ID: 960896444

View in Genome Browser
Species Human (GRCh38)
Location 3:122511199-122511221
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960896444_960896457 29 Left 960896444 3:122511199-122511221 CCCCAAGCTGCCTATTCTGACCC 0: 2
1: 0
2: 0
3: 6
4: 141
Right 960896457 3:122511251-122511273 TTGTTGCTCACAGAGTATATAGG 0: 1
1: 0
2: 1
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960896444 Original CRISPR GGGTCAGAATAGGCAGCTTG GGG (reversed) Intronic
901290729 1:8122291-8122313 GGGTCAGGAAAGGCAGAATGAGG + Intergenic
901514724 1:9737317-9737339 GGGTCAGAATGGGCAGAATAAGG + Intronic
901607672 1:10472228-10472250 GGGTCAGGAGAGGCGACTTGGGG - Intronic
901760921 1:11470966-11470988 GGCTCAGAATATGGAGTTTGTGG - Intergenic
903033446 1:20479489-20479511 GGGTCAGTGGAGGCATCTTGGGG - Intergenic
907125156 1:52043216-52043238 GGGTAAGAATAGGGTGCTTTGGG - Intronic
910226871 1:84944699-84944721 GAGTCACAAAAGGCAGCATGAGG + Intronic
915111297 1:153566020-153566042 GGGCCAGAGGAGGCAGCTGGGGG + Intronic
920172846 1:204082421-204082443 GAGTCAGAACAGCCAGCTTCTGG + Intronic
920279762 1:204834142-204834164 GGGGGAGAATAGGCAGGATGAGG - Intronic
921302735 1:213766010-213766032 TGGACAGATTAGGAAGCTTGGGG + Intergenic
1067181220 10:43987286-43987308 GGGTCTGAGTGGGCAGCTTAGGG + Intergenic
1067792716 10:49299947-49299969 GTGTAAGAACAGGCAGCCTGTGG - Intronic
1067834961 10:49632778-49632800 GGGTCAGGCTAAGCAGCCTGGGG - Intronic
1069810995 10:71159595-71159617 GGATGAGGATAGACAGCTTGGGG + Intergenic
1070799328 10:79235863-79235885 GTGCCAGGATAGACAGCTTGGGG + Intronic
1072191741 10:93081540-93081562 TGGTCAGCATGGGCAGGTTGGGG - Intergenic
1072451234 10:95541261-95541283 GGGTTAGAAGAGGGATCTTGGGG + Intronic
1073903531 10:108250487-108250509 GGTTCAGAATAGGGAGTGTGTGG - Intergenic
1076227403 10:128790885-128790907 GGGTCAAGCTAGGCAACTTGGGG + Intergenic
1076427944 10:130380766-130380788 TAATCAGAATAGGCAGGTTGGGG + Intergenic
1077763994 11:5137160-5137182 GGATAAGAAAAGGCAGCCTGGGG + Intergenic
1081663347 11:44902067-44902089 GGGTCAGAATAGAAAGCTCCGGG + Intronic
1088421395 11:109651738-109651760 TGGTAAGAATTGGCAGCTTTTGG + Intergenic
1089637425 11:119824284-119824306 GGGTGAGAGTAGGCAGGGTGGGG + Intergenic
1093095988 12:14972973-14972995 CGGTGAGATTAGGCAGCATGAGG + Intergenic
1093958909 12:25251287-25251309 GGGTCAGAATTGGCGGCTGCGGG - Intergenic
1099675961 12:85760527-85760549 TGGTAAATATAGGCAGCTTGGGG + Intergenic
1103040715 12:117693184-117693206 GGGTCAGTCTTGGCTGCTTGAGG - Intronic
1105514111 13:21075800-21075822 GGGTCTGCAAAGGCAGCTCGGGG - Intergenic
1106070231 13:26403965-26403987 GGGTTGGGATAGGCAGCATGTGG - Exonic
1106758510 13:32845560-32845582 GGATCAGAAAAGGTACCTTGAGG + Intergenic
1109268881 13:60232367-60232389 GGTTCAAAATAGGAAACTTGTGG - Intergenic
1113902639 13:113805254-113805276 GGGTCAGAAGAGCCAGCTGCCGG - Intronic
1114447111 14:22797286-22797308 AAGTCAGAATAAGCAGCTTCAGG + Intronic
1116395863 14:44448092-44448114 AGGTCAGAATAGGAAACTTTTGG - Intergenic
1118373389 14:65156713-65156735 GGGGCAGAAGAGGCTGCCTGAGG + Intergenic
1118760482 14:68877997-68878019 GGGACAGACTAGGAAGGTTGGGG + Intronic
1119189298 14:72669543-72669565 GGGTAGGAATAGGGAGGTTGTGG - Intronic
1119541937 14:75444942-75444964 GGGTCACAGAAGGCAGCTTAGGG - Intronic
1121078361 14:91087992-91088014 AGGTCAGAGGAGGCATCTTGGGG + Intronic
1121614600 14:95304798-95304820 GGGTCAGACCAGGCTGCTGGGGG - Intronic
1125898638 15:43324830-43324852 GGGTAAGCATGGGCTGCTTGAGG + Exonic
1125933606 15:43616737-43616759 GGGTCAGAATCTTCAGCTGGAGG - Intronic
1125946704 15:43716199-43716221 GGGTCAGAATCTTCAGCTGGAGG - Intergenic
1126451336 15:48811948-48811970 GGGTCAGTGTAGGCATCATGGGG - Intergenic
1130245143 15:82240437-82240459 AGGTGAGAATAGGCCTCTTGTGG + Exonic
1130455532 15:84102971-84102993 AGGTGAGAATAGGCCTCTTGTGG - Intergenic
1131152019 15:90053287-90053309 GGGCCTGAAGAGGCAGCATGGGG + Intronic
1131349757 15:91688434-91688456 TGTTCAGAATAGGCATCTTCAGG + Intergenic
1136069781 16:27780866-27780888 GGGTGAGTGTTGGCAGCTTGTGG + Intergenic
1138553984 16:57761749-57761771 GGGTGAGAGTGGGCAGCTAGGGG - Intronic
1141065748 16:80912260-80912282 GGGTCTGAACAGGCAGATGGGGG + Intergenic
1141746689 16:85930928-85930950 GGGCCAGAGGAGGCAGCGTGTGG + Intergenic
1143369360 17:6428840-6428862 GGGCCAGAAGAGGCAGCCGGAGG - Intronic
1144451575 17:15384325-15384347 TGCTCAAAATATGCAGCTTGTGG - Intergenic
1147556851 17:41485250-41485272 GGGTCAGAATAGCCAGGTGATGG + Intergenic
1148380021 17:47189444-47189466 GGGTCAGACTCGGTAGCTTCCGG - Intergenic
1149988024 17:61362900-61362922 GGGTCAGAGTAGGCAGAAAGTGG - Intronic
1150333782 17:64315316-64315338 GGGCCAGAATTTGCAGCATGAGG - Intergenic
1151618244 17:75228821-75228843 GGGGCAGAAAAGGCAGCCAGGGG + Intronic
1155723810 18:29053575-29053597 GGGACACGATAGGCATCTTGTGG - Intergenic
1158776518 18:60588542-60588564 GAGTCAAAATAGACAGCCTGTGG - Intergenic
1163054190 19:14706084-14706106 GGGACAGGAGAGGCAGCTGGAGG - Intronic
1163443078 19:17331343-17331365 GGTTCAGAATACGCTGCTCGTGG + Exonic
1167774564 19:51546145-51546167 GGGACAGCAGAGGAAGCTTGTGG + Intergenic
1168490353 19:56803747-56803769 GGGTCAAAACAGGCAGCTTTAGG + Intronic
926614300 2:14980219-14980241 GGTTGAGAAGAGGCAGCTGGGGG - Intergenic
927465477 2:23333081-23333103 GGGAGAGAAGAGGCAGCTTGCGG + Intergenic
927680052 2:25133053-25133075 GGGTCAGAAAATGCAGCTGGGGG - Intronic
927928492 2:27028924-27028946 GGGTCAGAGTGGGCAGGGTGTGG + Intergenic
928177430 2:29044417-29044439 GGGTCAGAGGAGGGAGTTTGTGG - Intronic
930028586 2:47044701-47044723 GGGTCAGGAAAGGCATTTTGGGG + Intronic
932472734 2:71972494-71972516 GCCTAAGAATAGGCAGCTTGAGG + Intergenic
932502164 2:72192546-72192568 GGGTCTTAGTAGGCAGCATGGGG + Intronic
933978594 2:87531795-87531817 GTGTTAAAACAGGCAGCTTGCGG + Intergenic
934562141 2:95318912-95318934 CTGGCAGCATAGGCAGCTTGTGG - Intronic
935059393 2:99594208-99594230 GGATCAGAATAGGAGGCTTGTGG + Exonic
935124105 2:100207731-100207753 GTCTCTGAATAGGCAGTTTGTGG - Intergenic
936315237 2:111419007-111419029 GTGTTAAAACAGGCAGCTTGCGG - Intergenic
938408084 2:131043839-131043861 GGGAGAGAAGAGGTAGCTTGAGG - Intronic
938750133 2:134320513-134320535 GGAGCAGAGTAGGCAGCTTTGGG + Intronic
942229333 2:173845064-173845086 GGGTCACAGTATGCAGCCTGAGG + Intergenic
943891337 2:193290365-193290387 AGGTAGGAATAGGCTGCTTGGGG + Intergenic
947642364 2:231714188-231714210 GGGTCAGGATAGCCAACTGGAGG + Intergenic
948602711 2:239116410-239116432 CGGACAGAATTGGGAGCTTGGGG - Intronic
1172519961 20:35560017-35560039 GGGTCAGAGTAGGGAACTGGGGG + Intergenic
1173274925 20:41572194-41572216 TGGTCAGCAGAGGCAGCTGGAGG + Intronic
1174005477 20:47407536-47407558 GGGTCAACACAGGCATCTTGGGG - Intergenic
1174272535 20:49380265-49380287 GGGTCAGAGTGGGCAGCCAGTGG + Intronic
1176147001 20:63569883-63569905 GGGGCAGTGTGGGCAGCTTGAGG + Intronic
1181106823 22:20580580-20580602 GGGTCAGAAAAGGCAGAGTTGGG + Intronic
949500467 3:4675755-4675777 GGGTCAGAGTAGGCAGATATTGG + Intronic
949694334 3:6676981-6677003 GGGTAGGAAAAAGCAGCTTGAGG - Intergenic
950030079 3:9846416-9846438 GGGTCAGCAGAGGCAGGATGGGG + Intronic
950640765 3:14346721-14346743 GAGCCAGAAGAGGCAGCTGGGGG + Intergenic
954115388 3:48464367-48464389 GGGGCAGAATAGGGGGCTGGAGG + Intronic
954218020 3:49135143-49135165 GGGCCAGAATAGGGATGTTGTGG - Intergenic
954396443 3:50295786-50295808 GGGGCATCATAGCCAGCTTGCGG - Intronic
956146743 3:66198483-66198505 GGGTCAGGATGGACAGCATGAGG - Intronic
956239518 3:67114099-67114121 GCTTCAGAATAGGCAGCCAGTGG + Intergenic
956891619 3:73619780-73619802 GGGACAGCATAGGAGGCTTGAGG + Intronic
960828846 3:121822405-121822427 GAGTCAGAATTTGGAGCTTGGGG + Intronic
960896444 3:122511199-122511221 GGGTCAGAATAGGCAGCTTGGGG - Intronic
960896448 3:122511219-122511241 GGGTCAGAATAGGCAGCTTGGGG - Intronic
962755851 3:138465003-138465025 GGGTGCTAAAAGGCAGCTTGGGG + Intronic
963618457 3:147573159-147573181 AGGTCAGAGAAGGCAGCTGGAGG + Intergenic
965908347 3:173739240-173739262 GGGCCAGAAAAGCCAGCTTAAGG + Intronic
966767195 3:183473828-183473850 GGGTCAGAAAATACAGCCTGTGG - Intergenic
968878502 4:3286666-3286688 GGGGCAGGAAAGGCAGCCTGTGG + Intergenic
977204466 4:94153897-94153919 GGGTCAGAATATTCTGATTGTGG - Intergenic
986240725 5:5957377-5957399 GGCTCAGAATAGGGAGTGTGGGG + Intergenic
987222763 5:15807359-15807381 GGGTCAGAAGAGGCATGTGGAGG - Intronic
989358848 5:40575983-40576005 GGGGCAGAGTAGGCAGCTGCAGG - Intergenic
990788178 5:59447039-59447061 GGGTCAGACTGGTCAGCCTGTGG + Intronic
992677178 5:79116859-79116881 GGGTTAGAGTAGGAACCTTGTGG + Intronic
994753936 5:103771836-103771858 GGGTCACATTATGCAACTTGTGG + Intergenic
995525227 5:113045371-113045393 GGGTCATAAAAAGCAGCTGGCGG - Intronic
996019691 5:118577725-118577747 GGGTCAGAATGGGCTGGTGGAGG - Intergenic
998007826 5:138668740-138668762 GGTTCAGAAGAGGCAGGATGTGG - Intronic
998019113 5:138754556-138754578 GGGACAGGATAGGCATTTTGTGG + Intronic
1003978833 6:11370525-11370547 GGGGAAGAAAAGGCGGCTTGAGG - Intronic
1014769443 6:125444722-125444744 GGGTTAGCAGAGGCAGCTAGAGG - Intergenic
1014784473 6:125601937-125601959 GGGTCAGAATTATGAGCTTGAGG - Intergenic
1017644314 6:156525022-156525044 GGCACAGAATGGGGAGCTTGAGG + Intergenic
1020906649 7:14071670-14071692 GGGTCAGTTTAGGTAGTTTGTGG + Intergenic
1021606586 7:22414781-22414803 GGGTCAGAGTAGGGAGATGGAGG + Intergenic
1024459455 7:49645170-49645192 GGGTCAGCATAGACATTTTGGGG + Intergenic
1028861444 7:95656153-95656175 GGGTCAGAATAAGCAGCTATAGG + Intergenic
1031176614 7:118360752-118360774 GTGACAGAAATGGCAGCTTGAGG - Intergenic
1032733573 7:134668903-134668925 GGGTAAGAGTAGGCTGCTGGGGG + Intronic
1032977429 7:137241830-137241852 TGGCCAGAAGAGGCAGCATGGGG - Intronic
1034569416 7:151943065-151943087 GGTTAAGAATAGGCAGGGTGCGG - Intergenic
1034630587 7:152527449-152527471 GGGCCAGAAGAGGCAGATTTTGG - Intergenic
1036201599 8:6775182-6775204 GGGGCAGGAGAGGCCGCTTGGGG + Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1041209406 8:55533496-55533518 CGGTCTGAATCGGAAGCTTGGGG + Exonic
1042178928 8:66065475-66065497 GGGACAGAATAGAAAGCTCGGGG - Intronic
1044559452 8:93598141-93598163 GGGTGAGAATAGGCCGGGTGTGG - Intergenic
1045909878 8:107394519-107394541 GAGTCAGAATAAGGAGCTGGGGG + Intronic
1045950643 8:107848243-107848265 GGGTCAGTATAGGCATTTAGAGG + Intergenic
1049923983 9:391222-391244 TGGTCAGAAAAGGCCTCTTGGGG - Intronic
1050654412 9:7810688-7810710 GAGTGATAATAGGCAGCTTTGGG + Intronic
1056134794 9:83621468-83621490 GGGTCAGAAAAAGCAACTAGGGG - Intergenic
1057686186 9:97237314-97237336 GGGGCAGAATGGGGAGCTGGAGG - Intergenic
1058354817 9:104072136-104072158 GGTTCAGAATAGACTGCTTCAGG - Intergenic
1188453520 X:30335560-30335582 GGCAGAGAATATGCAGCTTGTGG + Intergenic
1194247431 X:91533917-91533939 GGGTCACTTTAGTCAGCTTGTGG + Intergenic
1200566454 Y:4775450-4775472 GGGTCACTTTAGTCAGCTTGTGG + Intergenic