ID: 960898052

View in Genome Browser
Species Human (GRCh38)
Location 3:122526940-122526962
Sequence TGCATCCCTCCTCCTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960898052_960898055 2 Left 960898052 3:122526940-122526962 CCACCCTCAGGAGGAGGGATGCA 0: 1
1: 0
2: 0
3: 26
4: 238
Right 960898055 3:122526965-122526987 AAAGAGACCCGATCAAGCCCTGG 0: 1
1: 0
2: 2
3: 2
4: 69
960898052_960898060 24 Left 960898052 3:122526940-122526962 CCACCCTCAGGAGGAGGGATGCA 0: 1
1: 0
2: 0
3: 26
4: 238
Right 960898060 3:122526987-122527009 GAAGTAGACTCAGAGCTGTTAGG 0: 1
1: 0
2: 13
3: 63
4: 237
960898052_960898062 29 Left 960898052 3:122526940-122526962 CCACCCTCAGGAGGAGGGATGCA 0: 1
1: 0
2: 0
3: 26
4: 238
Right 960898062 3:122526992-122527014 AGACTCAGAGCTGTTAGGGCAGG 0: 1
1: 0
2: 4
3: 35
4: 232
960898052_960898061 25 Left 960898052 3:122526940-122526962 CCACCCTCAGGAGGAGGGATGCA 0: 1
1: 0
2: 0
3: 26
4: 238
Right 960898061 3:122526988-122527010 AAGTAGACTCAGAGCTGTTAGGG 0: 1
1: 0
2: 0
3: 37
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960898052 Original CRISPR TGCATCCCTCCTCCTGAGGG TGG (reversed) Intergenic
900091136 1:921194-921216 TGCCTCCCGCCGCCAGAGGGAGG - Intergenic
900880948 1:5380972-5380994 TGCATACCACCTCATGAGTGAGG + Intergenic
901213348 1:7539056-7539078 TGCAACCCTGGCCCTGAGGGTGG - Intronic
902878668 1:19356413-19356435 TGCTGGCCTCCTGCTGAGGGAGG - Intronic
904273820 1:29367482-29367504 TGGGTCCATCCTCCTGAGGGTGG - Intergenic
904364145 1:29999803-29999825 TGGGTCCATCCTCCTGAGGGTGG - Intergenic
904446136 1:30574292-30574314 TGCAGCCCTCCCCCAGATGGTGG + Intergenic
906923101 1:50085838-50085860 TGCAAGCCTCCTTCTTAGGGAGG + Intronic
907979851 1:59471035-59471057 TACCTCCCCTCTCCTGAGGGAGG + Intronic
910655818 1:89616853-89616875 TGAATACCTACTCCTCAGGGAGG + Intergenic
915229786 1:154436731-154436753 TGCATCCCTCCAGCTGTGGTGGG - Intronic
915430139 1:155860102-155860124 TGAACCCCTCCTTCTGGGGGAGG + Intronic
915610015 1:156984308-156984330 TGCATCCCTCCTGCCCACGGTGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
919935847 1:202250212-202250234 TGAATGTCTCCTCCTGAAGGAGG + Intronic
920194686 1:204218997-204219019 GCCATCCCTCCTCCTGGGGAGGG + Exonic
920695979 1:208181566-208181588 TGCTTCCCTCCTCCCTAGAGAGG + Intronic
920910371 1:210210674-210210696 GGCATTCCTCCTCCTGCGTGTGG - Intergenic
920993988 1:210969189-210969211 TTCATCCATCCTCATGAGTGAGG + Intronic
921896734 1:220409727-220409749 TGCATTCGTCCTCCTGAGCTTGG - Intergenic
1063667136 10:8069525-8069547 GGCATTCCTCCTCCAGAGTGTGG - Exonic
1064025538 10:11845818-11845840 TACATTCCTGCTCCTGAGGCAGG + Intronic
1064331390 10:14397379-14397401 TGCATCCCGCCTGCTGAGTGGGG + Intronic
1066171294 10:32849928-32849950 TGGATCCCTACTTCTGAAGGCGG + Intronic
1066657966 10:37712617-37712639 TGCATCCTTCCTCCTGGGACAGG + Intergenic
1068511001 10:57965639-57965661 GGCTTCCCACCTCCTGAGGGGGG + Intergenic
1069982289 10:72260923-72260945 AGCCTCCTTCCTCCCGAGGGTGG + Intergenic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1071684146 10:87736966-87736988 AGCAGCCCTACTTCTGAGGGCGG - Intronic
1072438426 10:95434082-95434104 TGCCTCTCCCCTCCAGAGGGTGG - Intronic
1073469412 10:103713613-103713635 TGAATGCCACCTCCTCAGGGAGG + Intronic
1073498956 10:103918623-103918645 TTCACCCCTCCTCCTGCTGGTGG + Intergenic
1073570953 10:104580833-104580855 TGGATGCCTCTTCCTGGGGGTGG + Intergenic
1076086602 10:127637503-127637525 AGCAGCCCTGCTACTGAGGGTGG + Intergenic
1076658097 10:132037501-132037523 AGCCTCCCTCCACCTGCGGGTGG + Intergenic
1076875034 10:133211623-133211645 TGCCGCCCTCCTCCAGAAGGTGG + Intronic
1077302124 11:1852244-1852266 TGCATCCCTCCTCCTGACCCTGG + Intergenic
1077303836 11:1859042-1859064 TGCCTGCCTCCTCCTGCCGGGGG - Intronic
1077550612 11:3198421-3198443 TGGATCCCACCCCCTGGGGGTGG + Intergenic
1078858315 11:15224692-15224714 TCTATGCCTCCTCCTGAGGTGGG + Intronic
1081318482 11:41660783-41660805 TGCAGCCCTTCTCCTGCAGGGGG - Intergenic
1081599634 11:44484196-44484218 TCCCTCCCTCCTCCTCAGGCTGG - Intergenic
1081986553 11:47309069-47309091 TTCATCCCTCCTCCTTGGGAGGG + Intronic
1083664843 11:64268770-64268792 TGCATCCCTCCTCCAGGGGAAGG + Exonic
1084461605 11:69299449-69299471 TGCATCTCCCCTGCTAAGGGGGG - Intronic
1084558339 11:69888770-69888792 GGCATCCTTCTTCCTTAGGGAGG + Intergenic
1084731059 11:71073944-71073966 TGCATCCCAGCTACAGAGGGTGG + Intronic
1085441567 11:76568609-76568631 TACTTCCCTCCTCCAGAAGGTGG - Intergenic
1092282368 12:7108146-7108168 TTCATCCCTCCTCCAGATGGGGG + Intronic
1094395652 12:30002680-30002702 ACCATCTCTCCTCCTGAAGGAGG - Intergenic
1097277281 12:57822096-57822118 TCCCTCCCTCCTCCTGGGGTGGG - Exonic
1099038119 12:77615519-77615541 TGCATCCTTGCTCCTGTAGGGGG + Intergenic
1101578504 12:106020133-106020155 TACATCCCTCTTCTTGATGGAGG - Intergenic
1102791636 12:115651189-115651211 TGTATCCATTCTCCTGTGGGGGG - Intergenic
1104744808 12:131204094-131204116 TGCTTCCCTCCTGCTGAGGCCGG + Intergenic
1104789605 12:131473325-131473347 TGCTTCCCTCCTGCTGAGGCCGG - Intergenic
1105891919 13:24688238-24688260 TGCAGCCCAACCCCTGAGGGAGG + Intronic
1107543978 13:41419775-41419797 TTAATGCATCCTCCTGAGGGTGG - Intergenic
1109379547 13:61541812-61541834 TGAATCACTCAACCTGAGGGTGG - Intergenic
1114646855 14:24260732-24260754 TCCATCCCCTCTCCTCAGGGAGG - Intronic
1115245105 14:31286939-31286961 TGCATTCCTCCCCATGTGGGAGG + Intergenic
1115899183 14:38125980-38126002 TGAATCACTCTCCCTGAGGGAGG - Intergenic
1119008901 14:70962360-70962382 TTTTTCCCTCCTCCTGATGGTGG + Intronic
1119118132 14:72046079-72046101 GTCATCCATCCTCCTGATGGAGG + Intronic
1120446996 14:84611528-84611550 TGCATTCCTCCTCGTCAGTGTGG + Intergenic
1120822541 14:88926226-88926248 TGAATCCCAGGTCCTGAGGGAGG + Intergenic
1122715740 14:103695995-103696017 GGCATCCCTCCTCCTGTGTGTGG + Intergenic
1122831045 14:104396039-104396061 TGCAGCCCTCCTCCTGTCGCTGG - Intergenic
1123723484 15:23080542-23080564 AGCATCCCTCTTTCTGAGGCCGG + Intergenic
1124363260 15:29054151-29054173 TGCCCTCCTCCTCCTCAGGGAGG - Exonic
1124962613 15:34409914-34409936 TGCCCTCCTCCTCCTCAGGGAGG - Intronic
1124979238 15:34556136-34556158 TGCCCTCCTCCTCCTCAGGGAGG - Intronic
1125735196 15:41919813-41919835 TTCCTCCCTCCTCCTGTGGAAGG - Intronic
1126187039 15:45840890-45840912 TGCATCCCAACTCCACAGGGAGG - Intergenic
1127980283 15:64029942-64029964 TACACCAGTCCTCCTGAGGGGGG - Intronic
1128998713 15:72316061-72316083 TGCCTCCCACCTCTGGAGGGAGG + Intronic
1129233973 15:74212801-74212823 AGAATCCCTCCTCCTCAAGGCGG + Intergenic
1129945111 15:79533030-79533052 TGCATTGCTCTGCCTGAGGGTGG - Intergenic
1131077700 15:89506178-89506200 TGTATCTCTGCCCCTGAGGGTGG + Intergenic
1131278631 15:91003217-91003239 TGAATCCTTCCTCCTGAAGAAGG - Intronic
1131453324 15:92563908-92563930 TGTATCTCAGCTCCTGAGGGTGG - Intergenic
1132222025 15:100112197-100112219 AGCATCCCTCCAGCTGAGGTTGG - Intronic
1132995383 16:2819917-2819939 AGGATCCCTCCTCCAGAGGGAGG - Intronic
1133477759 16:6139837-6139859 TGCTTCCTTCCTCCTGAGAAGGG - Intronic
1135138040 16:19899100-19899122 GCCCTCCCTCCTCCTGAGGGTGG + Intergenic
1136369923 16:29830054-29830076 TGCCTGGCTCCTCCAGAGGGAGG - Intronic
1136687430 16:32003462-32003484 TGCCTCCTTCCTCCTGAGAAGGG - Intergenic
1136788044 16:32947013-32947035 TGCCTCCTTCCTCCTGAGAAGGG - Intergenic
1136881741 16:33906776-33906798 TGCCTCCTTCCTCCTGAGAAGGG + Intergenic
1137563676 16:49519978-49520000 TGCATGCCACCTCCTCGGGGAGG + Intronic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1138554513 16:57763831-57763853 TGCAGCCCTGGTCCTGAGAGAGG + Intronic
1139339809 16:66261047-66261069 TGCCTTCCTCCTCCTGCAGGAGG - Intergenic
1141866780 16:86755724-86755746 TGCCTCCATCCACCTGGGGGAGG - Intergenic
1142176566 16:88648023-88648045 TGTATCCTTCCACCTGAGGCTGG - Exonic
1203090269 16_KI270728v1_random:1208670-1208692 TGCCTCCTTCCTCCTGAGAAGGG - Intergenic
1142915510 17:3133311-3133333 TGCATCTCTCCCCCTGAAGACGG + Intergenic
1143937401 17:10501245-10501267 TGCATGCTTCTTCCTCAGGGTGG + Exonic
1143939814 17:10528825-10528847 TGCATGCTTCTTCCTCAGGGTGG + Exonic
1144810731 17:17997220-17997242 TGAATCCCTCAGGCTGAGGGTGG + Intronic
1145911916 17:28548009-28548031 TGCCTTCCTCCGCCTGAGGCAGG - Exonic
1147034912 17:37672634-37672656 TCGTTCCTTCCTCCTGAGGGTGG - Intergenic
1147148410 17:38499131-38499153 TGCCTCCTTCCTCCTGAGAAGGG - Intronic
1148325228 17:46779453-46779475 TGCCACCCTCCTCCTGAAGCCGG + Intronic
1148778432 17:50108740-50108762 CCCCTCCCACCTCCTGAGGGAGG + Intronic
1150207559 17:63420528-63420550 TTCAGCCCCCCTCCTGTGGGAGG + Exonic
1151964874 17:77426031-77426053 TGGAGGCCTCCTCCTGAGGCTGG - Intronic
1152355794 17:79806566-79806588 TGGACCTCTCCTCTTGAGGGGGG + Intergenic
1152466390 17:80468989-80469011 TGCATCACTCCCGCAGAGGGGGG - Exonic
1152878580 17:82802658-82802680 GGCTTCCCCCCTCCTCAGGGAGG + Intronic
1155307847 18:24496545-24496567 TGGATCCCACCTCCTGAAGTTGG + Intergenic
1155367487 18:25063323-25063345 AGCAGCCCCCCTCCTGAGGGTGG + Intronic
1157121718 18:44917620-44917642 TCCAACCCTCCTGCTGGGGGTGG - Intronic
1158452672 18:57580894-57580916 CAGATCCATCCTCCTGAGGGAGG + Intronic
1159920069 18:74220025-74220047 TGCATCTCTCTCCCTGAGGGAGG - Intergenic
1160657563 19:281382-281404 CGCACTCCTCCTCCTGAGGCCGG - Exonic
1161287166 19:3474630-3474652 TGCACCCCTCTTCCTGAGCTTGG - Exonic
1162194636 19:8974998-8975020 TGCATTCCTCCTACTGATTGTGG + Exonic
1163623193 19:18372903-18372925 TGCAGCCCTCATCCCAAGGGGGG - Intergenic
1164587522 19:29485310-29485332 TGCAGACCTCCTCCTCAGGTGGG - Intergenic
1164763039 19:30742641-30742663 TGCATCCTTCCCCGTGAGCGGGG + Intergenic
1166326354 19:42053521-42053543 TGCATCCCTCCACCTCACGGTGG + Intronic
1166646955 19:44539284-44539306 TTCATCCCACCTTCTGAAGGAGG + Intergenic
1166759533 19:45215976-45215998 TGCTTCCTGCCTCCTGAGGGAGG - Intronic
1167048357 19:47064890-47064912 CCCTTCCCTCCTCCTCAGGGTGG - Exonic
1167113667 19:47476452-47476474 TGCAGGCCTCCTCCTGGGGGAGG - Intronic
1167876523 19:52418440-52418462 AGTATCCATCCTCCTGAGGTGGG - Intergenic
1168682338 19:58325120-58325142 TCCATGCCTCCTCCTGACGTGGG + Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
927474170 2:23399943-23399965 TGCATCCATTCTCCTGTGGGTGG + Intronic
927855976 2:26528237-26528259 GGCCTCCCAGCTCCTGAGGGGGG + Intronic
934104819 2:88685925-88685947 TAAATCCCTCCTGCTGATGGTGG - Intergenic
934751642 2:96797723-96797745 TGCAGCCCTCGTCCTATGGGGGG - Intronic
935740176 2:106140498-106140520 TCCACCCCTCCTCTTTAGGGTGG + Intronic
936290786 2:111222413-111222435 TGCAGCCTTCCTCCTGATAGAGG - Intergenic
937663577 2:124459326-124459348 TGCCTCCCTACCCCTGTGGGAGG + Intronic
938140044 2:128787694-128787716 TGCTAACCTCCTCCTGAGGCGGG - Intergenic
938790202 2:134669693-134669715 TGCAGCACACCTCCTGAGGCTGG + Intronic
940637873 2:156320314-156320336 TGCAGCCTTCGCCCTGAGGGTGG + Intergenic
941550277 2:166907560-166907582 TGCATCTCTCCTCCTCAGGTAGG + Intronic
941583791 2:167331808-167331830 TGCAACCCTGCTACTGAGGAAGG + Intergenic
941856900 2:170240478-170240500 TGCTTCCCTCCTTTTCAGGGAGG + Intronic
945175732 2:207041477-207041499 TCCATCCCTCCTCCTAAGGAGGG - Intergenic
948267097 2:236642985-236643007 TGCCTCCCTCCAGCTGAGGGAGG + Intergenic
1170536193 20:17343372-17343394 TGTAGCTGTCCTCCTGAGGGTGG + Intronic
1170602192 20:17849446-17849468 GGTACCCCTCGTCCTGAGGGTGG + Intergenic
1171294611 20:24006338-24006360 TACATTCTTCCTGCTGAGGGTGG - Intergenic
1171486934 20:25491897-25491919 TGCCTCCCTCCTTGGGAGGGAGG - Intronic
1172800221 20:37571193-37571215 TGCTTCCCTCCTCCAGAAGCAGG - Intergenic
1173727636 20:45308393-45308415 TCCCCCCTTCCTCCTGAGGGGGG + Intronic
1174150933 20:48485933-48485955 TGCATGCCTGCTCCTGAAAGGGG + Intergenic
1174191917 20:48747013-48747035 TGCATGGCTCCTCCTGGGGGTGG - Intronic
1174611490 20:51801700-51801722 CGCACCCCAGCTCCTGAGGGTGG + Intronic
1175121083 20:56716873-56716895 TGAATCCCTCCTCCAGGGGTGGG + Intergenic
1175205146 20:57305517-57305539 TCCATCCCTGCTCGTGGGGGTGG - Intergenic
1178132913 21:29593441-29593463 TCCATCCCTTCTTCTGAGGCAGG + Intronic
1178679404 21:34659963-34659985 TGCAGCCCTGCTGCTGAGGAGGG - Intergenic
1179549652 21:42135767-42135789 ACCATCCCTCCTCCAGAGAGAGG - Intronic
1179551508 21:42146646-42146668 TGCAGCCCTCCTCCCCAGGAGGG - Intergenic
1179551545 21:42146754-42146776 TGCACCCCTCCTCCCCAGGAGGG - Intergenic
1179551562 21:42146808-42146830 TGCACCCCTCCTCCCCAGGAGGG - Intergenic
1180066591 21:45415539-45415561 TGCATCCATCTTCCGGAAGGGGG - Intronic
1182041686 22:27243143-27243165 AGCATCCCTCTTCCTCGGGGCGG - Intergenic
1182505261 22:30777713-30777735 TGCAGCCCTCCTGCTAAGGGAGG + Intronic
1183411344 22:37656561-37656583 TCCATCCCTGCTCCTTGGGGAGG - Intronic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
949710154 3:6862519-6862541 AGCATCTCTCCACCTGAGGAAGG - Intronic
949923269 3:9021123-9021145 TCCATCCCTCTTCTTGAGGCAGG + Intronic
950153036 3:10703179-10703201 GACACCCCGCCTCCTGAGGGTGG - Intronic
950260731 3:11542043-11542065 TGCATCCCTGGCCCTGTGGGAGG - Intronic
950525302 3:13519548-13519570 CTCATCCCACCTCCTGACGGGGG - Intergenic
953367626 3:42359570-42359592 TGCATCCTTCTTCCTAAGTGTGG + Intergenic
953378972 3:42452220-42452242 TGCACCCTACCTCCTGAGGTAGG + Intergenic
953648034 3:44773425-44773447 TGCATCCCTCCCCTTCTGGGTGG - Intronic
954405573 3:50343327-50343349 GGGATCCCTCCCCCTCAGGGGGG + Exonic
954751592 3:52817167-52817189 GGCACCCCTCCTGATGAGGGAGG - Intronic
957595504 3:82259923-82259945 TGCAACCCTACTCCTGATGCTGG + Intergenic
958594266 3:96201503-96201525 TGCTGCCCTCCTGCTGGGGGAGG + Intergenic
960898052 3:122526940-122526962 TGCATCCCTCCTCCTGAGGGTGG - Intergenic
967407915 3:189138030-189138052 TGTGTCCCTCCTCTTGAGGCAGG - Intronic
968224598 3:196965888-196965910 TGCATCCTTCCTTCTGACTGCGG + Intronic
968936612 4:3614399-3614421 CGCATTCCTCCTTCTGAGGGAGG - Intergenic
969897698 4:10320676-10320698 TGTTTCCCTCCTCCTGATGACGG + Intergenic
969917033 4:10501143-10501165 TGCATCCCTCTCCTTCAGGGCGG + Intronic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
972693325 4:41420628-41420650 TGCATCTCACCTCCTTGGGGAGG - Intronic
973731037 4:53822518-53822540 TGCCCCCCGCCACCTGAGGGAGG - Intronic
975853984 4:78603016-78603038 TTCAGCTCTCCTCCTGAGAGAGG + Intronic
979444517 4:120795276-120795298 TGCTTCCCTCCTCCTGCTGTAGG - Intronic
983643807 4:169969575-169969597 AGCATCCATCCTTTTGAGGGGGG - Intergenic
984355384 4:178652390-178652412 TGCATCCCTCCTACAAAGCGTGG - Intergenic
985671365 5:1208668-1208690 TGAATGCCTGCTCCCGAGGGAGG + Intronic
987160250 5:15134170-15134192 TGCATCTCTTTGCCTGAGGGTGG + Intergenic
992769816 5:80036011-80036033 TACATCGCTCCGCCTGAGGAAGG - Intronic
994696609 5:103079767-103079789 TACATCCCTCCTCCTTGGGCAGG - Intergenic
994968427 5:106703779-106703801 TGGCTCCCTCTTCCTGGGGGAGG + Intergenic
997470871 5:134115989-134116011 TGCTGCCCTGCTCCCGAGGGGGG - Exonic
997507550 5:134430105-134430127 TGCCTTCTTCCTCCTGAGAGGGG - Intergenic
997985617 5:138499197-138499219 TGCCTCCCACCTCCAGAGAGCGG - Intergenic
998651247 5:144124135-144124157 TGCATTCCTCCTTTAGAGGGTGG + Intergenic
998850074 5:146343749-146343771 TGCATCGGGCCTCCGGAGGGTGG + Intergenic
1000339884 5:160268909-160268931 TGCAGCCCTGCTCTTGAGAGAGG - Intronic
1001401307 5:171448172-171448194 TGGACCCCTCATCCTGAGGGAGG + Intronic
1001668571 5:173454379-173454401 TACATCCCACCTCCAGTGGGAGG - Intergenic
1002930389 6:1630433-1630455 TGCTCCCCACCTCCTGAGTGGGG + Intronic
1003152376 6:3563737-3563759 TACAGCCCTCATCCTGAGGAGGG + Intergenic
1003599438 6:7503588-7503610 TGCATTCCACCTTCTTAGGGTGG - Intergenic
1005650329 6:27879570-27879592 TCCCTCCCTCCTCCTGGGGTGGG - Intergenic
1006188226 6:32192226-32192248 AGCCTTCCTCATCCTGAGGGGGG + Exonic
1007305127 6:40897745-40897767 GGCACCCCTCCTGTTGAGGGGGG + Intergenic
1007427405 6:41756509-41756531 AGCTTCCTTCCTGCTGAGGGAGG - Intergenic
1008598446 6:53065716-53065738 AGCACCCCTCCTCCGGGGGGCGG + Intronic
1008939085 6:57026269-57026291 TGCATCACTAGTACTGAGGGTGG - Exonic
1010185495 6:73139086-73139108 TGCCTGCCTCCTCCTCAGGCTGG + Intronic
1010584420 6:77641387-77641409 TGCATTCCACCTCTTGTGGGAGG + Intergenic
1013350369 6:109300304-109300326 GGCACTCCTCCTCCGGAGGGAGG + Intergenic
1013944668 6:115707099-115707121 TGCATTCCTCCTACATAGGGTGG - Intergenic
1016762869 6:147758797-147758819 TCCTTCCCTCCTCCTGTTGGGGG + Intergenic
1019616224 7:1963809-1963831 TGCTTCGCTCCTCTTGAGGCAGG + Intronic
1019805191 7:3118329-3118351 TGCCTCACCCCTCCTGAGTGTGG - Intergenic
1023301735 7:38780376-38780398 AGCCTTCCTCCTCCTGATGGAGG + Intronic
1023352763 7:39336589-39336611 TGCTTCCTTCCTCCTCAGCGTGG + Intronic
1024093732 7:45968201-45968223 TCCCACCCTTCTCCTGAGGGTGG + Intergenic
1024249474 7:47495469-47495491 TGCAGGCCTCGTCCTCAGGGCGG - Intronic
1030994025 7:116335937-116335959 TGCATCCATCCTCATGTGGCAGG - Intronic
1031798404 7:126208981-126209003 TGAATCCTTTCTCCTTAGGGAGG - Intergenic
1035025271 7:155820843-155820865 TGCAGGCCTCCTACTGTGGGAGG - Intergenic
1035583366 8:754013-754035 TGGAGCCCTCTTTCTGAGGGTGG + Intergenic
1035863947 8:3060892-3060914 AGCATCTCTCCTCCGGAGAGAGG - Intronic
1036440858 8:8780658-8780680 TGCCTCCCTCCTCCTGGTGAAGG - Intergenic
1039798917 8:40937768-40937790 TCCATCCATCCCCCTGAGTGTGG + Intergenic
1040485516 8:47867807-47867829 TGCATGCTTCCTCCTGAGATTGG - Intronic
1041583208 8:59486381-59486403 TGTTTCCCTCCTCCTGTGTGTGG + Intergenic
1041756857 8:61323390-61323412 TCCATTCCACCTCTTGAGGGAGG + Intronic
1042568274 8:70134607-70134629 TGCCTGCCTCCTCCTGACAGTGG - Intronic
1042691012 8:71498909-71498931 TGCAAACATCCTCCTGAGGAAGG + Intronic
1045659111 8:104418117-104418139 TGCATCCGTTCTCCAGAGGCTGG + Intronic
1046092906 8:109524497-109524519 TGCTCACCTCCTCATGAGGGTGG + Intronic
1048316906 8:133369535-133369557 TGCATCTCTCTTCCTAGGGGCGG - Intergenic
1049000629 8:139823603-139823625 TGCATCCCTCTTCCTGGGCATGG - Intronic
1049263499 8:141652645-141652667 TCCATCCCTGCTCCTCATGGGGG - Intergenic
1049501951 8:142971681-142971703 GGCCTCCCACCTCCCGAGGGTGG + Intergenic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1049678575 8:143904750-143904772 GGCAGCCTTCCTCCTGAGGTAGG + Intergenic
1050012796 9:1201822-1201844 AGCAGCCCTGCTCCTGTGGGAGG + Intergenic
1050480751 9:6084829-6084851 GGCATCCATCCTCCTCAGGAAGG + Intergenic
1050978047 9:11967157-11967179 TGCATGCTCCCTCCTGAGAGGGG + Intergenic
1052988047 9:34502267-34502289 TGTGTCCCCACTCCTGAGGGTGG + Intronic
1053167676 9:35856042-35856064 TGCATCCCTCCCAGTGAGGAGGG + Intergenic
1053558473 9:39163176-39163198 TACAGCCCTCATCCTGAAGGAGG + Intronic
1053822590 9:41983401-41983423 TACAGCCCTCATCCTGAAGGAGG + Intronic
1054138641 9:61455765-61455787 TACAGCCCTCATCCTGAAGGAGG - Intergenic
1054607985 9:67203964-67203986 TACAGCCCTCATCCTGAAGGAGG - Intergenic
1057725210 9:97563665-97563687 TGCATCAATCTTCCAGAGGGAGG - Intronic
1060755015 9:126206304-126206326 TGCCTCGCTCCACCTCAGGGGGG + Intergenic
1060766559 9:126298459-126298481 TGCCTCCCTCCTCCTGACCCAGG + Intergenic
1061445036 9:130632757-130632779 TGCATCCCGCCTCTCCAGGGAGG + Intronic
1061942481 9:133891245-133891267 CCCATCCCTCCTGCTGAGAGTGG - Intronic
1061973282 9:134056010-134056032 TGCATGCCTCGTCCTGGGTGGGG + Intronic
1185536038 X:862339-862361 GACCTCCTTCCTCCTGAGGGTGG + Intergenic
1186514528 X:10156773-10156795 TGCAGCCCAGCCCCTGAGGGTGG + Intergenic
1189949036 X:46209830-46209852 CGCATTCCTACACCTGAGGGTGG + Intergenic
1192344367 X:70289250-70289272 TGGATTCCTCCTCATGAGGTGGG - Exonic
1192784890 X:74325937-74325959 TGCTTACTTCCTCCTGAGGCAGG + Intergenic
1193418763 X:81257746-81257768 TGCTTCCCTCCCCTTGAGTGTGG - Intronic