ID: 960899303

View in Genome Browser
Species Human (GRCh38)
Location 3:122538592-122538614
Sequence GACTCAAAATTGTCAATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960899301_960899303 16 Left 960899301 3:122538553-122538575 CCAAAAGTGCCATCGTGCGGCAG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 960899303 3:122538592-122538614 GACTCAAAATTGTCAATAGCTGG 0: 1
1: 1
2: 0
3: 10
4: 151
960899302_960899303 7 Left 960899302 3:122538562-122538584 CCATCGTGCGGCAGAGCAAGAGA 0: 1
1: 0
2: 3
3: 2
4: 49
Right 960899303 3:122538592-122538614 GACTCAAAATTGTCAATAGCTGG 0: 1
1: 1
2: 0
3: 10
4: 151
960899299_960899303 25 Left 960899299 3:122538544-122538566 CCTCAACTACCAAAAGTGCCATC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 960899303 3:122538592-122538614 GACTCAAAATTGTCAATAGCTGG 0: 1
1: 1
2: 0
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960899303 Original CRISPR GACTCAAAATTGTCAATAGC TGG Intronic
901555841 1:10030838-10030860 TACTCATAATTGTCAAAAGGTGG + Intergenic
903223612 1:21882780-21882802 GAGTCAAAGTTGTCCAGAGCCGG - Intronic
905286566 1:36884209-36884231 GACTCAAAGGTGACAAGAGCAGG - Intronic
907967922 1:59351281-59351303 GACTCAGCATTGTCAAGACCAGG - Intronic
909988482 1:82192054-82192076 GACTCAAAGGTGTTAAAAGCTGG - Intergenic
911776017 1:101813725-101813747 GACTCAAAATGCCCAATTGCAGG + Intronic
912512135 1:110196798-110196820 GACTCAATATTTTCAATAACTGG + Intronic
913378081 1:118177200-118177222 GACTCACAATTCTCTATTGCTGG + Intronic
920103322 1:203532166-203532188 TACTTGAAATTGTCAAAAGCTGG + Intergenic
920171842 1:204076755-204076777 GACTAAAAACTGCCAATTGCAGG - Intronic
920595728 1:207268035-207268057 GATTCTAAATTGTAAATTGCGGG + Intergenic
922082501 1:222310560-222310582 GACTCAAGATGGACTATAGCAGG + Intergenic
923559840 1:235030702-235030724 GACTCTAAAAAGTAAATAGCCGG + Intergenic
923891059 1:238215296-238215318 GACTCAAAGTTCTGCATAGCTGG + Intergenic
923970289 1:239194498-239194520 AACTAAAAATTGTTAATAGTGGG + Intergenic
1063158797 10:3404159-3404181 GACAGAAAAGTGGCAATAGCGGG + Intergenic
1066499620 10:35978227-35978249 TACTCACAATGGTCAAAAGCTGG - Intergenic
1067190311 10:44062962-44062984 TACTCAAAATAGTCAAAACCTGG + Intergenic
1068937884 10:62653919-62653941 AACTCAAATTTGTAAATAGGAGG + Intronic
1069213239 10:65787869-65787891 GACTCAAAATTATATACAGCTGG - Intergenic
1070100883 10:73385543-73385565 GACTCAAAGATGACTATAGCAGG + Intronic
1079467505 11:20745266-20745288 GACTTATAATTTTCAATAGTTGG - Intronic
1079977453 11:27109627-27109649 GACTCAAATATGGCAATAGTTGG + Intronic
1080068424 11:28047753-28047775 GACTCAAAAATATGAATAGGAGG + Intronic
1080356991 11:31460484-31460506 GACTCAAAATTTTATCTAGCTGG + Intronic
1084735885 11:71105046-71105068 GACCCACAATTGCCAAAAGCTGG + Intronic
1086370454 11:86151103-86151125 GACTCTAAATTGCCAAAAGCAGG - Intergenic
1087108262 11:94433729-94433751 GACTCAAATTTCTACATAGCTGG - Intronic
1088049937 11:105499813-105499835 TATTCATAATTGCCAATAGCTGG - Intergenic
1088445177 11:109918694-109918716 TATTCATAATTGTCAAAAGCTGG - Intergenic
1089862478 11:121602300-121602322 GATAAAAAATTGTCAATAGAAGG - Intronic
1097521031 12:60671570-60671592 CAATCACAAGTGTCAATAGCAGG - Intergenic
1098820538 12:75222123-75222145 GACTCAAAGTTCTGCATAGCTGG - Intergenic
1099429447 12:82564771-82564793 GACTCACAATTCTGCATAGCTGG + Intergenic
1099601307 12:84741767-84741789 GACTCCAAGTTGTAAATGGCTGG - Intergenic
1100159823 12:91844622-91844644 GACTCACAGTTCTGAATAGCTGG - Intergenic
1100199673 12:92284821-92284843 GACACAAATTTATCAACAGCTGG + Intergenic
1102066403 12:109979664-109979686 AACTCAAAAGTGTCATCAGCTGG - Intronic
1104018566 12:124976382-124976404 GGGTCAAAAGTGCCAATAGCAGG + Intronic
1105969346 13:25413919-25413941 GACTGAAAATCTTCAATAGTTGG + Intronic
1108793561 13:54002740-54002762 GACAGAGAATTGTCGATAGCAGG + Intergenic
1109146755 13:58789593-58789615 CAATCAAAAGTATCAATAGCAGG - Intergenic
1109591019 13:64482005-64482027 GACACAAAATTGTCAAAAACTGG - Intergenic
1109645382 13:65247181-65247203 GACTCATTATTCTCAATAGAAGG - Intergenic
1111475216 13:88737651-88737673 GCCTCAAAATTCCAAATAGCTGG - Intergenic
1111537693 13:89625525-89625547 AAATCAAAATTGTTAATAGTGGG - Intergenic
1112524594 13:100132584-100132606 TATTCATAATTGTCAAAAGCTGG - Intronic
1113419326 13:110158102-110158124 GTCTCAAAACAGTCAATATCTGG + Intronic
1115435789 14:33371625-33371647 TAATCAAAATACTCAATAGCAGG - Intronic
1118465228 14:66024692-66024714 GACTCACTGTTGTCAATAGGTGG + Intergenic
1118489278 14:66243593-66243615 CACACAAAGTTGTCAATACCTGG - Intergenic
1120262903 14:82210493-82210515 GGATAAAAATTGTCAATATCAGG - Intergenic
1120381507 14:83786198-83786220 GACTCAAAATGAAGAATAGCTGG - Intergenic
1120381838 14:83790383-83790405 GACTCAAAATGAAGAATAGCTGG + Intergenic
1122161679 14:99789146-99789168 TACTCAAAATTGTTGAAAGCAGG - Intronic
1125582721 15:40798056-40798078 TACTCACAATAGTCAAAAGCTGG + Intronic
1126726707 15:51639231-51639253 AACTCAGAATTGTCAATGTCAGG + Intergenic
1127277743 15:57462056-57462078 GACTTTAAAAGGTCAATAGCAGG - Intronic
1130092750 15:80834852-80834874 GACTCAATATTGTAAATATTTGG - Intronic
1131280789 15:91019454-91019476 AACTCAAAATGGTCAACAGAGGG + Intronic
1131372026 15:91890507-91890529 GAATCAGAATTGTCAATGCCAGG - Intronic
1136052867 16:27665489-27665511 GACTCAAAGTTCTCCACAGCTGG - Intronic
1139137795 16:64225770-64225792 GACTCACAATTCTGAATGGCTGG + Intergenic
1140152568 16:72385137-72385159 TATTCACAATTGTCAAAAGCTGG + Intergenic
1141238742 16:82244761-82244783 GACTCACAATTCTGAATGGCTGG - Intergenic
1143429435 17:6869816-6869838 TATTCAAAATTGTCAACAACTGG - Intergenic
1143798880 17:9361086-9361108 GACTGAAAATTGTCATTGCCTGG + Intronic
1146356660 17:32140101-32140123 GAGTCAACATTGTCATTAACTGG + Intergenic
1147849859 17:43433665-43433687 AACTCAAAAATGAGAATAGCAGG - Intergenic
1150464510 17:65380645-65380667 GACTCAAAATTGCACATAGCTGG - Intergenic
1151168915 17:72229271-72229293 TATTCATAATTGTCAAAAGCAGG - Intergenic
1152136697 17:78508159-78508181 GACTCAAAATTGTCAATTGCAGG - Intronic
1152433995 17:80264134-80264156 AACTGAAAATTTTCAAAAGCAGG - Intronic
1153009761 18:527939-527961 GACTGATACTTGACAATAGCAGG - Intergenic
1157647552 18:49291722-49291744 GAATTAAAATTGTCAATAATTGG + Intronic
1159013169 18:63078288-63078310 GACTCAAAATTCAACATAGCTGG - Intergenic
1159086047 18:63792930-63792952 GACTTAAAATTGTTAACAGAAGG - Intronic
1159461310 18:68724970-68724992 GACTCACAATTCTGCATAGCTGG + Intronic
1163990819 19:20997858-20997880 GACTCAAAATTCTGCATGGCTGG + Intergenic
1164094939 19:21999723-21999745 GACTCAGAATTGTCTTTATCTGG - Intronic
1164114460 19:22204822-22204844 GACTCAGAATTGTCTTTATCTGG - Intergenic
1164198605 19:22996667-22996689 GACTCAGAATTGTCTTTATCTGG - Intronic
1168224843 19:54987267-54987289 GCTTGAAAAATGTCAATAGCTGG - Intronic
926262930 2:11283976-11283998 TACTCATAATTGTCAAAACCTGG + Intronic
928941949 2:36735399-36735421 GACTCCAAACTGCCAATTGCTGG + Intronic
936273735 2:111072512-111072534 TACTCACAATTGTCAAAAACTGG - Intronic
940455387 2:153891695-153891717 TACTCTACATTGTCAATAGAGGG + Intronic
940621155 2:156115393-156115415 GACTCAAAATTTCTAATGGCTGG - Intergenic
943314253 2:186366422-186366444 GACTCAAAGTAATCAATAGCTGG - Intergenic
943414339 2:187581443-187581465 TCCTCAAAAGTGTCAATAGTAGG - Intergenic
943783295 2:191848118-191848140 GTCTCAAAATTGTTCATAGAAGG - Intergenic
944893449 2:204140704-204140726 AAATCAGAATTGTCAATAGAGGG - Intergenic
946098470 2:217297136-217297158 GACTAAGAATTTTCAAAAGCTGG + Intronic
946750249 2:222887350-222887372 GATTCATAATTGCCAAAAGCTGG - Intronic
947144031 2:227047795-227047817 AACTCAAACTTATCAATACCTGG - Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
947406654 2:229784992-229785014 TACTCAAAATAGTCAAAAACTGG + Intronic
948013560 2:234669839-234669861 GACTCCAAATTGACTATAGGAGG + Intergenic
1173215800 20:41081989-41082011 AACTCAAAAGTGTCAAAAGGAGG - Intronic
1173482320 20:43412313-43412335 GAACCAAAATTATCAATATCGGG + Intergenic
1180919198 22:19510917-19510939 TAGTCATAATTGTCAATAGGTGG - Intronic
949796547 3:7857698-7857720 AACTTAAAACTGTCAATATCAGG - Intergenic
953320531 3:41967188-41967210 GTCTTAAAATTATCTATAGCAGG - Intergenic
953596851 3:44323686-44323708 AACTAAAAATATTCAATAGCAGG + Intronic
954970118 3:54645100-54645122 GACTCACAATTGTGCATGGCTGG + Intronic
955485896 3:59434045-59434067 GACTCACAGTTGTATATAGCTGG - Intergenic
956834499 3:73084928-73084950 GATTCTAAATTTTTAATAGCAGG + Intergenic
958087070 3:88823967-88823989 GAGCCAAAAATGTCAATAGGAGG + Intergenic
960076475 3:113491318-113491340 GACTCAAGATTATCTATAGCAGG + Intronic
960899303 3:122538592-122538614 GACTCAAAATTGTCAATAGCTGG + Intronic
961985618 3:131130028-131130050 GACTCAATATTGTCAAGATATGG - Intronic
965776617 3:172238453-172238475 GACTTAAAAATGTCAGTAGAGGG - Intronic
968021678 3:195396967-195396989 CAATCTAAATTGCCAATAGCAGG + Intronic
970834060 4:20379601-20379623 CACTCAAAATAGTCAAAGGCAGG - Intronic
971765724 4:30828435-30828457 GCCACAAAAATGTGAATAGCTGG - Intronic
976543984 4:86311920-86311942 GAATCAAAATAGCCAATAGAAGG + Intronic
977959024 4:103063827-103063849 AACTCAAAAAACTCAATAGCAGG + Intronic
977988038 4:103408153-103408175 GTTTAAAAGTTGTCAATAGCTGG + Intergenic
979082162 4:116358767-116358789 TACTCAAAACTGTCAGTAGATGG + Intergenic
979725416 4:123955438-123955460 GAATCAAAACAGTGAATAGCTGG + Intergenic
980029221 4:127806957-127806979 GCCTCAAAATTGACATTATCTGG - Intronic
980804278 4:137791707-137791729 TCTTCGAAATTGTCAATAGCAGG + Intergenic
983079376 4:163366274-163366296 GACTCACAATTCTGCATAGCTGG - Intergenic
988833094 5:35005954-35005976 CACACCAAATTGTCAATAGAAGG - Intronic
990109275 5:52304091-52304113 TACTCATAATTGTCAAAAACTGG + Intergenic
991420585 5:66437372-66437394 CACTTAACATTGTCTATAGCAGG + Intergenic
996432288 5:123395269-123395291 GAAGCAAGATTGTCACTAGCCGG + Intronic
996565213 5:124872852-124872874 GCCTCAACATTGCCAACAGCTGG - Intergenic
999685166 5:154096264-154096286 GCCTCAAAATTGGCAAGATCAGG + Intronic
1000394368 5:160758056-160758078 GAGTCAACATTTTTAATAGCAGG + Intronic
1002425763 5:179174261-179174283 GAAACAAAATTGTCAATGGAAGG - Intronic
1006068834 6:31482326-31482348 GATTGAAAATTGACAATGGCAGG - Intergenic
1011662074 6:89603197-89603219 GACTCAAAAGTTTCCAGAGCGGG - Intronic
1012777633 6:103518177-103518199 TACTCATAATTGCCAATAGTTGG - Intergenic
1013502690 6:110768455-110768477 TACTCATAATTGCCAAAAGCTGG + Intronic
1013829356 6:114254307-114254329 GCTTCAAAATAGTAAATAGCTGG + Intronic
1014028678 6:116677224-116677246 GACTCAAAGTTATCAGTAGCAGG - Intergenic
1023019658 7:35999190-35999212 GACTCAAAATTCTGCATGGCTGG - Intergenic
1024104894 7:46073169-46073191 GACTCAAAATTTGAAATAGCTGG - Intergenic
1024679656 7:51672301-51672323 GGCTCTGAATTGTCAATAACAGG + Intergenic
1024841289 7:53590647-53590669 AAATAAAAATTGTCAATGGCTGG - Intergenic
1027507750 7:79039289-79039311 GACTCACAATTCTGCATAGCTGG - Intronic
1028617295 7:92782849-92782871 GACTTAAAAATGTCAATATCTGG + Intronic
1033996918 7:147361914-147361936 AACTCAAAATTCTCAAGAGCTGG + Intronic
1036119827 8:6004038-6004060 AAATCAAAATTCTCAACAGCAGG + Intergenic
1037372000 8:18190088-18190110 GAATATAAAATGTCAATAGCAGG - Intronic
1037724814 8:21474346-21474368 GACTCACAATTATCAGTGGCTGG - Intergenic
1039208576 8:35185098-35185120 GTCTCAAAATTCTGATTAGCTGG + Intergenic
1039414736 8:37384112-37384134 GACTCAAAATTATATATAGGTGG + Intergenic
1040587930 8:48762058-48762080 GCCTCAACCTTGTCAGTAGCTGG + Intergenic
1041085443 8:54252263-54252285 GACTCAAAATTATAAAAAGAAGG - Intergenic
1042435102 8:68755283-68755305 GACTCAAAATTTTCAGTGTCAGG - Intronic
1044188723 8:89287660-89287682 GTTTTAAAATTGTAAATAGCAGG - Intergenic
1044744989 8:95363040-95363062 AACTCTAAAGTGTCCATAGCTGG - Intergenic
1045629682 8:104103912-104103934 GCCTCAAATTTGTCACTTGCAGG - Intronic
1051115649 9:13691212-13691234 TATTCATAATTGTCAAAAGCTGG - Intergenic
1053380036 9:37641303-37641325 GACTTAAAAGTGTCAAGATCTGG + Intronic
1056131084 9:83587178-83587200 TACTCAAAATAATCAAAAGCAGG + Intergenic
1057996068 9:99822477-99822499 CACTCAAAGTTGTCAATTTCAGG - Intronic
1192606176 X:72520985-72521007 AACTCAGCATTGTCAGTAGCAGG - Intronic
1194877552 X:99208214-99208236 GAATAAAACTTGTCAATAGTAGG - Intergenic
1196680200 X:118462584-118462606 GCCTCAACATTGTGAGTAGCTGG - Intergenic
1198581601 X:138071537-138071559 GACTAAAAATAGACAGTAGCTGG + Intergenic