ID: 960902274

View in Genome Browser
Species Human (GRCh38)
Location 3:122564629-122564651
Sequence CCCAGAGGGCTTTCGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960902274_960902280 -9 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902280 3:122564643-122564665 CCCTCTGGGGGCCCGGCCCCCGG 0: 1
1: 0
2: 2
3: 50
4: 498
960902274_960902293 26 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902293 3:122564678-122564700 ACCCAGTTCCAGCTGACCTAGGG 0: 1
1: 0
2: 3
3: 32
4: 184
960902274_960902282 -8 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902282 3:122564644-122564666 CCTCTGGGGGCCCGGCCCCCGGG 0: 1
1: 0
2: 3
3: 43
4: 438
960902274_960902283 0 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902283 3:122564652-122564674 GGCCCGGCCCCCGGGTTTCCAGG 0: 1
1: 0
2: 0
3: 19
4: 191
960902274_960902295 27 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902295 3:122564679-122564701 CCCAGTTCCAGCTGACCTAGGGG 0: 1
1: 0
2: 0
3: 10
4: 125
960902274_960902286 3 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902286 3:122564655-122564677 CCGGCCCCCGGGTTTCCAGGCGG 0: 1
1: 0
2: 1
3: 6
4: 155
960902274_960902292 25 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902292 3:122564677-122564699 GACCCAGTTCCAGCTGACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960902274 Original CRISPR CCCAGAGGGCTTTCGCAGCC TGG (reversed) Intronic