ID: 960900324

View in Genome Browser
Species Human (GRCh38)
Location 3:122548022-122548044
Sequence GCGCCTCACCCACAGCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960900324_960900327 -10 Left 960900324 3:122548022-122548044 CCAGTTAGCTGTGGGTGAGGCGC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 960900327 3:122548035-122548057 GGTGAGGCGCAGTGGGATACTGG 0: 1
1: 0
2: 0
3: 8
4: 164
960900324_960900328 -4 Left 960900324 3:122548022-122548044 CCAGTTAGCTGTGGGTGAGGCGC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 960900328 3:122548041-122548063 GCGCAGTGGGATACTGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960900324 Original CRISPR GCGCCTCACCCACAGCTAAC TGG (reversed) Intronic
900439290 1:2645359-2645381 GCGCCTCCCCCACAGCAAGGAGG + Exonic
901109624 1:6784895-6784917 GCGCGTCCCCCACAGCCACCGGG + Intergenic
909969932 1:81970587-81970609 GACCCTCACTGACAGCTAACAGG - Intronic
912596087 1:110877885-110877907 GCACCTCAGCCACTGCTCACAGG + Intronic
913942419 1:125120284-125120306 GTGCCTCACCCTCAGTCAACAGG - Intergenic
917515214 1:175701470-175701492 GCTCCTCAACCCCAGCTGACTGG + Intronic
919616345 1:199813530-199813552 CCACCTCACCCACAGCCAATTGG + Intergenic
1074705103 10:116123231-116123253 GCTCCTAGCCCACAGCTAAGAGG + Intronic
1083341273 11:61959897-61959919 GCATCTCATCCACAGCCAACAGG - Exonic
1084120706 11:67067326-67067348 GCCCCTCACCCACTGCTGCCAGG + Intronic
1084199140 11:67543645-67543667 GAGCCTGAGCCACAGCCAACTGG - Intergenic
1084424601 11:69077429-69077451 GCGTCTCATCCACAGTGAACGGG - Intronic
1087078073 11:94144035-94144057 CCCCCTCACCCATATCTAACTGG + Intronic
1090074714 11:123572967-123572989 GCGCCTCTGCCTCAGCTATCGGG - Intronic
1092087686 12:5777186-5777208 GTGCCTCACCTACAGCTAACTGG - Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101724392 12:107377054-107377076 GGGCCTCCCCCACAGCTGAGGGG + Intronic
1122323119 14:100867261-100867283 GAGCCTAACCCAGAGCTAATGGG - Intergenic
1122508246 14:102245864-102245886 GCACCTCACCAACTTCTAACTGG + Intronic
1122801254 14:104230710-104230732 GCCCCTCCCCCACAGCCAGCCGG - Intergenic
1133168456 16:3965126-3965148 GCGGCTCACCCACAGCCCACGGG + Exonic
1136696131 16:32083799-32083821 GTGCCTCACCCTCAGTCAACAGG + Intergenic
1136796625 16:33027051-33027073 GTGCCTCACCCTCAGTCAACAGG + Intergenic
1139974142 16:70795638-70795660 TCGCCTCCCCCACAGCCAGCAGG + Intronic
1144994504 17:19258095-19258117 TTCCCTCACCCACATCTAACTGG - Intronic
1147554423 17:41467341-41467363 TCTCCTCAGCCACAGCTACCTGG + Exonic
1148777632 17:50104653-50104675 GGGCATCACCCACTGCTACCTGG + Intronic
1161043082 19:2120467-2120489 CCACCTCACCTACAGCAAACAGG + Intronic
1162789901 19:13057438-13057460 GCTCCTCGCACACAGCTAATGGG - Intronic
927428609 2:23007981-23008003 CAGCCCCACCCACAGCTATCAGG - Intergenic
933229147 2:79785712-79785734 GTGCCTGACACACAGCTAGCTGG + Intronic
941554379 2:166958185-166958207 GCCCCTCACCCACAGTCAATGGG - Intronic
941901129 2:170679514-170679536 CCGCCCCACCCACAGTTAAAGGG + Intergenic
946856797 2:223957777-223957799 GCCCCGCGCCCACAGCTCACGGG - Intronic
946955725 2:224928037-224928059 GAGCCTCACCCACTGCTGAAGGG + Intronic
1175878803 20:62244455-62244477 GCGCATGCCCCACAGCTCACGGG - Intronic
1177604203 21:23357704-23357726 GGGTCTCACCCACAGCTTATGGG + Intergenic
1179902527 21:44401476-44401498 GAGCCTCACACACAGCCACCGGG - Intronic
1185267905 22:49914246-49914268 GTGCCTCCCACCCAGCTAACTGG - Intronic
949787529 3:7758370-7758392 GCCCCTCACCTACAGTTCACTGG + Intergenic
952425711 3:33172426-33172448 GAGCCACACCCACAGCCAAATGG - Intronic
952713688 3:36456728-36456750 GCACCTCATCCTCAGCTACCTGG + Intronic
954582854 3:51712394-51712416 GTGCATCCCCCACAGCTAGCAGG - Intronic
958928992 3:100189271-100189293 GTGCCTCAGCCAGAGCTCACAGG + Intronic
960900324 3:122548022-122548044 GCGCCTCACCCACAGCTAACTGG - Intronic
960997606 3:123350237-123350259 TCTCCTCACACACAGTTAACAGG - Intronic
968867041 4:3219732-3219754 GCACCTCACGCACAGAGAACTGG + Intronic
969480424 4:7443991-7444013 GTGCCTCACCCACAGGTAAAGGG + Intronic
976808023 4:89070131-89070153 TGGGCTCAGCCACAGCTAACAGG - Intronic
981652993 4:147080020-147080042 GCACCTCACCAGCAGCTGACAGG + Intergenic
981707356 4:147674856-147674878 GCTGCTCACCCACAGATTACTGG - Intronic
998398441 5:141834826-141834848 GCTCCTCATCCCCAGCTGACTGG - Intergenic
999373586 5:151071020-151071042 GCGCCCCCCCCACCCCTAACAGG - Intronic
1003054374 6:2805371-2805393 GGGCCCCACCCACAGCAAATAGG + Intergenic
1012525503 6:100172269-100172291 CCTCCTCACCCCCAGCTAAATGG - Intergenic
1035125481 7:156605649-156605671 GTGCCTCACCCACAGCCATGCGG + Intergenic
1036558777 8:9884077-9884099 TCCCCTCACCCTCAGCTATCAGG - Intergenic
1038532459 8:28329374-28329396 AGGCCTCTCCCACAGCTCACAGG + Intronic
1048482170 8:134808352-134808374 GCTCCTAATCCACAGCTAGCTGG - Intergenic
1048906289 8:139092691-139092713 GCTCCTCCCCCACACTTAACAGG - Intergenic
1054769498 9:69070392-69070414 GCGCCCCGCCCACAGCTGACAGG + Intronic
1057192751 9:93096480-93096502 GCGCACCACCGACAGCTGACGGG - Intronic
1060719405 9:125965249-125965271 GAGCCTCAGCCACAGATAATTGG + Intronic
1198965913 X:142228764-142228786 ACGCCTGAACCACAGCTACCAGG + Intergenic
1199372023 X:147060673-147060695 TCCTATCACCCACAGCTAACAGG + Intergenic