTTTTCTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960889018_960889022 16 Left 960889018 3:122426664-122426686 CCACAAGAAAAAGGGAGCCACAT 0: 1
1: 1
2: 0
3: 21
4: 216
Right 960889022 3:122426703-122426725 CCATAACTCTAATGTAAGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960889018 Original CRISPR ATGTGGCTCCCTTTTTCTTG TGG (reversed) Exonic
903253920 1:22078986-22079008 ATGTGTCTCCACTTTTCTTGTGG + Intronic
904674388 1:32189840-32189862 ATGTGCCTGCATTTTTCTAGGGG + Intronic
907683409 1:56586133-56586155 ATATGGCACCCTCTTTCTGGTGG - Intronic
907796527 1:57723728-57723750 TTGTGGCTACATTTTTCTGGAGG + Intronic
908070497 1:60454871-60454893 CTTTGGCTCCCTTTGTCCTGGGG - Intergenic
909985253 1:82153944-82153966 ATGTGGCTCCTTCTTTCATGTGG + Intergenic
910446529 1:87303682-87303704 ATCTGGCTCACCTTTTCCTGTGG + Intergenic
912543077 1:110431514-110431536 GAGTGGCTCCCTCTTTCCTGCGG + Intergenic
912582173 1:110730439-110730461 CTGTGGCTCTCTTTGTCTTGTGG + Intergenic
917484799 1:175446057-175446079 TTGTGGCTCTTTTTTTCTTATGG + Intronic
919039583 1:192366104-192366126 AAATGGCTCCCTTTTTTGTGAGG + Exonic
919438660 1:197598052-197598074 ATGTGGCTCACATTTTATTTTGG + Intronic
919822990 1:201484557-201484579 ATCTGGCTCCCTTTGGTTTGGGG - Exonic
920265527 1:204719421-204719443 ATGAGTTTCCCTTTTTCTTGAGG + Intergenic
920656445 1:207879078-207879100 TTGTGGATCCCTTGTTCTGGGGG - Intergenic
921198784 1:212783680-212783702 ATTTGGGTCCAATTTTCTTGTGG + Intronic
921583692 1:216924591-216924613 ATGTGGCTCACTTTTCCCTGTGG - Intronic
922083686 1:222324673-222324695 TTGTGGTTGCCCTTTTCTTGCGG + Intergenic
922692877 1:227709870-227709892 ATGTGGCTGCCTTTTTATGAAGG - Intergenic
923385877 1:233464845-233464867 ATGTAGCTCTGTTTTCCTTGGGG + Intergenic
924786158 1:247201970-247201992 ATGTGTCTCCTCTTTTCTTCTGG - Intergenic
1063247890 10:4242175-4242197 GTTTGGCTCCCTTTTTCTGGAGG - Intergenic
1065521853 10:26580835-26580857 CAGTGGTTCCCTTTTTCTTGGGG - Intergenic
1065527642 10:26639009-26639031 CAATGGTTCCCTTTTTCTTGGGG - Intergenic
1065528344 10:26644450-26644472 CAGTGGTTCCCTTTTCCTTGAGG - Intergenic
1065558891 10:26943092-26943114 CTGTGGTTCCCTTTTCCTTGAGG + Intergenic
1066286020 10:33966820-33966842 AGGTGGCTCCCTTATTTGTGGGG + Intergenic
1068558580 10:58485796-58485818 ATGTAGCCTCCTTTTTCTTTTGG - Intergenic
1069821991 10:71234025-71234047 ATATGGCTCCCTTCTTTTTACGG + Intronic
1071563094 10:86658173-86658195 CTGGGGCTCCCTTTTGCTGGAGG + Intronic
1073970241 10:109039861-109039883 CTGGAGCTCCCTTTTTCTTTTGG - Intergenic
1075351800 10:121730924-121730946 ATGTGGCTCCCTCTCCCCTGTGG + Intergenic
1077556656 11:3229168-3229190 ATGGGGCTCCCTGTTGCTAGTGG + Intronic
1077858813 11:6157198-6157220 AAGTGACTCCCTTCTGCTTGAGG + Intergenic
1078993408 11:16671628-16671650 ACGTGACTCCATATTTCTTGGGG - Intronic
1079182264 11:18204270-18204292 ATTTGACTCCCTTTATCCTGGGG - Intronic
1081213494 11:40365042-40365064 AAGTGGTTTCCTTTTTCTTGTGG - Intronic
1081407176 11:42711168-42711190 ATCTGACTCCCTTTTTCTGTAGG - Intergenic
1082894346 11:58174153-58174175 ATGTGGCTTGCTTTGTCTTGTGG + Intronic
1084657059 11:70525797-70525819 ATGTGGCTCCTTTAGTTTTGTGG + Intronic
1085610554 11:77944976-77944998 ATTTTGGTCCCTTTTTGTTGTGG - Intronic
1085731790 11:79006263-79006285 AGGTGCCACCCATTTTCTTGGGG - Intronic
1085760771 11:79239328-79239350 ATATGACTCCCTTTTCCTTCTGG - Intronic
1087406316 11:97735288-97735310 ATGTGGCTCCTATTATTTTGTGG - Intergenic
1087668638 11:101080114-101080136 TTGTGGTTCCCTTCTCCTTGGGG + Intronic
1089551546 11:119282935-119282957 ATGTGGCTTTTTTTTTTTTGGGG - Intronic
1090814986 11:130285027-130285049 CTGTGGCTCCTTCTATCTTGCGG + Intronic
1092385872 12:8035174-8035196 ATGTGGCTCTCTGTTTCAAGTGG + Intronic
1092735954 12:11583150-11583172 ATGTGTCTCCCTAATTCTGGAGG + Intergenic
1093335760 12:17903175-17903197 ATGTTTCTCACTTTTTCCTGTGG + Intergenic
1095610901 12:44126903-44126925 ACATGGCTCTCTTTTTCTTCTGG - Intronic
1096839868 12:54373672-54373694 TGGTGGTTCTCTTTTTCTTGGGG + Intronic
1099390212 12:82070232-82070254 ATTTGGTTCCCTGTTTCTTATGG + Intergenic
1100633108 12:96407874-96407896 ATGTTACTCCCTTTTTCCTTTGG - Intergenic
1102688273 12:114741006-114741028 GTGGGGCCTCCTTTTTCTTGGGG + Intergenic
1102911731 12:116720251-116720273 CTGCGGCTCCTTTTTTCTTTCGG - Intronic
1103727485 12:123005273-123005295 ATGTGGACCACTGTTTCTTGAGG + Exonic
1106659000 13:31778904-31778926 ATCTTGCTCCCTTATTCTTTTGG + Intronic
1106927732 13:34631033-34631055 AGGTGGTTTCCTTTTCCTTGTGG - Intergenic
1107395924 13:40017533-40017555 ATGTGGCTTGCATTTTCATGTGG + Intergenic
1107524260 13:41214334-41214356 AAGTGACTCCCTTCTGCTTGAGG - Intergenic
1108280148 13:48852980-48853002 ATGGGGCTGCCTTTTTCTGGAGG + Intergenic
1108384963 13:49890748-49890770 TTGCTGTTCCCTTTTTCTTGTGG + Intergenic
1108417078 13:50208898-50208920 ATGTGGATCCCTTGTGCCTGAGG + Intronic
1109126881 13:58528772-58528794 TTGCTGTTCCCTTTTTCTTGTGG + Intergenic
1110013238 13:70365614-70365636 AGGTTGCTCACTTTTTCTGGAGG - Intergenic
1110110281 13:71736626-71736648 ATTTGACTCCCTCTTTCTTACGG - Intronic
1110560499 13:76906639-76906661 ATGCGGCTCCCTTCTACTTCTGG + Intergenic
1111313416 13:86518720-86518742 ATGTGGCTCTATTTATGTTGAGG - Intergenic
1111725910 13:92008605-92008627 ATGTAGTTCCATTTTTCTTCTGG + Intronic
1113055679 13:106264534-106264556 ATGTGCCTTTCTTTTTCCTGTGG - Intergenic
1116012470 14:39367137-39367159 CTTTGGCTCCCTTTGTCCTGGGG + Intronic
1118088187 14:62442322-62442344 ATTTGGGTCCTTTTTTGTTGGGG + Intergenic
1119182593 14:72614672-72614694 ATTCAGCTCCCTCTTTCTTGAGG - Intergenic
1121404081 14:93708108-93708130 AAGGGGCTTCCTTTTTCTTCTGG + Intergenic
1121491640 14:94365262-94365284 CTGAGGCTCCCTTGCTCTTGAGG - Intergenic
1121494386 14:94381839-94381861 CTGAGGCTCCCTTGCTCTTGAGG - Intronic
1122402770 14:101477009-101477031 TGGTGGCTCCCTCTTTCTTTCGG - Intergenic
1123965912 15:25457569-25457591 ATTTGTCTTCCTTTTTTTTGCGG - Intergenic
1124822222 15:33057739-33057761 AAGTGCTTCCCTTTATCTTGGGG + Intronic
1124883267 15:33661258-33661280 ATGTTGCTCCCTTGTTTGTGTGG - Intronic
1126080293 15:44954412-44954434 TTGTGGTTCCCTTTTTCTTTAGG - Intergenic
1128462527 15:67881970-67881992 GTGTACCTCCCTTATTCTTGAGG + Intergenic
1128578897 15:68795285-68795307 ACGTGGATGCTTTTTTCTTGGGG - Intronic
1128693594 15:69744063-69744085 ATCTGCCTCCCTATTTCATGAGG - Intergenic
1128888133 15:71307083-71307105 ATTTGCCTTCCTTGTTCTTGGGG + Intronic
1129276377 15:74448428-74448450 ATGTGGCTTCCTTGTTATTTTGG - Intronic
1130576463 15:85097245-85097267 TGGTGACTCCCTTTATCTTGGGG - Intronic
1133420751 16:5644515-5644537 ATGTGGCTCCCTCTGACATGAGG + Intergenic
1134246665 16:12545317-12545339 ATGTGACACCCTTTCTCTGGTGG - Intronic
1135878758 16:26231426-26231448 ATGTGGCTCCCTTCTTTTAAAGG - Intergenic
1138416538 16:56874818-56874840 ATGTGCATTCCTTTTTTTTGCGG - Intronic
1140608985 16:76575577-76575599 TTGTGGCTCCCCTTTTGTTTTGG + Intronic
1141883567 16:86875960-86875982 ATGTGTATCCATTTATCTTGAGG - Intergenic
1143377739 17:6477339-6477361 ATGTGGCTTCCTGTGTCTTTTGG - Intronic
1144509231 17:15860972-15860994 TCGTGGTTCCCTCTTTCTTGGGG - Intergenic
1144529538 17:16023164-16023186 AAGTGTTTCCATTTTTCTTGTGG + Intronic
1144602360 17:16628273-16628295 TTTTGTCTCCCTTTTTTTTGGGG - Intronic
1144631886 17:16877775-16877797 ATGTGGCTCCATCTCTCTTCTGG - Intergenic
1145173349 17:20678617-20678639 TCGTGGTTCCCTCTTTCTTGGGG - Intergenic
1146691209 17:34877451-34877473 AGCTTTCTCCCTTTTTCTTGAGG - Intergenic
1146978635 17:37138830-37138852 CTCTGGCTCTCTTTTTCTTCTGG + Intronic
1147266816 17:39239430-39239452 ATGTGGCTCCCTTCCTCAGGAGG + Intergenic
1150628828 17:66861988-66862010 TGGTGGCTCCCTTCATCTTGGGG + Intronic
1151654030 17:75487191-75487213 CAGTGGCTCCCTTTTGCTTATGG + Intronic
1153440828 18:5117459-5117481 ATATGGGGCCCTTTTACTTGTGG - Intergenic
1154082645 18:11273585-11273607 TTGGGCCTCCCTTCTTCTTGGGG - Intergenic
1154150578 18:11903324-11903346 CTGTGGCTTTCTTTTTCCTGTGG - Intronic
1156432551 18:37091848-37091870 CTTTGGCTCCCTTTGTCCTGGGG - Intronic
1157020542 18:43775932-43775954 GTGTGGCTCCCTGTTTCTCTTGG - Intergenic
1157597882 18:48874931-48874953 TTTTGGCTCCCTTTTTGCTGGGG + Intergenic
1164041743 19:21498638-21498660 ATGTGGCTCTCCTTTTTTTCTGG + Intronic
1164294650 19:23899135-23899157 ATGTGACTCTCTTCTTCTTCTGG + Intergenic
1167228908 19:48269229-48269251 ATGTGCATCTCTTTTTCTTTTGG - Intronic
925317900 2:2939355-2939377 ATGTGGCTGCCTCTGTCTTGGGG - Intergenic
926239214 2:11072075-11072097 ATGTGGGTTCCTCTTTCATGTGG - Intergenic
929357533 2:41043978-41044000 CTGTGGCTCCCTTTTTAATGGGG - Intergenic
929386050 2:41408600-41408622 TAGTGGCTTCCTTGTTCTTGTGG - Intergenic
931812789 2:65870903-65870925 ATGTGGGTCCCTTTCATTTGGGG - Intergenic
936933108 2:117810428-117810450 ATGTGTATCCCTTTTTTTTTAGG + Intergenic
939703540 2:145422947-145422969 ATCTGTCTCCCTTCTGCTTGTGG - Intergenic
941007686 2:160264415-160264437 ATGTGGTTCCCTTTTGCTTCTGG + Intronic
941109679 2:161405309-161405331 ATGTACCTAACTTTTTCTTGTGG - Intronic
942231680 2:173866453-173866475 ATGGCACTCCCTTTTCCTTGAGG - Intergenic
944071473 2:195674588-195674610 ATTTACCTCCTTTTTTCTTGAGG + Intronic
944436930 2:199699897-199699919 ATGTGGCTCTCATTATTTTGAGG - Intergenic
946883955 2:224204427-224204449 ATGAGTCTCCCTTTGTTTTGTGG - Intergenic
1169111757 20:3038674-3038696 ATGTCTCTCCCTTTGTCTGGGGG + Exonic
1169286437 20:4311239-4311261 TTGCGGTTCCCTTTTTCTTGAGG + Intergenic
1170777638 20:19391436-19391458 CTGTAGCTCAGTTTTTCTTGAGG + Intronic
1171353045 20:24519686-24519708 ATGTGGCTCCTTTGATCTTTTGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1175286228 20:57838741-57838763 ATGCGGCCCACATTTTCTTGCGG + Intergenic
1176297549 21:5082271-5082293 ATGTGGCTCCCTCTTTTCAGAGG - Intergenic
1177218928 21:18165620-18165642 ACGTGGCTCCCTCCTTTTTGAGG - Intronic
1177586228 21:23100055-23100077 AAGTGGGTACCTTTTCCTTGGGG + Intergenic
1179859480 21:44179677-44179699 ATGTGGCTCCCTCTTTTCAGAGG + Intergenic
1179993502 21:44960701-44960723 CTGTGGCTCCCTCTTTTCTGAGG + Intronic
1180566345 22:16669976-16669998 ATGTGTATCCCTTTTTTTTCTGG - Intergenic
1184672093 22:46019040-46019062 ATGTGGCCCACTTTGCCTTGAGG + Intergenic
1184774845 22:46618008-46618030 ATGGGTGTCCCTTTCTCTTGAGG + Intronic
1185334833 22:50266818-50266840 ATGTGGGTCCCACATTCTTGGGG + Intronic
949207256 3:1455005-1455027 ATGGGGCTGTCTTTTCCTTGTGG - Intergenic
951228982 3:20154957-20154979 ATGTGGCTTCCTTTTATCTGTGG + Intergenic
953209088 3:40858488-40858510 AACTGGCTCCCCTTTCCTTGAGG - Intergenic
958928278 3:100182312-100182334 ATGTGACTTACTTTTTCTTTTGG - Intergenic
960889018 3:122426664-122426686 ATGTGGCTCCCTTTTTCTTGTGG - Exonic
967986152 3:195096887-195096909 ATGTGACTACCTTTTGCTGGAGG + Intronic
968152331 3:196346691-196346713 TTGTGCCCCCCCTTTTCTTGTGG - Intergenic
970076464 4:12227398-12227420 ATTTGTCTCCCATTATCTTGTGG + Intergenic
970993609 4:22239761-22239783 ATGTGGCTGATTGTTTCTTGAGG + Intergenic
971625811 4:28918547-28918569 ATGTTGGTCCCTATTTTTTGTGG - Intergenic
972386071 4:38567011-38567033 AAATGGCTCCCTGTCTCTTGTGG - Intergenic
973894043 4:55395146-55395168 AAGTAGCTCACTTTTTCTTTTGG + Intergenic
976046439 4:80953947-80953969 ATATGGGTCCCTTTTACTTTTGG - Intronic
977292484 4:95178747-95178769 ATGTTGTCCCCATTTTCTTGTGG + Intronic
978272977 4:106913717-106913739 ATCTCTCTCCCTTTCTCTTGTGG - Intergenic
978524987 4:109656027-109656049 ATGTGGGTGCCTCTATCTTGTGG + Intronic
979476165 4:121159782-121159804 ATGTGGTTGGCTTTTTGTTGGGG + Intronic
979703661 4:123695300-123695322 TTATGGGTCCATTTTTCTTGGGG + Intergenic
979944624 4:126813406-126813428 ATTTTTCTCCCTTTTTCCTGTGG - Intergenic
983240339 4:165224726-165224748 GTGAGTCTCCCTTTTTCTTCAGG + Intronic
984967224 4:185150018-185150040 ATGTGGCATCCTTTGTGTTGAGG + Exonic
987548259 5:19342100-19342122 ATGTGTCTGTCTTTTTCTAGGGG + Intergenic
988067438 5:26239727-26239749 ATGTGGCTTCCTGTTTCATGTGG + Intergenic
990425997 5:55689693-55689715 ACGAGGCTCCCTCTTTCTTCAGG + Intronic
990809531 5:59706869-59706891 ATGTGGATACCATTTTCTTTAGG - Intronic
991118466 5:62982377-62982399 TTCTGGCTCCCTTTTTCTCCTGG + Intergenic
992062091 5:73062739-73062761 GTGTGACTACCTTTTTCTTTAGG + Intronic
993983887 5:94574095-94574117 CTTTGCCTTCCTTTTTCTTGGGG - Intronic
996967612 5:129323252-129323274 CTTTGGCTCCCTTTGTCCTGAGG + Intergenic
997087355 5:130817616-130817638 ATGTGGCTTCCTTTTTCTTGGGG - Intergenic
997911545 5:137878922-137878944 CTTTGGCTCCCAGTTTCTTGTGG - Intronic
998172335 5:139880068-139880090 ATGTGGCTACCTATTTATTGGGG - Intronic
998271818 5:140713331-140713353 ATGGGACTCTCTTTTTCTGGTGG + Intergenic
998273433 5:140728120-140728142 ATGGGACTCTCTTTTTCTGGTGG + Intergenic
1001251241 5:170148661-170148683 ATGATGCTCCCTCTTTCATGAGG - Intergenic
1002826500 6:778758-778780 AGGTGTCTTCCTTTTTCTTCTGG + Intergenic
1003571963 6:7261773-7261795 ATGTGGTTCCCTGTTGCTTGAGG - Intergenic
1003574513 6:7279894-7279916 AAGTGGCTCCGTTTCTTTTGGGG + Intronic
1005160885 6:22862166-22862188 ATGTGGGTCTCTTTTTCTAAAGG - Intergenic
1005226957 6:23654317-23654339 ATATGTCTGCTTTTTTCTTGGGG - Intergenic
1005281037 6:24274034-24274056 ATGTGGCTCTCTTTCACTTTGGG - Intronic
1005653814 6:27911578-27911600 ATGTGGCTCCCATCTAATTGTGG - Exonic
1007985998 6:46207181-46207203 ATGTGGGTCACTTTTTTTTTTGG - Intergenic
1011213521 6:84980090-84980112 ATGTGGTTTCATTTTTATTGGGG - Intergenic
1013612145 6:111805627-111805649 ACCTGGCTCCCTTCTTCCTGAGG + Intronic
1014429869 6:121355805-121355827 ATTTGGCGGCCTTTTTCATGTGG - Intergenic
1018071758 6:160170893-160170915 AGGAGGCTGCCTTTTGCTTGTGG + Intergenic
1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG + Intergenic
1021536467 7:21710440-21710462 ATTTTGCTGCCTCTTTCTTGCGG - Intronic
1023433050 7:40114286-40114308 TTATGTCTCCCATTTTCTTGGGG + Intergenic
1024299644 7:47877163-47877185 ACGTGCCTGCCTTTTTCTTGGGG + Intronic
1027161670 7:75807189-75807211 ATGTGGCTCCCTGTGCCTGGGGG + Intergenic
1028753113 7:94404818-94404840 ATGGGTCTCCCATTTTCTTAGGG + Exonic
1029422390 7:100478106-100478128 ATGTGGCCCCCTTGTTCCAGGGG - Exonic
1031615139 7:123871054-123871076 CTGTTGCTCCTTTTTTCCTGAGG - Intronic
1032880491 7:136084768-136084790 ATGCAGATCCCCTTTTCTTGAGG + Intergenic
1035290639 7:157836390-157836412 ATGTGGCTTACTGTTTCTTTAGG - Intronic
1035489468 7:159260490-159260512 ATTTGGCTCCAATTTCCTTGTGG + Intergenic
1036516463 8:9448634-9448656 ATGTGACTCCTTTTTTGTTATGG - Intergenic
1037233822 8:16692958-16692980 ATGTGGCTTTGTTTTTCTTTTGG - Intergenic
1038280227 8:26157665-26157687 ATGTGATTTCTTTTTTCTTGGGG + Intergenic
1038512343 8:28150939-28150961 ATGTGCCTCCGTTTTTTGTGGGG + Intronic
1039714585 8:40093748-40093770 ATTTGGCTCCCATATTCTTTTGG + Intergenic
1040340817 8:46439679-46439701 CGGTGGACCCCTTTTTCTTGTGG + Intergenic
1040619225 8:49071312-49071334 TTGTGGCTCCCTTTACATTGAGG - Intronic
1040887367 8:52279685-52279707 ATCTGGCTTCTTTTTTGTTGTGG - Intronic
1043330335 8:79109557-79109579 ATGAGGCTCCATTTATGTTGGGG - Intergenic
1043332096 8:79130153-79130175 ATTTGACTCCCTTTTTTTGGGGG - Intergenic
1044339271 8:91028263-91028285 TTGTGACTCTCTCTTTCTTGTGG - Intronic
1045387660 8:101687071-101687093 ATGTGGCTCACTTTTCTTTCTGG + Exonic
1046015704 8:108602645-108602667 ATGTGGCTCCTTTTTTGCTTTGG + Intergenic
1046193461 8:110830059-110830081 TTCCCGCTCCCTTTTTCTTGTGG - Intergenic
1046537040 8:115528469-115528491 ATGTGGCTTCCTTATTGGTGTGG - Intronic
1046592780 8:116225711-116225733 ATGTTGCTCTTTTGTTCTTGGGG + Intergenic
1047765551 8:127987083-127987105 ATGTGTCTCCTGATTTCTTGGGG + Intergenic
1048491028 8:134894148-134894170 TTGTGGCTCCCTTCTTCTCTGGG + Intergenic
1049188854 8:141274900-141274922 CTGGGGCCCCCTTTTCCTTGTGG - Intronic
1050305725 9:4304383-4304405 ATATTGCTTCCTATTTCTTGAGG + Intronic
1052188961 9:25634077-25634099 ATGTGTGTCACATTTTCTTGTGG + Intergenic
1053198499 9:36137255-36137277 GTCTGGCTCCCTTTCTCCTGGGG + Intronic
1055097029 9:72424215-72424237 AACTGACTCTCTTTTTCTTGGGG + Intergenic
1062627581 9:137450210-137450232 AGGTGGCCACCTTGTTCTTGAGG + Exonic
1185771298 X:2767417-2767439 ATGAGGCTGCTTTCTTCTTGGGG + Intronic
1186758395 X:12697550-12697572 ATGTGGTTGCATTTGTCTTGGGG + Intronic
1186904508 X:14097194-14097216 ATCTGGTTCCCTTTTTTTGGAGG + Intergenic
1187105536 X:16237772-16237794 ATGTGCCTCACTGTTCCTTGGGG - Intergenic
1187856000 X:23636761-23636783 ACTTGGCTCCCTTTGTCTTTGGG - Intergenic
1189175423 X:38952274-38952296 CGATGGCTCCCTTTTTCTTTTGG + Intergenic
1189676715 X:43468118-43468140 ATGTGACTTCATTCTTCTTGGGG - Intergenic
1189888836 X:45577621-45577643 CTTTGGCTCCCTTTGTCCTGGGG + Intergenic
1190884126 X:54516111-54516133 ATATGGTTTTCTTTTTCTTGTGG - Intergenic
1191722507 X:64245842-64245864 ATGTTTCTACCTTTTTCATGTGG + Intergenic
1196248312 X:113427746-113427768 ATGTGGCTCACTCTTTCATGAGG - Intergenic
1196285599 X:113875959-113875981 TTGTGGCTCCCTGTTTCTGTAGG - Intergenic
1198606879 X:138350097-138350119 GTGCTGCTCCCTTTTTTTTGTGG - Intergenic
1200408884 Y:2842309-2842331 CTGTGGCTCGGTATTTCTTGGGG + Intronic
1202041115 Y:20685024-20685046 ATTTGGCTCCTTTTTCTTTGTGG + Intergenic